Biomaterials 35 (2014) 3571e3581

Contents lists available at ScienceDirect

Biomaterials journal homepage: www.elsevier.com/locate/biomaterials

In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells Ji-Yun Ko, Kyung-Il Kim, Siyeon Park, Gun-Il Im* Department of Orthopaedics, Dongguk University Ilsan Hospital, 814 Siksa-Dong, Goyang 411-773, Republic of Korea

a r t i c l e i n f o

a b s t r a c t

Article history: Received 23 December 2013 Accepted 7 January 2014 Available online 24 January 2014

The purpose of this study was to investigate the chondrogenic features of human induced pluripotent stem cells (hiPSCs) and examine the differences in the chondrogenesis between hiPSCs and human bone marrow-derived MSCs (hBMMSCs). Embryoid bodies (EBs) were formed from undifferentiated hiPSCs. After EBs were dissociated into single cells, chondrogenic culture was performed in pellets and alginate hydrogel. Chondro-induced hiPSCs were implanted in osteochondral defects created on the patellar groove of immunosuppressed rats and evaluated after 12 weeks. The ESC markers NANOG, SSEA4 and OCT3/4 disappeared while the mesodermal marker BMP-4 appeared in chondro-induced hiPSCs. After 21 days of culture, greater glycosaminoglycan contents and better chondrocytic features including lacuna and abundant matrix formation were observed from chondro-induced hiPSCs compared to chondroinduced hBMMSCs. The expression of chondrogenic markers including SOX-9, type II collagen, and aggrecan in chondro-induced hiPSCs was comparable to or greater than chondro-induced hBMMSCs. A remarkably low level of hypertrophic and osteogenic markers including type X collagen, type I collagen and Runx-2 was noted in chondro-induced hiPSCs compared to chondro-induced hBMMSCs. hiPSCs had significantly greater methylation of several CpG sites in COL10A1 promoter than hBMMSCs in either undifferentiated or chondro-induced state, suggesting an epigenetic cause of the difference in hypertrophy. The defects implanted with chondro-induced hiPSCs showed a significantly better quality of cartilage repair than the control defects, and the majority of cells in the regenerated cartilage consisted of implanted hiPSCs. Ó 2014 Elsevier Ltd. All rights reserved.

Keywords: Human iPS cells Human mesenchymal stem cells Chondrogenic differentiation Cartilage repair

1. Introduction Articular cartilage (AC) does not heal spontaneously in adults when damaged, progressing to osteoarthritis (OA). This inability to self-repair after damage has encouraged extensive studies on AC regeneration [1,2], the most commonly investigated strategy being cell-based treatments. A number of cell sources have been explored for AC regeneration. Of these, autologous chondrocytes were first used in clinical practice [3]. However, inherent problems were reported with autologous chondrocytes implantation (ACI). Chondrocytes have limited proliferative potential and quickly lose their functional phenotypes in culture [4]. In addition, an extra injury is done to the joint during the harvesting procedure even though the harvest site is located away from the lesion. An alternative method to ACI is the use of adult mesenchymal stem cells (MSCs). Tissue regeneration from MSCs takes advantage of the natural course of

* Corresponding author. Tel.: þ82 31 961 7315; fax: þ82 31 961 7314. E-mail address: [email protected] (G.-I. Im). 0142-9612/$ e see front matter Ó 2014 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.biomaterials.2014.01.009

embryonic development [5e8]. One critical shortcoming with MSCs is premature hypertrophy which would result in a tissue incapable of enduring the pressure and shear force that the AC is subjected to [9e11]. In addition, the number of MSCs, their proliferative capacity as well as their differentiation potential is known to decline with age [12]. Embryonic stem cells (ESCs) may provide a potential alternative for cartilage tissue engineering. Human embryonic stem cells (hESCs) have drawn great attention as a cell source for regenerative medicine [13,14]. The most compelling advantage of hESCs for cartilage regeneration is that they can potentially provide an unlimited number of chondrocytes or chondroprogenitors for implantation. However, derivation of hESCs from early embryos raises ethical limitations for their use in clinic practice [15]. Induced pluripotent stem cells (iPSCs), generated from somatic cells by transduction of defined reprogramming transcription factors, typically OCT4, SOX2, KLF4, and c-MYC, offer a new path to avoid the controversy of using hESCs [16,17]. iPSCs express many of the markers associated with pluripotent cells, and are known to possess an epigenetic status similar to that of ESCs [16e20]. iPSCs

