J. vet. Pharmacol. Therap. doi: 10.1111/jvp.12204
In vitro assessment of chloramphenicol and florfenicol as second-line antimicrobial agents in dogs M. G. MAALAND* S. S. MO
†
S. SCHWARZ ‡ & L. GUARDABASSI* *Department of Veterinary Disease Biology, Faculty of Health and Medical Sciences, University of Copenhagen, Frederiksberg, Denmark; †National Veterinary Institute, Oslo, Norway; ‡Institute of Farm Animal Genetics, Friedrich-Loeffler-Institut (FLI), Neustadt-Mariensee, Germany
Maaland, M. G., Mo, S. S., Schwarz, S., Guardabassi, L. In vitro assessment of chloramphenicol and florfenicol as second-line antimicrobial agents in dogs. J. vet. Pharmacol. Therap. doi: 10.1111/jvp.12204. The aim of this study was to evaluate the potential of chloramphenicol and florfenicol as second-line antimicrobial agents for treatment of infections caused by methicillin-resistant Staphyococcus pseudintermedius (MRSP) and extended-spectrum b-lactamase (ESBL)-producing Escherichia coli in dogs, through a systematic in vitro assessment of the pharmacodynamic properties of the two drugs. Minimum inhibitory concentrations (MIC) and phenicol resistance genes were determined for 169 S. pseudintermedius and 167 E. coli isolates. Minimum bactericidal concentrations (MBC), time-killing kinetics, and postantibiotic effect (PAE) of both agents against wild-type isolates of each species were assessed. For S. pseudintermedius, the chloramphenicol MIC90 was 32 lg/mL. No florfenicol resistance was detected in this species (MIC90 = 4 lg/mL). The MIC90 of both agents against E. coli was 8 lg/mL. Resistance genes found were catpC221 in S. pseudintermedius and catA1 and/or floR in E. coli. The phenicols displayed a time-dependent, mainly, bacteriostatic effect on both species. Prolonged PAEs were observed for S. pseudintermedius, and no PAEs were detected for E. coli. More research into determination of PK/PD targets of efficacy is needed to further assess the clinical use of chloramphenicol and florfenicol as second-line agents in dogs, optimize dosage regimens, and set up species-specific clinical break points. (Paper received 4 August 2014; accepted for publication 29 December 2014) Luca Guardabassi, Department of Veterinary Disease Biology, Faculty of Health and Medical Sciences, University of Copenhagen, Stigbøjlen 4, 1870 Frederiksberg C, Denmark. E-mail: [email protected]
INTRODUCTION Staphylococcus pseudintermedius and Escherichia coli are opportunistic pathogens and responsible for a wide range of infections in dogs. S. pseudintermedius is the most common cause of pyoderma (Bannoehr & Guardabassi, 2012), while E. coli is the main pathogen causing urinary tract infections (Ling et al., 2001). Occurrence of methicillin-resistant S. pseudintermedius (MRSP) and extended-spectrum b-lactamase (ESBL)-producing E. coli is increasing worldwide among clinical isolates (Ewers et al., 2012; Frank & Loeffler, 2012). Some infections caused by multidrug-resistant bacteria are difficult to manage as they cannot be treated with any of the veterinary antimicrobial agents available for systemic therapy in dogs, thereby often leading to euthanasia due to animal welfare and owner safety reasons (Rutland et al., 2009; Schwartz et al., 2009; Bengtsson & Greko, 2014). Veterinary use of antimicrobial agents that are not authorized for veterinary use and considered critically important in human medicine (e.g., vancomycin and carbapen-
© 2015 John Wiley & Sons Ltd
ems) has been discouraged due to public health concerns (Spohr et al., 2012). Therefore, novel antimicrobial strategies such as investigation of older or alternative antimicrobials that are neither extensively used in small animal medicine nor considered as critically important in human medicine are needed (Papich, 2012). Among alternative antimicrobial agents, phenicols, such as chloramphenicol and florfenicol, are potentially valuable options. Chloramphenicol was widely used in human and veterinary medicine until it was found to cause irreversible, doseindependent aplastic anemia in humans (Settepani, 1984). In canine medicine, the use of this drug decreased during the 1970s and 1980s when safer and more efficient antimicrobial agents were brought to the market (Papich, 2012). Although chloramphenicol is increasingly used to target MRSP infections (Bryan et al., 2012; Short et al., 2014), recommended dosages are based on old data and not on modern PK/PD criteria (Papich, 2012). Florfenicol, a fluorinated thiamphenicol derivative, displays a similar spectrum of activity as chloramphenicol,
1
2 M. G. Maaland et al.
but is safer to humans and cannot be inactivated by acetyltransferases produced by chloramphenicol-resistant strains (Cannon et al., 1990; Schwarz et al., 2004). However, florfenicol is only authorized for large animals and fish and available as an injectable formulation or a premix. This makes the use of this agent unpractical in dogs as antimicrobial agents are – after prescription by a veterinarian – commonly administered to the dogs by their owners. The aim of our study was to evaluate the in vitro data necessary to optimize use of chloramphenicol and florfenicol as second-line agents in canine medicine. For this purpose, the in vitro pharmacodynamic profiles [minimum inhibitory concentration (MIC) and inhibition zone diameter distributions, minimum bactericidal concentration (MBC), prevalence and mechanism of resistance, time-kill kinetics, and postantibiotic effect (PAE)] were determined in canine S. pseudintermedius and E. coli isolates. Previous studies have shown synergism of the combination amoxicillin/cefuroxime and florfenicol on Staphylococcus aureus and E. coli (Choi et al., 2011), or cefepime and chloramphenicol on methicillin-resistant S. aureus (MRSA) (Guignard et al., 2013). We therefore investigated the combined action of florfenicol and b-lactams (ampicillin or cefazolin) which are currently used for perioperative prophylaxis, as both MRSP and ESBL-producing E. coli are frequently associated with postsurgical infections and resistant to b-lactams. MATERIALS AND METHODS
MBCs were determined on five randomly selected wild-type isolates of each bacterial species as previously described (Hindler & Munro, 2010). The MBC was defined as the lowest concentration showing ≥99.9% killing compared with the initial inoculum. Antibacterial drug activity was defined as bactericidal and bacteriostatic for MBC/MIC ratios 1–4 and ≥8, respectively (French, 2006). Checkerboard assay Antibiotic interaction studies between (i) florfenicol and cefazolin (Sigma-Aldrich) and (ii) florfenicol and ampicillin (SigmaAldrich) were carried out by the checkerboard method in a 96-well microtiter plate as described previously (Eliopoulos & Moellering, 1996). One florfenicol-susceptible MRSP isolate (MICs of florfenicol, cefazolin, and ampicillin: 4, 128 and 32 lg/mL, respectively) and one florfenicol-susceptible CMY-2producing E. coli isolate (MICs of florfenicol, cefazolin, and ampicillin: 4, 1024 and 256 lg/mL, respectively) were included in this test. The concentration range tested was 0.125–8 lg/mL (florfenicol), 4–256 lg/mL (cefazolin) and 1–64 lg/mL (ampicillin, S. pseudintermedius) or 8–512 lg/mL (ampicillin, E. coli). For each 96-well plate, the fractional inhibitory concentration (FIC) indices were calculated for the first well showing no growth and interpreted as described by Guignard et al. (2013): ≤0.5, synergism; >0.5 but 4, antagonism.
Bacterial isolates
Time-kill kinetics
A total of 169 canine S. pseudintermedius isolates, including 20 MRSP, and 167 E. coli isolates, including 14 ESBL producers, were included in the study. These isolates were collected at veterinary diagnostic laboratories between 1998 and 2012. The E. coli isolates originated from Denmark (n = 154), Germany (n = 12) and Italy (n = 1) and were confirmed to the species level by standard phenotypic methods. The S. pseudintermedius isolates originated from Denmark (n = 92), North America (n = 30), Italy (n = 28) and Germany (n = 19) and were confirmed to the species level by either species-specific PCR (Sasaki et al., 2010) or PCR RFLP of the pta gene followed by Mbol digestion (Bannoehr et al., 2009).
Time-kill kinetics was performed to determine whether drug activities were time dependent or concentration dependent. Killing rates at different concentrations of the antimicrobial agent was observed visually by comparing the steepness of the slopes of the killing curves over 24 h (Craig, 2007). Killing curves were generated for one S. pseudintermedius isolate (chloramphenicol and florfenicol MICs: 8 and 4 lg/mL, respectively) and one E. coli isolate (chloramphenicol and florfenicol MICs: 4 lg/mL for both drugs), displaying the most common MICs of the wild-type populations. The method was based on that described by Jakobsen et al. (2012) with minor adjustments. Bacterial solutions corresponding to 5 9 105 CFU/mL in cation-adjusted Mueller–Hinton broth were incubated at 37 °C for 20–30 min. Thereafter, the antimicrobial agent was added at concentrations corresponding to 0.5, 1, 2, 4, 8, and 16 9 MIC of the isolates. Aliquots of 0.1 mL were collected after 0, 1, 3, 5, 7, and 24 h, 1:10 serially diluted, and spotted onto agar plates. CFU counts were performed with duplicate spots of 20 lL from appropriate dilutions. Tryptone soya agar (Oxoid) was used for S. pseudintermedius, while MacConkey agar (Merck, Darmstadt, Germany) was used for E. coli. For one MRSP isolate in the FIC assay, FIC indices from single wells showed an additive effect of florfenicol combined with cefazolin at some concentrations (florfenicol concentration of 2 lg/mL and cefazolin concentrations of 4–32 lg/mL), but not at others. To further investigate this, the time-kill kinetics of
Antimicrobial susceptibility testing Antimicrobial susceptibility testing was performed according to CLSI standards (CLSI, 2013a). MICs of chloramphenicol and florfenicol (Sigma-Aldrich, Schnelldorf, Germany) were determined by broth microdilution in cation-adjusted Mueller–Hinton broth (Sigma-Aldrich). The concentration range tested was 0.025–128 lg/mL for both phenicols. Zone diameters were determined by disk diffusion on Mueller–Hinton agar (Oxoid, Basingstoke, UK) using 30-lg disks (Oxoid) for both drugs. Quality control strains E. coli ATCC 25922 (MIC and disk diffusion), S. aureus ATCC 29213 (MIC testing) and S. aureus ATCC 25923 (disk diffusion) were included in all susceptibility tests.