3572

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581

function in a manner indistinguishable from ESCs by differentiating into cell types that are characteristic of the three germ layers in vitro and in vivo. As iPSCs also have high proliferative and differentiation capabilities similar to those of hESCs, they hold great potential for regenerative medicine [21]. In order to be regarded as a clinically viable alternative to MSCs, iPSCs should demonstrate a property superior or comparable to that of MSCs. iPSC-derived mesenchymal cells were able to attenuate the injury associated with hindlimb ischemia in a rodent model and contributed to tissue regeneration to a greater degree than bone marrow-derived stem cells [22]. Further studies have also demonstrated that iPSCs can be differentiated into skeletal muscle, adipocytes, and vascular lineages in vitro [23e26]. Several obstacles still need to be overcome before iPSCs can be considered as a potential therapeutic measure for cartilage regeneration. First, the persistence of differentiated phenotypes in vivo must be demonstrated. Second, simple and standardized protocols to generate ‘‘easy to grow’’ cell populations are necessary for the clinical application of iPSCs, so that the cells can survive in vivo transplantations and regenerate functional tissue without the risk of tumor formation. Although significant progress has recently been made with regard to iPSCs in musculoskeletal regenerative medicine [27,28], the chondrogenic features of human iPSCs (hiPSCs) in comparison with MSCs were not reported, particularly regarding the difference in hypertrophy induction. In addition, to the best of our knowledge, there are no published reports that examined whether and how the implantation of hiPSCs promotes the repair of chondral defect. The purpose of this study was to investigate the chondrogenic features of hiPSCs in tandem with bone marrow-derived MSCs (BMMSCs) and examine the underlying cause of differences in the chondrogenesis between two cell types. The in vivo capacity of hiPSCs for cartilage regeneration was also assessed using an osteochondral defect model. 2. Materials and methods 2.1. hiPSC culture To avoid potential safety issues associated with the use of viruses, we used the hiPS cell line (SC802A-1, System Biosciences In. Mountain View, CA) created by direct delivery of four proteins fused to a cell penetrating peptide into human fibroblasts in the present study [29]. Undifferentiated hiPSCs were maintained as described previously [17,20]. To prepare feeder-free hiPSCs for differentiation experiments, hiPSCs were passaged to Matrigel-coated polystyrene plates and cultured in the defined mTeSR1 medium (STEMCELL Technologies Inc., Vancouver, BC, Canada). A combined use of mTeSR1 medium and Matrigel-coated substrates had proven to support the feeder-independent maintenance of hiPSCs [30,31].

2.2. Differentiation into embryoid bodies In vitro differentiation of hiPSCs was performed using the standard embryoid body (EB) differentiation method [32] with minor modifications. For sphere formation, cells were dissociated with 0.05% trypsin-EDTA and plated onto 6-well ultra-low-attachment plates (Corning, Tewksbury, MA, USA). After 2 days of sphere formation, EBs were cultured in ESC medium in the presence of 107 M alltrans retinoic acid (ATRA) for 10 days. Medium was changed every other day.