© 2015 John Wiley & Sons Ltd
Phenicol activity against canine bacteria 3
florfenicol at 0.5–16 9 MIC combined with 100 lg/mL cefazolin in each tube was compared with the time-killing effect of florfenicol at the same concentrations alone. A control tube with no antibiotics was included at all time-killing measurements. The cefazolin concentration was selected based on expected plasma concentrations after standard dosages for surgical prophylaxis (Richardson et al., 1992; Marcellin-Little et al., 1996). Postantibiotic effect Postantibiotic effect (PAE) determinations were performed as previously described (Bundtzen et al., 1981; Li & Tang, 2004). The same S. pseudintermedius isolate was included as for the time-kill study, while the E. coli isolate (chloramphenicol and florfenicol MICs: 4 lg/mL for both drugs) was different from the one used for the time-kill study. Both isolates displayed the most common MICs of the wild-type population. Experiments were undertaken in cation-adjusted Mueller–Hinton broth, and the isolates, in logarithmic phase growth, were incubated for 1 h with antimicrobial concentrations corresponding to 1, 2, 4, 8, and 16 9 MIC, and one control without antibiotics. Thereafter, centrifugation and washing with fresh medium was performed three times in total. Samples were withdrawn before addition of the antimicrobial, before and after drug removal, and hourly up to 6 h after removal of drug, as described for the time-killing experiments. PCR for detection of resistance genes PCR was performed on suspected non-wild-type isolates according to the MIC distributions. All S. pseudintermedius isolates with a chloramphenicol MIC of ≥16 lg/mL were screened for the resistance genes catpC221, catpC223, and catpC194, associated with chloramphenicol resistance in staphylococci (Schwarz
et al., 2004). As a novel fexA gene variant conferring only chloramphenicol, but not florfenicol resistance has been described recently (Gomez-Sanz et al., 2013), chloramphenicolresistant S. pseudintermedius were also checked for the presence of fexA. All E. coli isolates with a MIC ≥64 lg/mL were screened for the presence of catA2, catA3, and cmlA, genes known to confer chloramphenicol resistance in E. coli (Schwarz et al., 2004). E. coli isolates with florfenicol MIC ≥256 lg/mL were included in PCR for the resistance gene floR, which mediates combined chloramphenicol and florfenicol resistance in E. coli (White et al., 2000; Karczmarczyk et al., 2011). The PCR primers used, the expected amplicon sizes, and the corresponding annealing temperatures used are given in Table 1. RESULTS Susceptibility testing, minimum bactericidal concentrations, and antibiotic interactions The chloramphenicol and florfenicol MIC distributions are shown in Fig. 1. The number of non-wild-type isolates was low in E. coli (8.4% and 1.8% for chloramphenicol and florfenicol, respectively). No non-wild-type isolates of S. pseudintermedius could be detected against florfenicol, whereas 17.2% of the isolates were non-wild type against chloramphenicol. The chloramphenicol disk diffusion zone diameters (ZDs) were 21–31 and 8–10 mm for wild-type and non-wild-type S. pseudintermedius, respectively, and 15–27 and 0 mm for wild-type and non-wild-type E. coli, respectively. Florfenicol ZDs were 25–33 mm for S. pseudintermedius (all wild type) and 13–27 and 0 mm for wild-type and non-wild-type E. coli, respectively. Two MRSP isolates showed non-wild-type MICs to chloramphenicol, while one ESBL-producing E. coli isolate displayed high MICs to both chloramphenicol and florfenicol.
Table 1. PCR primers and test conditions used to detect phenicol resistance genes Gene catpC221 catpC223 catpC194 catA1 catA2 catA3 cmlA floR fexA
Primers (50 ?30 )
Amplicon size (bp)
Annealing temperature (°C)
fw: ATTTATGCAATTATGGAAGTTG rv: TGAAGCATGGTAACCATCAC fw: GAATCAAATGCTAGTTTTAACTC rv: ACATGGTAACCATCACATAC fw: TTTGAACCAACAAACGACTTT rv: TCCTGCATGATAACCATCACA fw: GGCATTTCAGTCAGTTG rv: CATTAAGCATTCTGCCG fw: TGTTAATCAGTTTCCGGAGTTCC rv: ACAGAAACAGGTAATAATACGCGG fw: ACCATGTGGTTTTAGCTTAACA rv: GCAATAACAGTCTATCCCCTTC fw: CCGCCACGGTGTTGTTGTTATC rv: CACCTTGCCTGCCCATCATTAG fw: GCATCCTGAACACGACGCCCGCT rv: GCTGTGGTCGTGACGGTAACGGC fw: GATCCGTAAGCCCATCCATA rv: AGGCACCGGTTGTTAAACTG
435
50
Schnellmann et al. (2006)
283
50
Schnellmann et al. (2006)
535
50
This study
551
55
Kikuvi et al. (2007)
372
61
von Czapiewski (2010)
473
56
Kikuvi et al. (2007)
699
62
Kikuvi et al. (2007)
1031
63
Blickwede & Schwarz (2004)
2081
55
Gomez-Sanz et al. (2013)
© 2015 John Wiley & Sons Ltd
Reference
4 M. G. Maaland et al.
(a)
(b)
The MBCs for chloramphenicol and florfenicol could not be determined for 9/10 isolates, as growth was seen at all concentrations tested, resulting in MBCs ≥16 9 MIC. The MBC of florfenicol was determined for a single E. coli isolate (8 9 MIC). Based on the results of the checkerboard assay, the florfenicol/cefazolin combination displayed additivity (FIC index: 0.53– 0.75) for the MRSP isolate at a florfenicol concentration of 2 lg/mL and cefazolin concentrations of 4–32 lg/mL. Other drug concentration combinations displayed indifference for this isolate. For the other drug combinations tested against the MRSP and the CMY-2 producing E. coli isolates, all FIC indices showed indifference, and neither synergistic additive nor antagonistic effects were observed at any concentrations. Time-kill kinetics
Fig. 1. Chloramphenicol (a) and florfenicol (b) minimal inhibitory (MIC) distributions for 169 S. pseudintermedius and 167 E. coli isolates. The numbers of isolates displaying specific MIC values are indicated above the bars.
Chloramphenicol and florfenicol time-kill kinetics for S. pseudintermedius and E. coli are shown in Fig. 2. The 24-h antibacterial activity of both drugs against both bacterial species was time dependent as saturation of the killing rate occurred with increasing concentrations of the phenicols. For E. coli, no growth was detected at 2–16 9 MIC after 24 h, showing a bactericidal effect of both drugs on the test strain. Limited to E. coli, re-growth was seen at the concentration corresponding to 1 9 MIC. To further investigate the additive effect of florfenicol and cefazolin observed in the checkerboard assay of the MRSP test strain, a time-killing assay was performed to evaluate the
Fig. 2. Chloramphenicol and florfenicol 24-h time-kill kinetics for representative isolates of S. pseudintermedius (chloramphenicol MIC: 8 lg/mL, florfenicol MIC: 4 lg/mL) and E. coli (chloramphenicol MIC: 4 lg/mL, florfenicol MIC: 4 lg/mL). © 2015 John Wiley & Sons Ltd
Phenicol activity against canine bacteria 5
effects of this drug combination over time. Following exposure to 100 lg/mL cefazolin with 2–16 9 MIC of florfenicol, no major differences in bacterial killing were seen compared with the inhibition exerted by florfenicol alone. An increased killing rate of the antimicrobial combination was only visible at low concentrations of florfenicol (0.5–1 9 MIC) following 24-h exposure (data not shown). When exposed to florfenicol alone, bacterial re-growth (1.5 log units increase in CFU/ml) was seen at 0.5 9 MIC, while at 1 9 MIC the effect was purely bacteriostatic ( MIC) or the 24-h area under the concentration–time-curve (AUC) divided by the MIC (AUC/MIC) have been utilized for PK/PD analysis (Burgess et al., 2007; Manning et al., 2011; Illambas et al., 2013). In general, the PK/PD target of antimicrobials can be predicted based on their pattern of killing (i.e., concentration dependent or time dependent) and whether or not a PAE is present. Time-dependent antimicrobials are usually evaluated based on AUC/MIC if the PAE is moderate to prolonged, and on T > MIC if no or only a minimal PAE is present (Craig, 2003). However, as the PAE is a purely in vitro concept and not amenable to in vivo PK/PD modeling (Nielsen & Friberg, 2013), the true value of a PAE is uncertain. In this study, the killing pattern of chloramphenicol and florfenicol was time dependent against S. pseudintermedius and E. coli. Both phenicols exhibited a prolonged PAE against S. pseudintermedius, while no PAE could be demonstrated against E. coli for either drug. This latter finding is in contrast to previous studies showing chloramphenicol PAEs of 0.3–1.8 h in E. coli (Bundtzen et al., 1981; Craig & Gudmundsson, 1996). The test was therefore repeated with a different E. coli strain. Also for this second strain, no PAE could be detected (data not shown).
Clearly, in vitro or in vivo dose fractionation studies are needed to determine the appropriate PK/PD indices for chloramphenicol and florfenicol, and their magnitude required for efficacy. This information, together with pharmacokinetic data from dogs, is crucial to determine the appropriate dosage regimens and clinical break points of these drugs (Turnidge & Paterson, 2007). The current dosage recommendation of chloramphenicol in dogs of 25–50 mg/kg 3–4 times daily appears to have clinical efficacy (Papich, 2012). No dosage recommendations exist for florfenicol use in dogs, and the drug is currently only available as an injectable formulation. In florfenicol safety studies, dogs were shown to be the most sensitive species (EMA). After IV and oral administration of 20 mg/kg florfenicol to six beagle dogs, the mean plasma half-life was 1.1 and 1.2 h, respectively (Park et al., 2008). Also chloramphenicol has a short mean plasma half-life (2.4 h (1.3)) in dogs (Papich, 2012). Short half-lives for chloramphenicol and florfenicol indicate the necessity of frequent administration. However, proper assessment of dosage regimens can only be duly performed when the appropriate PK/PD targets are known. Chloramphenicol, even though approved for use in dogs in several countries, should not be used as a first-line agent for several reasons; besides the inconvenience of frequent administration, clinical use is associated with a high incidence of relatively mild adverse effects such as gastrointestinal irritations and lethargy (Bryan et al., 2012; Short et al., 2014). As dose-dependent reversible bone marrow suppression was occasionally reported in dogs and other mammals (Watson, 1977; Yunis, 1988), some authors have recommended blood screening in dogs that become anorexic or loose substantial weight (Frank & Loeffler, 2012). Furthermore, chloramphenicol may interact with other drugs as it is known to inhibit cytochrome p450 enzymes in the liver (Aidasani et al., 2008). Antimicrobial agents show synergistic effects when the combined action of two drugs is increased compared with the sum of the actions of each antimicrobial agent alone, a phenomenon that can be exploited to enhance success in clinical therapy (Eliopoulos & Moellering, 1996). The combination of florfenicol with a b-lactam did not show a marked increase in killing of b-lactam-resistant isolates in vitro, and the combined use of florfenicol and ampicillin or cefazolin can therefore not be supported based on the results of this study. This study confirms high levels of susceptibility in E. coli and S. pseudintermedius to chloramphenicol and florfenicol. In light of the increasing levels of resistance in these bacterial species and the lack of new veterinary antimicrobial drugs in the near future, more research is needed to rationalize the use of available antibiotics that are not critically important in human medicine. Optimization of the use of such drugs may constitute a viable option to address the current animal health concerns associated with multidrug-resistant bacteria in dogs as well as to prevent/limit veterinary use of human last resort drugs and minimize possible risks of zoonotic transmission of antimicrobial resistance. © 2015 John Wiley & Sons Ltd
Phenicol activity against canine bacteria 7
CONCLUSION Low levels of chloramphenicol and florfenicol resistance were observed in canine S. pseudintermedius and E. coli isolates. Activity of both agents was time dependent and primarily bacteriostatic on both bacterial species. A prolonged PAE was observed on S. pseudintermedius, while no PAE was detected for E. coli. More research, in particular determination of PK/PD targets of efficacy, is needed to further evaluate the clinical potential of florfenicol and chloramphenicol as second-line agents against infections caused by multidrug-resistant bacteria in dogs.
ACKNOWLEDGMENTS The funding source for this project was the Danish Center for Antimicrobial Research and Development (DanCARD). The authors would like to thank Mark G. Papich for providing his expertise and guidance on the subject of this manuscript. We would also like to acknowledge Tatjana Petrovna Kristensen, Geovana Brenner Michael, and Roswitha Becker for technical assistance and Antonio Battisti and David Bemis for providing bacterial isolates from Italy and the USA, respectively.
CONFLICT OF INTEREST STATEMENT There are none to be stated.
REFERENCES Aidasani, D., Zaya, M.J., Malpas, P.B. & Locuson, C.W. (2008) In vitro drug-drug interaction screens for canine veterinary medicines: evaluation of cytochrome P450 reversible inhibition. Drug Metabolism and Disposition, 36, 1512–1518. Balbi, H.J. (2004) Chloramphenicol: a review. Pediatrics in Review, 25, 284–288. Bannoehr, J. & Guardabassi, L. (2012) Staphylococcus pseudintermedius in the dog: taxonomy, diagnostics, ecology, epidemiology and pathogenicity. Veterinary Dermatology, 23, 253–266. Bannoehr, J., Franco, A., Iurescia, M., Battisti, A. & Fitzgerald, J.R. (2009) Molecular diagnostic identification of Staphylococcus pseudintermedius. Journal of Clinical Microbiology, 47, 469–471. Bengtsson, B. & Greko, C. (2014) Antibiotic resistance – consequences for animal health, welfare, and food production. Upsala Journal of Medical Sciences, 119, 96–102. Blickwede, M. & Schwarz, S. (2004) Molecular analysis of florfenicolresistant Escherichia coli isolates from pigs. Journal of Antimicrobial Chemotherapy, 53, 58–64. Bryan, J., Frank, L.A., Rohrbach, B.W., Burgette, L.J., Cain, C.L. & Bemis, D.A. (2012) Treatment outcome of dogs with meticillin-resistant and meticillin-susceptible Staphylococcus pseudintermedius pyoderma. Veterinary Dermatology, 23, 361–368. Bundtzen, R.W., Gerber, A.U., Cohn, D.L. & Craig, W.A. (1981) Postantibiotic suppression of bacterial growth. Reviews of Infectious Diseases, 3, 28–37. Burgess, D.S., Frei, C.R., Lewis, J.S. II, Fiebelkorn, K.R. & Jorgensen, J.H. (2007) The contribution of pharmacokinetic-pharmacodynamic
© 2015 John Wiley & Sons Ltd
modelling with Monte Carlo simulation to the development of susceptibility breakpoints for Neisseria meningitidis. Clinical Microbiology and Infection, 13, 33–39. Cannon, M., Harford, S. & Davies, J. (1990) A comparative study on the inhibitory actions of chloramphenicol, thiamphenicol and some fluorinated derivatives. Journal of Antimicrobial Chemotherapy, 26, 307–317. Choi, M.J., Lee, E.M., Lee, S.J., Reza, M.D., Lee, J.S., Gebru, E., Rhee, M.H. & Park, S.C. (2011) The in vitro antibacterial activity of florfenicol in combination with amoxicillin or cefuroxime against pathogenic bacteria of animal origin. Pakistan Veterinary Journal, 31, 141– 144. CLSI. 2013a. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, Approved Standard, 4th Edition. Vet01-A4. Clinical and Laboratory Standards Institute, Wayne, PA. CLSI. 2013b. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, Second Informational Supplement. Vet01-S2. Clinical and Laboratory Standards Institute, Wayne, PA. Craig, W.A. (2003) Basic pharmacodynamics of antibacterials with clinical applications to the use of beta-lactams, glycopeptides, and linezolid. Infectious Disease Clinics of North America, 17, 479–501. Craig, W.A. (2007). Chapter 1. Pharmacodynamics of antimicrobials: general concepts and applications. In Antimicrobial Pharmacodynamics in Theory and Clinical Practice, 2 edn. Eds Nightingale, C.H., Ambrose, P.G., Drusano, G.L. & Murakawa, T., pp. 1–19. Informa Healthcare USA, Inc., New York. Craig, W.A. & Gudmundsson, S. (1996) Postantibiotic effect. In Antibiotics in Laboratory Medicine. 4th edn. Ed Lorian, V., pp. 304–305. The Williams & Wilkins Co., Baltimore. von Czapiewski, E. (2010) Determination of the Minimum Inhibitory Concentration by Broth Microdilution for Pathogenic Bacteria of Fish and Molecular Characterization of Antimicrobial Resistance Genes. Doctoral dissertation. University of Veterinary Medicine Hannover, Hannover, Germany. Eliopoulos, G.M. & Moellering, R.C. Jr (1996) Antimicrobial combinations. In Antibiotics in Laboratory Medicine, 4th edn. Ed Lorian, V., pp. 330–396. The Williams & Wilkins Co., Baltimore. EMA (European Medicines Agency. Available from http://www. ema.europa.eu/docs/en_GB/document_library/Maximum_Residue_ Limits_-_Report/2009/11/WC500014274.pdf (accessed 10 December 2014). Ewers, C., Bethe, A., Semmler, T., Guenther, S. & Wieler, L.H. (2012) Extended-spectrum b–lactamase-producing and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on public health: a global perspective. Clinical Microbiology and Infection, 18, 646–655. Frank, L.A. & Loeffler, A. (2012) Meticillin-resistant Staphylococcus pseudintermedius: clinical challenge and treatment options. Veterinary Dermatology, 23, 283–E256. French, G.L. (2006) Bactericidal agents in the treatment of MRSA infections – the potential role of daptomycin. Journal of Antimicrobial Chemotherapy, 58, 1107–1117. Gomez-Sanz, E., Kadlec, K., Feßler, A.T., Zarazaga, M., Torres, C. & Schwarz, S. (2013) A novel fexA variant from a canine Staphylococcus pseudintermedius isolate that does not confer florfenicol resistance. Antimicrobial Agents and Chemotherapy, 57, 5763–5766. Grobbel, M., Lubke-Becker, A., Alesik, E., Schwarz, S., Wallmann, J., Werckenthin, C. & Wieler, L.H. (2007) Antimicrobial susceptibility of Escherichia coli from swine, horses, dogs and cats as determined in the BfT-GermVet monitoring program 2004–2006. Berliner und Munchener Tierarztliche Wochenschrift, 120, 391–401.