2.3. Induction of chondrogenic differentiation 2.3.1. Chondrogenic pellet culture with hiPSCs hiPSC-EBs were dissociated to a single cell suspension by trypsinizing and then diluting to a final concentration of 5.0  105 cells/ml. Micromass pellets were cultured as non-adherent spheres in 5-ml round tubes for 21 days. Chondrogenic medium consisted of DMEM/F-12 as base medium, and was supplemented with 10% FBS, 107 M dexamethasone, 50 mM ascorbate-2-phosphate, 50 mM L-proline, 1 mM sodium pyruvate, 1% insulinetransferrineselenium, and 10 ng/ml TGF-b3 (R&D Systems, Minneapolis, MN, USA) [33]. The tubes were then placed in an incubator at 37  C in a humidified 5% CO2 atmosphere. Chondrogenic differentiation of hiPSCs was also performed in alginate gels using the same chondrogenic medium.

2.3.2. Chondrogenic differentiation of hBMMSCs The bone marrow samples used to isolate hBMMSCs were obtained from three patients (mean age: 64 years, range: 54e72 years) undergoing total hip replacement due to osteoarthritis. Informed consent was obtained from all donors. hBMMSCs were isolated from fresh bone marrow samples, and then expanded as described previously [34]. Chondrogenic pellet cultures were performed in the same method and culture medium as used in hiPSCs for 21 days. 2.3.3. Chondrogenic differentiation of hiPSCs or hBMMSCs in alginate gel For constructs with alginate, dissociated hiPSCs or hBMMSCs were suspended at a density of 1.5  106 cells per 100 ml in 2% alginate (Sigma). Polymerization of alginate was then achieved by dropping the grafts into 100 mM CaCl2 solution. After instantaneous gelation, the alginate was allowed to polymerize further for a period of 8e10 min in the CaCl2 solution. Thereafter, all beads were thoroughly washed with PBS (Gibco, Carlsbad, CA, USA) and were cultured in a 24-well plate (Nunc, Waltham, MA, USA) under the same chondrogenic medium and conditions as in pellet culture. Media were changed every 3e4 days. Cell viability was determined with the LIVE/DEADÒ Viability/Cytotoxicity Kit (Invitrogen, Carlsbad, CA, USA). Alginates were washed in PBS and exposed to 4 mM calcein-AM and 2 mM ethidium homodimer in PBS for 20 min at 37  C. Dye uptake was detected by using a Leica fluorescence microscope with filter cubes for fluorescein (for calcein in live cells) and Texas red (for ethidium homodimer) in dead cells. 2.4. Biochemical assays for DNA and GAG quantification After 21 days of in vitro culture, the alginate hydrogels were dissolved by incubating the beads for 20 min in dissolution solution (55 mM EDTA, 10 mM HEPES, pH 7.4). The pellets were digested overnight in papain buffer at 60  C. DNA content was determined using the Quant-iTÔ dsDNA assay kit and QubitFluorometer system (Invitrogen). Glycosaminoglycan (GAG) production was determined using a Blyscan kit (Biocolor, Carrickfergus, UK) according to the manufacturer’s instructions. 2.5. RT-qPCR Total RNA preparation, cDNA synthesis, and reverse transcriptionequantitative polymerase chain reaction (RT-qPCR) reactions were performed as described previously [34]. Primer information is provided in Supplementary Table 1. The relative normalization ratio of PCR products derived from each target gene was calculated using the software of the LightCycler System (Roche, Indianapolis, IN, USA). All experiments were performed in triplicate. 2.6. Western blot analysis Proteins were extracted from cultures, electrophoresed and transferred to a nitrocellulose membrane. The blot was probed with anti-rabbit type II collagen (COL2A1; 1:500; Abcam, Cambridge, UK), type X collagen (COL10A1; 1:500; Abcam), type I collagen (COL1A1; 1:500; Abcam), SOX-9 (1:1000; Abcam), Runx-2 (1:500; Abcam), an anti-mouse aggrecan (1:100; Abcam), followed by horseradish peroxidase (HRP)-conjugated anti-rabbit IgG or anti-mouse IgG (1:2000; Cell Signaling Technology, Beverly, MA, USA). This experiment was repeated in three samples, each from different individuals. 2.7. Immunohistochemistry (IHC) The cells or sections were blocked with 5% normal donkey serum (NDS) and 0.1% Triton X-100 in PBS at room temperature for 1 h. The following primary antibodies were applied overnight at 4  C: rabbit polyclonal antibodies including NANOG 1:200 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), brachyury (1:200; Abcam), COL2A1 (1:200; Abcam), COL1A1 (1:200; Abcam), SOX-9 (1:200; Abcam), and Runx-2 (1:100; Abcam), and mouse monoclonal antibodies including Oct3/4 (1:200; Santa Cruz Biotechnology), SSEA4 (1:100; R&D systems), COL10A1 (1:200; Sigma), human nuclear antigen (HN; 1:100; Chemicon Temecula, CA, USA), and aggrecan (1:100; Abcam). Appropriate fluorescence-tagged secondary antibodies (R&D Systems) were used for visualization. 2.8. Methylation-Specific polymerase chain reaction (MSP) Genomic DNA was extracted from hiPSCs (triplicates) and hBMMSCs (3 donors) using a GeneAllÒ ExgeneÔ Tissue SV kit (GeneAll, Seoul, Korea) according to the manufacturer’s instructions. Bisulfite-modified genomic DNA was also prepared using an EpiTectÒ Bisulfite kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. CpG sites within the upstream sequences approximately 5.0 kb from the transcription start site (TSS) of COL10A1 gene were analyzed (Supplementary Table 2). From the quantified data, methylation index (MI) was defined as intensity of methylated band divided by the sum of intensity of both methylated and unmethylated band. 2.9. Bisulfite sequencing (BSQ) analysis Genomic DNA extracted in MSP was also used for bisulfite sequencing (BSQ). Primers were designed, based on Zimmermann et al. [35] (Supplementary Table 3).