8 M. G. Maaland et al. Guignard, B., Vouillamoz, J., Giddey, M. & Moreillon, P. (2013) A positive interaction between inhibitors of protein synthesis and cefepime in the fight against methicillin-resistant Staphylococcus aureus. European Journal of Clinical Microbiology & Infectious Diseases, 32, 899–907. Hindler, J.F. & Munro, S. (2010). Section 5.10.1 Minimum bactericidal concentration testing. In Clinical Microbiology Procedures Handbook, 3 edn. Ed Garcia, L.S., pp. 5.10.1.1–5.10.1.17. ASM Press, Washington, DC. Illambas, J., Potter, T., Sidhu, P., Rycroft, A.N., Cheng, Z. & Lees, P. (2013) Pharmacodynamics of florfenicol for calf pneumonia pathogens. Veterinary Record, 172, 340. Jakobsen, L., Cattoir, V., Jensen, K.S., Hammerum, A.M., Nordmann, P. & Frimodt-Moller, N. (2012) Impact of low-level fluoroquinolone resistance genes qnrA1, qnrB19 and qnrS1 on ciprofloxacin treatment of isogenic Escherichia coli strains in a murine urinary tract infection model. Journal of Antimicrobial Chemotherapy, 67, 2438–2444. Karczmarczyk, M., Abbott, Y., Walsh, C., Leonard, N. & Fanning, S. (2011) Characterization of multidrug-resistant Escherichia coli isolates from animals presenting at a university veterinary hospital. Applied and Environmental Microbiology, 77, 7104–7112. Kikuvi, G.M., Schwarz, S., Ombui, J.N., Mitema, E.S. & Kehrenberg, C. (2007) Streptomycin and chloramphenicol resistance genes in Escherichia coli isolates from cattle, pigs, and chicken in Kenya. Microbial Drug Resistance-Mechanisms Epidemiology and Disease, 13, 62–68. Li, R.C. & Tang, M.C. (2004) Post-antibiotic effect induced by an antibiotic combination: influence of mode, sequence and interval of exposure. Journal of Antimicrobial Chemotherapy, 54, 904–908. Ling, G.V., Norris, C.R., Franti, C.E., Eisele, P.H., Johnson, D.L., Ruby, A.L. & Jang, S.S. (2001) Interrelations of organism prevalence, specimen collection method, and host age, sex, and breed among 8354 canine urinary tract infections (1969–1995). Journal of Veterinary Internal Medicine, 15, 341–347. Manning, L., Laman, M., Greenhill, A.R., Michael, A., Siba, P., Mueller, I. & Davis, T.M.E. (2011) Increasing chloramphenicol resistance in Streptococcus pneumoniae isolates from Papua New Guinean children with acute bacterial meningitis. Antimicrobial Agents and Chemotherapy, 55, 4454–4456. Marcellin-Little, D.J., Papich, M.G., Richardson, D.C. & DeYoung, D.J. (1996) Pharmacokinetic model for cefazolin distribution during total hip arthroplasty in dogs. American Journal of Veterinary Research, 57, 720–723. Moodley, A., Damborg, P. & Nielsen, S.S. (2014) Antimicrobial resistance in methicillin susceptible and methicillin resistant Staphylococcus pseudintermedius of canine origin: literature review from 1980 to 2013. Veterinary Microbiology, 171, 337–341. Nielsen, E.I. & Friberg, L.E. (2013) Pharmacokinetic-pharmacodynamic modeling of antibacterial drugs. Pharmacological Reviews, 65, 1053–1090. Papich, M.G. (2012) Selection of antibiotics for meticillin-resistant Staphylococcus pseudintermedius: time to revisit some old drugs? Veterinary Dermatology, 23, 352–E364. Park, B.K., Lim, J.H., Kim, M.S., Hwang, Y.H. & Yun, H.I. (2008) Pharmacokinetics of florfenicol and its metabolite, florfenicol amine, in dogs. Research in Veterinary Science, 84, 85–89. Perreten, V., Kadlec, K., Schwarz, S., Andersson, U.G., Finn, M., Greko, C., Moodley, A., Kania, S.A., Frank, L.A., Bemis, D.A., Franco, A., Iurescia, M., Battisti, A., Duim, B., Wagenaar, J.A., van Duijkeren, E., Weese, J.S., Fitzgerald, J.R., Rossano, A. & Guardabassi, L. (2010)
Clonal spread of methicillin-resistant Staphylococcus pseudintermedius in Europe and North America: an international multicentre study. Journal of Antimicrobial Chemotherapy, 65, 1145–1154. Richardson, D.C., Aucoin, D.P., Deyoung, D.J., Tyczkowska, K.L. & Deyoung, B.A. (1992) Pharmacokinetic disposition of cefazolin in serum and tissue during canine total hip-replacement. Veterinary Surgery, 21, 1–4. Rutland, B.E., Weese, J.S., Bolin, C., Au, J. & Malani, A.N. (2009) Human-to-dog transmission of methicillin-resistant Staphylococcus aureus. Emerging Infectious Diseases, 15, 1328–1330. Sasaki, T., Tsubakishita, S., Tanaka, Y., Sakusabe, A., Ohtsuka, M., Hirotaki, S., Kawakami, T., Fukata, T. & Hiramatsu, K. (2010) Multiplex-PCR method for species identification of coagulase-positive staphylococci. Journal of Clinical Microbiology, 48, 765–769. Schnellmann, C., Gerber, V., Rossano, A., Jaquier, V., Panchaud, Y., Doherr, M.G., Thomann, A., Straub, R. & Perreten, V. (2006) Presence of new mecA and mph(C) variants conferring antibiotic resistance in Staphylococcus spp. isolated from the skin of horses before and after clinic admission. Journal of Clinical Microbiology, 44, 4444–4454. Schwartz, M., Boettcher, I.C., Kramer, S. & Tipold, A. (2009) Two dogs with iatrogenic discospondylitis caused by meticillin-resistant Staphylococcus aureus. Journal of Small Animal Practice, 50, 201–205. Schwarz, S. & Kehrenberg, C. (2006) Old dogs that learn new tricks: modified antimicrobial agents that escape pre-existing resistance mechanisms. International Journal of Medical Microbiology, 296, 45–49. Schwarz, S., Kehrenberg, C., Doublet, B. & Cloeckaert, A. (2004) Molecular basis of bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiology Reviews, 28, 519–542. Schwarz, S., Alesik, E., Werckenthin, C., Grobbel, M., Lubke-Becker, A., Wieler, L.H. & Wallmann, J. (2007) Antimicrobial susceptibility of coagulase-positive and coagulase-variable staphylococci from various indications of swine, dogs and cats as determined in the BfT-GermVet monitoring program 2004–2006. Berliner und Munchener Tierarztliche Wochenschrift, 120, 372–379. Settepani, J.A. (1984) The hazard of using chloramphenicol in food animals. Journal of the American Veterinary Medical Association, 184, 930–931. Short, J., Zabel, S., Cook, C. & Schmeitzel, L. (2014) Adverse events associated with chloramphenicol use in dogs: a retrospective study (2007–2013). The Veterinary Record, 175, 537–539. Spohr, A., Schjøth, B., Wiinberg, B., Houser, G., Willesen, J., Jessen, L.R., Guardabassi, L., Schjærff, M., Eriksen, T. & Jensen, V.F. (2012). Antibiotic use Guidelines for Companion Animal Practice. Danish Small Animal Veterinary Association (SvHKS).https://www.ddd.dk/organisatorisk/sektionsmaadyr/Documents/AntibioticGuidelines.pdf (accessed 9 September 2013). Turnidge, J. & Paterson, D.L. (2007) Setting and revising antibacterial susceptibility breakpoints. Clinical Microbiology Reviews, 20, 391–408. Watson, A.D.J. (1977) Chloramphenicol toxicity in dogs. Research in Veterinary Science, 23, 66–69. White, D.G., Hudson, C., Maurer, J.J., Ayers, S., Zhao, S.H., Lee, M.D., Bolton, L., Foley, T. & Sherwood, J. (2000) Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. Journal of Clinical Microbiology, 38, 4593–4598. Yunis, A.A. (1988) Chloramphenicol – relation of structure to activity and toxicity. Annual Review of Pharmacology and Toxicology, 28, 83–100.