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581 After PCR using bisulfite-treated genomic DNA was performed, elute of specific PCR product was ligated with pGEMÒ-T Easy Vector (Promega, Madison, Wisconsin, USA) according to the manufacturer’s instructions. After transformation of ligated products into DH5a chemically competent E. coli, clones were screened. Positive clones (n ¼ 5e15) were cultured and plasmid DNA was isolated using GeneAllÒ ExprepÔ Plasmid SV kit (GeneAll) according to its manual. Total methylation rates were obtained by multiplying methylated CpG sites per total analyzed clone number by total CpG sites in hiPSCs and BMMSCs.

3573

2.13. Macroscopic observation and histology Regenerated cartilage was grossly examined using the International Cartilage Repair Society (ICRS) macroscopic score [36], which evaluates the degree of defect repair, integration to the border zone, and the macroscopic appearance. The histologic grading scale as described by Wakitani [37,38] was used to evaluate the quality of the repaired tissue (Supplementary Table 5). 2.14. Statistical analysis

2.10. 5-Azacytidine (AzaC) treatment hiPSCs and hBMMSCs were plated at 30e40% confluence and treated 24 h later (day 0) with 0.006% DMSO or 10 mM 5-AzaC (Sigma, St. Louis, MO, USA) in 0.006% DMSO. Media containing DMSO or DMSOþ5-AzaC was exchanged daily. Cells were harvested for analysis after 8 days.

2.11. Electrophoretic mobility shift assay (EMSA)

All quantitative data are expressed as mean  SEM of at least 3 independent experiments. Statistical comparisons were made by ANOVA, with Tukey post-hoc analysis (SPSS 15.0; SPSS Inc., Chicago, IL) when two or more groups were involved. Statistical significance was set at a P < 0.05.

3. Results 3.1. Generation of hiPSC-chondrogenic pellets

To search putative transcription factors interacting with the human COL10A1 promoter (1 w 300 bp), we performed using web-based software (Tfsitescan; http://www.ifti.org/cgi-bin/ifti/Tfsitescan.pl). A predicted putative transcription factors included Specificity Protein 1 (Sp1). The binding site of Sp1 was located on 134 w 147 from TSS which included CpG site examined in BSQ region 6. In vitro DNA binding activity for Sp1 were assayed using 5 mg of hiPSCs and hBMMSC nuclear extracts (Supplementary Table 4).

EBs were formed by the addition of retinoic acid from undifferentiated hiPSCs. After these cells were dissociated into single cells, chondrogenic pellet culture was performed. After 21 days of pellet culture, chondrocytic features including lacuna and abundant matrix formation were observed, especially in the peripheral areas of the pellets (Fig. 1).

2.12. Osteochondral defect model The animal experiments conducted in this study were approved by the Animal Research and Care Committee of our institution. 9-week-old male SpragueeDawley rats were used in this study. A 1.5-mm outer diameter trephine drill was used to create osteochondral defects (2.0  4.0 mm) in the trochlear groove of the femur. The hiPSC-pellets or alginate-hiPSCs constructs, which were prepared in the same way as the in vitro study and cultured for 21 days, were implanted in the osteochondral defects. The defects were managed using one of the following methods: no treatment (group 1); filling with alginate hydrogel only (group 2); filling with three hiPSC-pellets (group 3); and filling with alginate-hiPSCs construct (group 4). Each group consisted of 6 rats. After 12 weeks, the rats were sacrificed for gross and histological examinations.

3.2. Disappearance of ESC markers and appearance of mesodermal markers ESC markers NANOG, SSEA4 and OCT3/4 were expressed from the undifferentiated hiPSCs. They stopped to appear in EBs and hiPSCchondrogenic pellets. On the other hand, the mesodermal marker, brachyury, which was not observed in undifferentiated hiPSCs, appeared in abundance from EBs, then disappeared from hiPSCchondrogenic pellets. Another mesodermal marker, BMP-4,

A Undifferentiated hiPSCs media :

KSR+bFGF

EB formation

w/ RA

w/o RA

Pellet culture

Chondrogenic media

B hiPSCs

Pellet

EBs

H&E

100μm Fig. 1. Generation of chondrogenic pellets. Time schedule for chondrogenic induction from hiPSCs (A). Undifferentiated hiPSCs and EBs in culture plate, and hiPSC-chondrogenic pellets in culture tube and HE stain (B).

3574

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581

appeared in EBs and hiPSC-chondrogenic pellets (Fig. 2). These findings suggest that hiPSC-chondrogenic pellets lost the properties of undifferentiated hiPSCs and acquired those of mesodermal cells. 3.3. Morphological and biochemical characterization of chondroinduced hiPSCs GAG analysis and Safranin-O staining were performed after 21 days of chondro-induction. Chondro-induced hiPSCs in pellets or in alginate hydrogels were compared with chondro-induced hBMMSCs as well as with undifferentiated hiPSCs and EBs. GAG content significantly increased in chondro-induced hiPSCs compared to undifferentiated hiPSCs (2.5e3-fold, P < 0.01). GAG content also significantly increased in chondro-induced hBMMSCs compared to undifferentiated hBMMSCs (P < 0.01). There was not a significant difference in GAG content according to culture method: pellets or alginate hydrogel. The GAG content of hiPSCchondrogenic pellets was significantly greater than that of

mRNA relative expression

A

1.5 1

*

* *

1.5 1

3.4. Chondrogenic markers in hiPSC-chondrogenic pellets Chondrogenic gene expression was evaluated by RT-qPCR on day 7, 14, 21 of chondro-induction from chondrogenic pellets. Western blotting and IHC were performed for chondrogenic protein expression on day 21. The gene expression of SOX-9, the master transcription factor of chondrogenesis, gradually increased in hiPSC-chondrogenic pellets compared to undifferentiated hiPSCs, significantly greater at day 14 and 21 (P < 0.01). COL2A1, the key