© 2015 John Wiley & Sons Ltd
In vitro assessment of chloramphenicol and florfenicol as second-line antimicrobial agents in dogs M. G. MAALAND* S. S. MO
†
S. SCHWARZ ‡ & L. GUARDABASSI* *Department of Veterinary Disease Biology, Faculty of Health and Medical Sciences, University of Copenhagen, Frederiksberg, Denmark; †National Veterinary Institute, Oslo, Norway; ‡Institute of Farm Animal Genetics, Friedrich-Loeffler-Institut (FLI), Neustadt-Mariensee, Germany
Maaland, M. G., Mo, S. S., Schwarz, S., Guardabassi, L. In vitro assessment of chloramphenicol and florfenicol as second-line antimicrobial agents in dogs. J. vet. Pharmacol. Therap. doi: 10.1111/jvp.12204. The aim of this study was to evaluate the potential of chloramphenicol and florfenicol as second-line antimicrobial agents for treatment of infections caused by methicillin-resistant Staphyococcus pseudintermedius (MRSP) and extended-spectrum b-lactamase (ESBL)-producing Escherichia coli in dogs, through a systematic in vitro assessment of the pharmacodynamic properties of the two drugs. Minimum inhibitory concentrations (MIC) and phenicol resistance genes were determined for 169 S. pseudintermedius and 167 E. coli isolates. Minimum bactericidal concentrations (MBC), time-killing kinetics, and postantibiotic effect (PAE) of both agents against wild-type isolates of each species were assessed. For S. pseudintermedius, the chloramphenicol MIC90 was 32 lg/mL. No florfenicol resistance was detected in this species (MIC90 = 4 lg/mL). The MIC90 of both agents against E. coli was 8 lg/mL. Resistance genes found were catpC221 in S. pseudintermedius and catA1 and/or floR in E. coli. The phenicols displayed a time-dependent, mainly, bacteriostatic effect on both species. Prolonged PAEs were observed for S. pseudintermedius, and no PAEs were detected for E. coli. More research into determination of PK/PD targets of efficacy is needed to further assess the clinical use of chloramphenicol and florfenicol as second-line agents in dogs, optimize dosage regimens, and set up species-specific clinical break points. (Paper received 4 August 2014; accepted for publication 29 December 2014) Luca Guardabassi, Department of Veterinary Disease Biology, Faculty of Health and Medical Sciences, University of Copenhagen, Stigbøjlen 4, 1870 Frederiksberg C, Denmark. E-mail: [email protected]
INTRODUCTION Staphylococcus pseudintermedius and Escherichia coli are opportunistic pathogens and responsible for a wide range of infections in dogs. S. pseudintermedius is the most common cause of pyoderma (Bannoehr & Guardabassi, 2012), while E. coli is the main pathogen causing urinary tract infections (Ling et al., 2001). Occurrence of methicillin-resistant S. pseudintermedius (MRSP) and extended-spectrum b-lactamase (ESBL)-producing E. coli is increasing worldwide among clinical isolates (Ewers et al., 2012; Frank & Loeffler, 2012). Some infections caused by multidrug-resistant bacteria are difficult to manage as they cannot be treated with any of the veterinary antimicrobial agents available for systemic therapy in dogs, thereby often leading to euthanasia due to animal welfare and owner safety reasons (Rutland et al., 2009; Schwartz et al., 2009; Bengtsson & Greko, 2014). Veterinary use of antimicrobial agents that are not authorized for veterinary use and considered critically important in human medicine (e.g., vancomycin and carbapen-
© 2015 John Wiley & Sons Ltd
ems) has been discouraged due to public health concerns (Spohr et al., 2012). Therefore, novel antimicrobial strategies such as investigation of older or alternative antimicrobials that are neither extensively used in small animal medicine nor considered as critically important in human medicine are needed (Papich, 2012). Among alternative antimicrobial agents, phenicols, such as chloramphenicol and florfenicol, are potentially valuable options. Chloramphenicol was widely used in human and veterinary medicine until it was found to cause irreversible, doseindependent aplastic anemia in humans (Settepani, 1984). In canine medicine, the use of this drug decreased during the 1970s and 1980s when safer and more efficient antimicrobial agents were brought to the market (Papich, 2012). Although chloramphenicol is increasingly used to target MRSP infections (Bryan et al., 2012; Short et al., 2014), recommended dosages are based on old data and not on modern PK/PD criteria (Papich, 2012). Florfenicol, a fluorinated thiamphenicol derivative, displays a similar spectrum of activity as chloramphenicol,
1
2 M. G. Maaland et al.
but is safer to humans and cannot be inactivated by acetyltransferases produced by chloramphenicol-resistant strains (Cannon et al., 1990; Schwarz et al., 2004). However, florfenicol is only authorized for large animals and fish and available as an injectable formulation or a premix. This makes the use of this agent unpractical in dogs as antimicrobial agents are – after prescription by a veterinarian – commonly administered to the dogs by their owners. The aim of our study was to evaluate the in vitro data necessary to optimize use of chloramphenicol and florfenicol as second-line agents in canine medicine. For this purpose, the in vitro pharmacodynamic profiles [minimum inhibitory concentration (MIC) and inhibition zone diameter distributions, minimum bactericidal concentration (MBC), prevalence and mechanism of resistance, time-kill kinetics, and postantibiotic effect (PAE)] were determined in canine S. pseudintermedius and E. coli isolates. Previous studies have shown synergism of the combination amoxicillin/cefuroxime and florfenicol on Staphylococcus aureus and E. coli (Choi et al., 2011), or cefepime and chloramphenicol on methicillin-resistant S. aureus (MRSA) (Guignard et al., 2013). We therefore investigated the combined action of florfenicol and b-lactams (ampicillin or cefazolin) which are currently used for perioperative prophylaxis, as both MRSP and ESBL-producing E. coli are frequently associated with postsurgical infections and resistant to b-lactams. MATERIALS AND METHODS
MBCs were determined on five randomly selected wild-type isolates of each bacterial species as previously described (Hindler & Munro, 2010). The MBC was defined as the lowest concentration showing ≥99.9% killing compared with the initial inoculum. Antibacterial drug activity was defined as bactericidal and bacteriostatic for MBC/MIC ratios 1–4 and ≥8, respectively (French, 2006). Checkerboard assay Antibiotic interaction studies between (i) florfenicol and cefazolin (Sigma-Aldrich) and (ii) florfenicol and ampicillin (SigmaAldrich) were carried out by the checkerboard method in a 96-well microtiter plate as described previously (Eliopoulos & Moellering, 1996). One florfenicol-susceptible MRSP isolate (MICs of florfenicol, cefazolin, and ampicillin: 4, 128 and 32 lg/mL, respectively) and one florfenicol-susceptible CMY-2producing E. coli isolate (MICs of florfenicol, cefazolin, and ampicillin: 4, 1024 and 256 lg/mL, respectively) were included in this test. The concentration range tested was 0.125–8 lg/mL (florfenicol), 4–256 lg/mL (cefazolin) and 1–64 lg/mL (ampicillin, S. pseudintermedius) or 8–512 lg/mL (ampicillin, E. coli). For each 96-well plate, the fractional inhibitory concentration (FIC) indices were calculated for the first well showing no growth and interpreted as described by Guignard et al. (2013): ≤0.5, synergism; >0.5 but 4, antagonism.
Bacterial isolates
Time-kill kinetics
A total of 169 canine S. pseudintermedius isolates, including 20 MRSP, and 167 E. coli isolates, including 14 ESBL producers, were included in the study. These isolates were collected at veterinary diagnostic laboratories between 1998 and 2012. The E. coli isolates originated from Denmark (n = 154), Germany (n = 12) and Italy (n = 1) and were confirmed to the species level by standard phenotypic methods. The S. pseudintermedius isolates originated from Denmark (n = 92), North America (n = 30), Italy (n = 28) and Germany (n = 19) and were confirmed to the species level by either species-specific PCR (Sasaki et al., 2010) or PCR RFLP of the pta gene followed by Mbol digestion (Bannoehr et al., 2009).
Time-kill kinetics was performed to determine whether drug activities were time dependent or concentration dependent. Killing rates at different concentrations of the antimicrobial agent was observed visually by comparing the steepness of the slopes of the killing curves over 24 h (Craig, 2007). Killing curves were generated for one S. pseudintermedius isolate (chloramphenicol and florfenicol MICs: 8 and 4 lg/mL, respectively) and one E. coli isolate (chloramphenicol and florfenicol MICs: 4 lg/mL for both drugs), displaying the most common MICs of the wild-type populations. The method was based on that described by Jakobsen et al. (2012) with minor adjustments. Bacterial solutions corresponding to 5 9 105 CFU/mL in cation-adjusted Mueller–Hinton broth were incubated at 37 °C for 20–30 min. Thereafter, the antimicrobial agent was added at concentrations corresponding to 0.5, 1, 2, 4, 8, and 16 9 MIC of the isolates. Aliquots of 0.1 mL were collected after 0, 1, 3, 5, 7, and 24 h, 1:10 serially diluted, and spotted onto agar plates. CFU counts were performed with duplicate spots of 20 lL from appropriate dilutions. Tryptone soya agar (Oxoid) was used for S. pseudintermedius, while MacConkey agar (Merck, Darmstadt, Germany) was used for E. coli. For one MRSP isolate in the FIC assay, FIC indices from single wells showed an additive effect of florfenicol combined with cefazolin at some concentrations (florfenicol concentration of 2 lg/mL and cefazolin concentrations of 4–32 lg/mL), but not at others. To further investigate this, the time-kill kinetics of
Antimicrobial susceptibility testing Antimicrobial susceptibility testing was performed according to CLSI standards (CLSI, 2013a). MICs of chloramphenicol and florfenicol (Sigma-Aldrich, Schnelldorf, Germany) were determined by broth microdilution in cation-adjusted Mueller–Hinton broth (Sigma-Aldrich). The concentration range tested was 0.025–128 lg/mL for both phenicols. Zone diameters were determined by disk diffusion on Mueller–Hinton agar (Oxoid, Basingstoke, UK) using 30-lg disks (Oxoid) for both drugs. Quality control strains E. coli ATCC 25922 (MIC and disk diffusion), S. aureus ATCC 29213 (MIC testing) and S. aureus ATCC 25923 (disk diffusion) were included in all susceptibility tests.
© 2015 John Wiley & Sons Ltd
Phenicol activity against canine bacteria 3
florfenicol at 0.5–16 9 MIC combined with 100 lg/mL cefazolin in each tube was compared with the time-killing effect of florfenicol at the same concentrations alone. A control tube with no antibiotics was included at all time-killing measurements. The cefazolin concentration was selected based on expected plasma concentrations after standard dosages for surgical prophylaxis (Richardson et al., 1992; Marcellin-Little et al., 1996). Postantibiotic effect Postantibiotic effect (PAE) determinations were performed as previously described (Bundtzen et al., 1981; Li & Tang, 2004). The same S. pseudintermedius isolate was included as for the time-kill study, while the E. coli isolate (chloramphenicol and florfenicol MICs: 4 lg/mL for both drugs) was different from the one used for the time-kill study. Both isolates displayed the most common MICs of the wild-type population. Experiments were undertaken in cation-adjusted Mueller–Hinton broth, and the isolates, in logarithmic phase growth, were incubated for 1 h with antimicrobial concentrations corresponding to 1, 2, 4, 8, and 16 9 MIC, and one control without antibiotics. Thereafter, centrifugation and washing with fresh medium was performed three times in total. Samples were withdrawn before addition of the antimicrobial, before and after drug removal, and hourly up to 6 h after removal of drug, as described for the time-killing experiments. PCR for detection of resistance genes PCR was performed on suspected non-wild-type isolates according to the MIC distributions. All S. pseudintermedius isolates with a chloramphenicol MIC of ≥16 lg/mL were screened for the resistance genes catpC221, catpC223, and catpC194, associated with chloramphenicol resistance in staphylococci (Schwarz
et al., 2004). As a novel fexA gene variant conferring only chloramphenicol, but not florfenicol resistance has been described recently (Gomez-Sanz et al., 2013), chloramphenicolresistant S. pseudintermedius were also checked for the presence of fexA. All E. coli isolates with a MIC ≥64 lg/mL were screened for the presence of catA2, catA3, and cmlA, genes known to confer chloramphenicol resistance in E. coli (Schwarz et al., 2004). E. coli isolates with florfenicol MIC ≥256 lg/mL were included in PCR for the resistance gene floR, which mediates combined chloramphenicol and florfenicol resistance in E. coli (White et al., 2000; Karczmarczyk et al., 2011). The PCR primers used, the expected amplicon sizes, and the corresponding annealing temperatures used are given in Table 1. RESULTS Susceptibility testing, minimum bactericidal concentrations, and antibiotic interactions The chloramphenicol and florfenicol MIC distributions are shown in Fig. 1. The number of non-wild-type isolates was low in E. coli (8.4% and 1.8% for chloramphenicol and florfenicol, respectively). No non-wild-type isolates of S. pseudintermedius could be detected against florfenicol, whereas 17.2% of the isolates were non-wild type against chloramphenicol. The chloramphenicol disk diffusion zone diameters (ZDs) were 21–31 and 8–10 mm for wild-type and non-wild-type S. pseudintermedius, respectively, and 15–27 and 0 mm for wild-type and non-wild-type E. coli, respectively. Florfenicol ZDs were 25–33 mm for S. pseudintermedius (all wild type) and 13–27 and 0 mm for wild-type and non-wild-type E. coli, respectively. Two MRSP isolates showed non-wild-type MICs to chloramphenicol, while one ESBL-producing E. coli isolate displayed high MICs to both chloramphenicol and florfenicol.
Table 1. PCR primers and test conditions used to detect phenicol resistance genes Gene catpC221 catpC223 catpC194 catA1 catA2 catA3 cmlA floR fexA
Primers (50 ?30 )
Amplicon size (bp)
Annealing temperature (°C)
fw: ATTTATGCAATTATGGAAGTTG rv: TGAAGCATGGTAACCATCAC fw: GAATCAAATGCTAGTTTTAACTC rv: ACATGGTAACCATCACATAC fw: TTTGAACCAACAAACGACTTT rv: TCCTGCATGATAACCATCACA fw: GGCATTTCAGTCAGTTG rv: CATTAAGCATTCTGCCG fw: TGTTAATCAGTTTCCGGAGTTCC rv: ACAGAAACAGGTAATAATACGCGG fw: ACCATGTGGTTTTAGCTTAACA rv: GCAATAACAGTCTATCCCCTTC fw: CCGCCACGGTGTTGTTGTTATC rv: CACCTTGCCTGCCCATCATTAG fw: GCATCCTGAACACGACGCCCGCT rv: GCTGTGGTCGTGACGGTAACGGC fw: GATCCGTAAGCCCATCCATA rv: AGGCACCGGTTGTTAAACTG
435
50
Schnellmann et al. (2006)
283
50
Schnellmann et al. (2006)
535
50
This study
551
55
Kikuvi et al. (2007)
372
61
von Czapiewski (2010)
473
56
Kikuvi et al. (2007)
699
62
Kikuvi et al. (2007)
1031
63
Blickwede & Schwarz (2004)
2081
55
Gomez-Sanz et al. (2013)
© 2015 John Wiley & Sons Ltd
Reference
4 M. G. Maaland et al.
(a)
(b)
The MBCs for chloramphenicol and florfenicol could not be determined for 9/10 isolates, as growth was seen at all concentrations tested, resulting in MBCs ≥16 9 MIC. The MBC of florfenicol was determined for a single E. coli isolate (8 9 MIC). Based on the results of the checkerboard assay, the florfenicol/cefazolin combination displayed additivity (FIC index: 0.53– 0.75) for the MRSP isolate at a florfenicol concentration of 2 lg/mL and cefazolin concentrations of 4–32 lg/mL. Other drug concentration combinations displayed indifference for this isolate. For the other drug combinations tested against the MRSP and the CMY-2 producing E. coli isolates, all FIC indices showed indifference, and neither synergistic additive nor antagonistic effects were observed at any concentrations. Time-kill kinetics
Fig. 1. Chloramphenicol (a) and florfenicol (b) minimal inhibitory (MIC) distributions for 169 S. pseudintermedius and 167 E. coli isolates. The numbers of isolates displaying specific MIC values are indicated above the bars.
Chloramphenicol and florfenicol time-kill kinetics for S. pseudintermedius and E. coli are shown in Fig. 2. The 24-h antibacterial activity of both drugs against both bacterial species was time dependent as saturation of the killing rate occurred with increasing concentrations of the phenicols. For E. coli, no growth was detected at 2–16 9 MIC after 24 h, showing a bactericidal effect of both drugs on the test strain. Limited to E. coli, re-growth was seen at the concentration corresponding to 1 9 MIC. To further investigate the additive effect of florfenicol and cefazolin observed in the checkerboard assay of the MRSP test strain, a time-killing assay was performed to evaluate the
Fig. 2. Chloramphenicol and florfenicol 24-h time-kill kinetics for representative isolates of S. pseudintermedius (chloramphenicol MIC: 8 lg/mL, florfenicol MIC: 4 lg/mL) and E. coli (chloramphenicol MIC: 4 lg/mL, florfenicol MIC: 4 lg/mL). © 2015 John Wiley & Sons Ltd
Phenicol activity against canine bacteria 5
effects of this drug combination over time. Following exposure to 100 lg/mL cefazolin with 2–16 9 MIC of florfenicol, no major differences in bacterial killing were seen compared with the inhibition exerted by florfenicol alone. An increased killing rate of the antimicrobial combination was only visible at low concentrations of florfenicol (0.5–1 9 MIC) following 24-h exposure (data not shown). When exposed to florfenicol alone, bacterial re-growth (1.5 log units increase in CFU/ml) was seen at 0.5 9 MIC, while at 1 9 MIC the effect was purely bacteriostatic ( MIC) or the 24-h area under the concentration–time-curve (AUC) divided by the MIC (AUC/MIC) have been utilized for PK/PD analysis (Burgess et al., 2007; Manning et al., 2011; Illambas et al., 2013). In general, the PK/PD target of antimicrobials can be predicted based on their pattern of killing (i.e., concentration dependent or time dependent) and whether or not a PAE is present. Time-dependent antimicrobials are usually evaluated based on AUC/MIC if the PAE is moderate to prolonged, and on T > MIC if no or only a minimal PAE is present (Craig, 2003). However, as the PAE is a purely in vitro concept and not amenable to in vivo PK/PD modeling (Nielsen & Friberg, 2013), the true value of a PAE is uncertain. In this study, the killing pattern of chloramphenicol and florfenicol was time dependent against S. pseudintermedius and E. coli. Both phenicols exhibited a prolonged PAE against S. pseudintermedius, while no PAE could be demonstrated against E. coli for either drug. This latter finding is in contrast to previous studies showing chloramphenicol PAEs of 0.3–1.8 h in E. coli (Bundtzen et al., 1981; Craig & Gudmundsson, 1996). The test was therefore repeated with a different E. coli strain. Also for this second strain, no PAE could be detected (data not shown).
Clearly, in vitro or in vivo dose fractionation studies are needed to determine the appropriate PK/PD indices for chloramphenicol and florfenicol, and their magnitude required for efficacy. This information, together with pharmacokinetic data from dogs, is crucial to determine the appropriate dosage regimens and clinical break points of these drugs (Turnidge & Paterson, 2007). The current dosage recommendation of chloramphenicol in dogs of 25–50 mg/kg 3–4 times daily appears to have clinical efficacy (Papich, 2012). No dosage recommendations exist for florfenicol use in dogs, and the drug is currently only available as an injectable formulation. In florfenicol safety studies, dogs were shown to be the most sensitive species (EMA). After IV and oral administration of 20 mg/kg florfenicol to six beagle dogs, the mean plasma half-life was 1.1 and 1.2 h, respectively (Park et al., 2008). Also chloramphenicol has a short mean plasma half-life (2.4 h (1.3)) in dogs (Papich, 2012). Short half-lives for chloramphenicol and florfenicol indicate the necessity of frequent administration. However, proper assessment of dosage regimens can only be duly performed when the appropriate PK/PD targets are known. Chloramphenicol, even though approved for use in dogs in several countries, should not be used as a first-line agent for several reasons; besides the inconvenience of frequent administration, clinical use is associated with a high incidence of relatively mild adverse effects such as gastrointestinal irritations and lethargy (Bryan et al., 2012; Short et al., 2014). As dose-dependent reversible bone marrow suppression was occasionally reported in dogs and other mammals (Watson, 1977; Yunis, 1988), some authors have recommended blood screening in dogs that become anorexic or loose substantial weight (Frank & Loeffler, 2012). Furthermore, chloramphenicol may interact with other drugs as it is known to inhibit cytochrome p450 enzymes in the liver (Aidasani et al., 2008). Antimicrobial agents show synergistic effects when the combined action of two drugs is increased compared with the sum of the actions of each antimicrobial agent alone, a phenomenon that can be exploited to enhance success in clinical therapy (Eliopoulos & Moellering, 1996). The combination of florfenicol with a b-lactam did not show a marked increase in killing of b-lactam-resistant isolates in vitro, and the combined use of florfenicol and ampicillin or cefazolin can therefore not be supported based on the results of this study. This study confirms high levels of susceptibility in E. coli and S. pseudintermedius to chloramphenicol and florfenicol. In light of the increasing levels of resistance in these bacterial species and the lack of new veterinary antimicrobial drugs in the near future, more research is needed to rationalize the use of available antibiotics that are not critically important in human medicine. Optimization of the use of such drugs may constitute a viable option to address the current animal health concerns associated with multidrug-resistant bacteria in dogs as well as to prevent/limit veterinary use of human last resort drugs and minimize possible risks of zoonotic transmission of antimicrobial resistance. © 2015 John Wiley & Sons Ltd
Phenicol activity against canine bacteria 7
CONCLUSION Low levels of chloramphenicol and florfenicol resistance were observed in canine S. pseudintermedius and E. coli isolates. Activity of both agents was time dependent and primarily bacteriostatic on both bacterial species. A prolonged PAE was observed on S. pseudintermedius, while no PAE was detected for E. coli. More research, in particular determination of PK/PD targets of efficacy, is needed to further evaluate the clinical potential of florfenicol and chloramphenicol as second-line agents against infections caused by multidrug-resistant bacteria in dogs.
ACKNOWLEDGMENTS The funding source for this project was the Danish Center for Antimicrobial Research and Development (DanCARD). The authors would like to thank Mark G. Papich for providing his expertise and guidance on the subject of this manuscript. We would also like to acknowledge Tatjana Petrovna Kristensen, Geovana Brenner Michael, and Roswitha Becker for technical assistance and Antonio Battisti and David Bemis for providing bacterial isolates from Italy and the USA, respectively.
CONFLICT OF INTEREST STATEMENT There are none to be stated.
REFERENCES Aidasani, D., Zaya, M.J., Malpas, P.B. & Locuson, C.W. (2008) In vitro drug-drug interaction screens for canine veterinary medicines: evaluation of cytochrome P450 reversible inhibition. Drug Metabolism and Disposition, 36, 1512–1518. Balbi, H.J. (2004) Chloramphenicol: a review. Pediatrics in Review, 25, 284–288. Bannoehr, J. & Guardabassi, L. (2012) Staphylococcus pseudintermedius in the dog: taxonomy, diagnostics, ecology, epidemiology and pathogenicity. Veterinary Dermatology, 23, 253–266. Bannoehr, J., Franco, A., Iurescia, M., Battisti, A. & Fitzgerald, J.R. (2009) Molecular diagnostic identification of Staphylococcus pseudintermedius. Journal of Clinical Microbiology, 47, 469–471. Bengtsson, B. & Greko, C. (2014) Antibiotic resistance – consequences for animal health, welfare, and food production. Upsala Journal of Medical Sciences, 119, 96–102. Blickwede, M. & Schwarz, S. (2004) Molecular analysis of florfenicolresistant Escherichia coli isolates from pigs. Journal of Antimicrobial Chemotherapy, 53, 58–64. Bryan, J., Frank, L.A., Rohrbach, B.W., Burgette, L.J., Cain, C.L. & Bemis, D.A. (2012) Treatment outcome of dogs with meticillin-resistant and meticillin-susceptible Staphylococcus pseudintermedius pyoderma. Veterinary Dermatology, 23, 361–368. Bundtzen, R.W., Gerber, A.U., Cohn, D.L. & Craig, W.A. (1981) Postantibiotic suppression of bacterial growth. Reviews of Infectious Diseases, 3, 28–37. Burgess, D.S., Frei, C.R., Lewis, J.S. II, Fiebelkorn, K.R. & Jorgensen, J.H. (2007) The contribution of pharmacokinetic-pharmacodynamic
© 2015 John Wiley & Sons Ltd
modelling with Monte Carlo simulation to the development of susceptibility breakpoints for Neisseria meningitidis. Clinical Microbiology and Infection, 13, 33–39. Cannon, M., Harford, S. & Davies, J. (1990) A comparative study on the inhibitory actions of chloramphenicol, thiamphenicol and some fluorinated derivatives. Journal of Antimicrobial Chemotherapy, 26, 307–317. Choi, M.J., Lee, E.M., Lee, S.J., Reza, M.D., Lee, J.S., Gebru, E., Rhee, M.H. & Park, S.C. (2011) The in vitro antibacterial activity of florfenicol in combination with amoxicillin or cefuroxime against pathogenic bacteria of animal origin. Pakistan Veterinary Journal, 31, 141– 144. CLSI. 2013a. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, Approved Standard, 4th Edition. Vet01-A4. Clinical and Laboratory Standards Institute, Wayne, PA. CLSI. 2013b. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, Second Informational Supplement. Vet01-S2. Clinical and Laboratory Standards Institute, Wayne, PA. Craig, W.A. (2003) Basic pharmacodynamics of antibacterials with clinical applications to the use of beta-lactams, glycopeptides, and linezolid. Infectious Disease Clinics of North America, 17, 479–501. Craig, W.A. (2007). Chapter 1. Pharmacodynamics of antimicrobials: general concepts and applications. In Antimicrobial Pharmacodynamics in Theory and Clinical Practice, 2 edn. Eds Nightingale, C.H., Ambrose, P.G., Drusano, G.L. & Murakawa, T., pp. 1–19. Informa Healthcare USA, Inc., New York. Craig, W.A. & Gudmundsson, S. (1996) Postantibiotic effect. In Antibiotics in Laboratory Medicine. 4th edn. Ed Lorian, V., pp. 304–305. The Williams & Wilkins Co., Baltimore. von Czapiewski, E. (2010) Determination of the Minimum Inhibitory Concentration by Broth Microdilution for Pathogenic Bacteria of Fish and Molecular Characterization of Antimicrobial Resistance Genes. Doctoral dissertation. University of Veterinary Medicine Hannover, Hannover, Germany. Eliopoulos, G.M. & Moellering, R.C. Jr (1996) Antimicrobial combinations. In Antibiotics in Laboratory Medicine, 4th edn. Ed Lorian, V., pp. 330–396. The Williams & Wilkins Co., Baltimore. EMA (European Medicines Agency. Available from http://www. ema.europa.eu/docs/en_GB/document_library/Maximum_Residue_ Limits_-_Report/2009/11/WC500014274.pdf (accessed 10 December 2014). Ewers, C., Bethe, A., Semmler, T., Guenther, S. & Wieler, L.H. (2012) Extended-spectrum b–lactamase-producing and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on public health: a global perspective. Clinical Microbiology and Infection, 18, 646–655. Frank, L.A. & Loeffler, A. (2012) Meticillin-resistant Staphylococcus pseudintermedius: clinical challenge and treatment options. Veterinary Dermatology, 23, 283–E256. French, G.L. (2006) Bactericidal agents in the treatment of MRSA infections – the potential role of daptomycin. Journal of Antimicrobial Chemotherapy, 58, 1107–1117. Gomez-Sanz, E., Kadlec, K., Feßler, A.T., Zarazaga, M., Torres, C. & Schwarz, S. (2013) A novel fexA variant from a canine Staphylococcus pseudintermedius isolate that does not confer florfenicol resistance. Antimicrobial Agents and Chemotherapy, 57, 5763–5766. Grobbel, M., Lubke-Becker, A., Alesik, E., Schwarz, S., Wallmann, J., Werckenthin, C. & Wieler, L.H. (2007) Antimicrobial susceptibility of Escherichia coli from swine, horses, dogs and cats as determined in the BfT-GermVet monitoring program 2004–2006. Berliner und Munchener Tierarztliche Wochenschrift, 120, 391–401.
8 M. G. Maaland et al. Guignard, B., Vouillamoz, J., Giddey, M. & Moreillon, P. (2013) A positive interaction between inhibitors of protein synthesis and cefepime in the fight against methicillin-resistant Staphylococcus aureus. European Journal of Clinical Microbiology & Infectious Diseases, 32, 899–907. Hindler, J.F. & Munro, S. (2010). Section 5.10.1 Minimum bactericidal concentration testing. In Clinical Microbiology Procedures Handbook, 3 edn. Ed Garcia, L.S., pp. 5.10.1.1–5.10.1.17. ASM Press, Washington, DC. Illambas, J., Potter, T., Sidhu, P., Rycroft, A.N., Cheng, Z. & Lees, P. (2013) Pharmacodynamics of florfenicol for calf pneumonia pathogens. Veterinary Record, 172, 340. Jakobsen, L., Cattoir, V., Jensen, K.S., Hammerum, A.M., Nordmann, P. & Frimodt-Moller, N. (2012) Impact of low-level fluoroquinolone resistance genes qnrA1, qnrB19 and qnrS1 on ciprofloxacin treatment of isogenic Escherichia coli strains in a murine urinary tract infection model. Journal of Antimicrobial Chemotherapy, 67, 2438–2444. Karczmarczyk, M., Abbott, Y., Walsh, C., Leonard, N. & Fanning, S. (2011) Characterization of multidrug-resistant Escherichia coli isolates from animals presenting at a university veterinary hospital. Applied and Environmental Microbiology, 77, 7104–7112. Kikuvi, G.M., Schwarz, S., Ombui, J.N., Mitema, E.S. & Kehrenberg, C. (2007) Streptomycin and chloramphenicol resistance genes in Escherichia coli isolates from cattle, pigs, and chicken in Kenya. Microbial Drug Resistance-Mechanisms Epidemiology and Disease, 13, 62–68. Li, R.C. & Tang, M.C. (2004) Post-antibiotic effect induced by an antibiotic combination: influence of mode, sequence and interval of exposure. Journal of Antimicrobial Chemotherapy, 54, 904–908. Ling, G.V., Norris, C.R., Franti, C.E., Eisele, P.H., Johnson, D.L., Ruby, A.L. & Jang, S.S. (2001) Interrelations of organism prevalence, specimen collection method, and host age, sex, and breed among 8354 canine urinary tract infections (1969–1995). Journal of Veterinary Internal Medicine, 15, 341–347. Manning, L., Laman, M., Greenhill, A.R., Michael, A., Siba, P., Mueller, I. & Davis, T.M.E. (2011) Increasing chloramphenicol resistance in Streptococcus pneumoniae isolates from Papua New Guinean children with acute bacterial meningitis. Antimicrobial Agents and Chemotherapy, 55, 4454–4456. Marcellin-Little, D.J., Papich, M.G., Richardson, D.C. & DeYoung, D.J. (1996) Pharmacokinetic model for cefazolin distribution during total hip arthroplasty in dogs. American Journal of Veterinary Research, 57, 720–723. Moodley, A., Damborg, P. & Nielsen, S.S. (2014) Antimicrobial resistance in methicillin susceptible and methicillin resistant Staphylococcus pseudintermedius of canine origin: literature review from 1980 to 2013. Veterinary Microbiology, 171, 337–341. Nielsen, E.I. & Friberg, L.E. (2013) Pharmacokinetic-pharmacodynamic modeling of antibacterial drugs. Pharmacological Reviews, 65, 1053–1090. Papich, M.G. (2012) Selection of antibiotics for meticillin-resistant Staphylococcus pseudintermedius: time to revisit some old drugs? Veterinary Dermatology, 23, 352–E364. Park, B.K., Lim, J.H., Kim, M.S., Hwang, Y.H. & Yun, H.I. (2008) Pharmacokinetics of florfenicol and its metabolite, florfenicol amine, in dogs. Research in Veterinary Science, 84, 85–89. Perreten, V., Kadlec, K., Schwarz, S., Andersson, U.G., Finn, M., Greko, C., Moodley, A., Kania, S.A., Frank, L.A., Bemis, D.A., Franco, A., Iurescia, M., Battisti, A., Duim, B., Wagenaar, J.A., van Duijkeren, E., Weese, J.S., Fitzgerald, J.R., Rossano, A. & Guardabassi, L. (2010)
Clonal spread of methicillin-resistant Staphylococcus pseudintermedius in Europe and North America: an international multicentre study. Journal of Antimicrobial Chemotherapy, 65, 1145–1154. Richardson, D.C., Aucoin, D.P., Deyoung, D.J., Tyczkowska, K.L. & Deyoung, B.A. (1992) Pharmacokinetic disposition of cefazolin in serum and tissue during canine total hip-replacement. Veterinary Surgery, 21, 1–4. Rutland, B.E., Weese, J.S., Bolin, C., Au, J. & Malani, A.N. (2009) Human-to-dog transmission of methicillin-resistant Staphylococcus aureus. Emerging Infectious Diseases, 15, 1328–1330. Sasaki, T., Tsubakishita, S., Tanaka, Y., Sakusabe, A., Ohtsuka, M., Hirotaki, S., Kawakami, T., Fukata, T. & Hiramatsu, K. (2010) Multiplex-PCR method for species identification of coagulase-positive staphylococci. Journal of Clinical Microbiology, 48, 765–769. Schnellmann, C., Gerber, V., Rossano, A., Jaquier, V., Panchaud, Y., Doherr, M.G., Thomann, A., Straub, R. & Perreten, V. (2006) Presence of new mecA and mph(C) variants conferring antibiotic resistance in Staphylococcus spp. isolated from the skin of horses before and after clinic admission. Journal of Clinical Microbiology, 44, 4444–4454. Schwartz, M., Boettcher, I.C., Kramer, S. & Tipold, A. (2009) Two dogs with iatrogenic discospondylitis caused by meticillin-resistant Staphylococcus aureus. Journal of Small Animal Practice, 50, 201–205. Schwarz, S. & Kehrenberg, C. (2006) Old dogs that learn new tricks: modified antimicrobial agents that escape pre-existing resistance mechanisms. International Journal of Medical Microbiology, 296, 45–49. Schwarz, S., Kehrenberg, C., Doublet, B. & Cloeckaert, A. (2004) Molecular basis of bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiology Reviews, 28, 519–542. Schwarz, S., Alesik, E., Werckenthin, C., Grobbel, M., Lubke-Becker, A., Wieler, L.H. & Wallmann, J. (2007) Antimicrobial susceptibility of coagulase-positive and coagulase-variable staphylococci from various indications of swine, dogs and cats as determined in the BfT-GermVet monitoring program 2004–2006. Berliner und Munchener Tierarztliche Wochenschrift, 120, 372–379. Settepani, J.A. (1984) The hazard of using chloramphenicol in food animals. Journal of the American Veterinary Medical Association, 184, 930–931. Short, J., Zabel, S., Cook, C. & Schmeitzel, L. (2014) Adverse events associated with chloramphenicol use in dogs: a retrospective study (2007–2013). The Veterinary Record, 175, 537–539. Spohr, A., Schjøth, B., Wiinberg, B., Houser, G., Willesen, J., Jessen, L.R., Guardabassi, L., Schjærff, M., Eriksen, T. & Jensen, V.F. (2012). Antibiotic use Guidelines for Companion Animal Practice. Danish Small Animal Veterinary Association (SvHKS).https://www.ddd.dk/organisatorisk/sektionsmaadyr/Documents/AntibioticGuidelines.pdf (accessed 9 September 2013). Turnidge, J. & Paterson, D.L. (2007) Setting and revising antibacterial susceptibility breakpoints. Clinical Microbiology Reviews, 20, 391–408. Watson, A.D.J. (1977) Chloramphenicol toxicity in dogs. Research in Veterinary Science, 23, 66–69. White, D.G., Hudson, C., Maurer, J.J., Ayers, S., Zhao, S.H., Lee, M.D., Bolton, L., Foley, T. & Sherwood, J. (2000) Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. Journal of Clinical Microbiology, 38, 4593–4598. Yunis, A.A. (1988) Chloramphenicol – relation of structure to activity and toxicity. Annual Review of Pharmacology and Toxicology, 28, 83–100.
© 2015 John Wiley & Sons Ltd