Oct3/4

*

*

8 6

Brachyury

*

*

4 0.5 0

0.5 hiPSCs EBs Pellets Nanog/DAPI

0

2 hiPSCs EBs Pellets SSEA4/DAPI

0

hiPSCs EBs Pellets Oct3/4/DAPI

18 15 12 9 6 3 0

BMP4

*

*

hiPSCs EBs Pellets Brachyury/DAPI

Pellet

EB

hiPSCs

B

Nanog

hBMMSC-chondrogenic pellets (P < 0.05, Fig. 3A). Safranin-O staining also showed increased matrix formation along with chondrocyte-like cell forming lacuna in hiPSC-chondrogenic pellets, which looked better differentiated than those in hBMMSCchondrogenic pellets (Fig. 3B). In alginate hydrogel, hiPSCs were evenly distributed in similar way to hBMMSCs and also demonstrated chondrocyte-like appearances (Fig. 3C). Cell viability assay showed that a vast majority of hiPSCs were alive (Fig. 3D).

30μm Fig. 2. Disappearance of ESC markers and appearance of mesodermal markers in EBs and hiPSC-chondrogenic pellets. RT-qPCR from undifferentiated hiPSCs, EBs, and hiPSCchondrogenic pellets for ESC markers NANOG, OCT3/4 and mesodermal markers brachyury and BMP-4 (A). IHC from undifferentiated hiPSCs, EBs, and hiPSC-chondrogenic pellets for ESC markers NANOG, SSEA4 and OCT3/4 and the mesodermal marker brachyury (B). Bar represents mean  SE. N ¼ 3, *P < 0.05.

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581

A

**

GAG/DNA (μg/μg)

10 8

** ** **

#

B

hiPSCs

3575

hiPSC-Pellet

** **

6 4

50μm

2

hBMMSC-Pellet

0

50μm

C

1.0mm

hiPSCs in alginate

D

Live/Dead

hBMMSCs in alginate

50μm

50μm Fig. 3. Morphological and biochemical characterization of chondro-induced hiPSCs versus hBMMSCs after 21 days. GAG per DNA (A), Safranin-O staining of chondrogenic pellets (B), and chondro-induced cells in alginate hydrogel (C). Live/dead cell assay of hiPSCs in alginate hydrogel. Live cells are green and dead cells are red (D). Bar represents mean  SE. N ¼ 3, **P < 0.01, #P < 0.05 versus hiPSC-pellets (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).

chondrogenic marker, also significantly increased in hiPSCchondrogenic pellets at day 14 (8-fold) and 21 (19-fold) compared to undifferentiated hiPSCs (P < 0.01). Aggrecan, another chondrogenic marker, also significantly increased at day 21, 5-fold greater in hiPSC-chondrogenic pellets than in undifferentiated hiPSCs (P < 0.01). The expression of all three genes also increased with chondrogenic differentiation in hBMMSCs. COL2A1 and aggrecan gene expressions were significantly greater in hiPSCchondrogenic pellets than in hBMMSC-chondrogenic pellets at day 21 of chondrogenic culture (P < 0.01, Fig. 4A). The findings from Western blotting showed noticeable increase of SOX-9, COL2A1 and aggrecan in hiPSC-chondrogenic pellets at day 21 compared to undifferentiated hiPSCs or EBs. SOX-9 and COL2A1 also increased in hBMMSC-chondrogenic pellets compared to untreated hBMMSCs. hiPSC-chondrogenic pellets had greater expression of all three proteins than hBMMSC-pellets (Fig. 4B). IHC findings also showed abundant expression of chondrogenic markers in hiPSC-chondrogenic pellets which were comparable to or greater than in hBMMSC-chondrogenic pellets. While SOX-9, a transcription factor, was principally located within the nucleus, COL2A1 and aggrecan were found in the cytoplasm and intercellular areas (Fig. 4C).

3.5. Low level of hypertrophic or osteogenic markers in the hiPSCchondrogenic pellets To prove whether the chondrogenic pellets acquired desirable phenotypes of chondrocytes, COL10A1, the marker of hypertrophy, and COL1A1, the marker of osteogenesis as well as Runx-2 which characterize both processes, were analyzed after 21 days of culture. The results from RT-qPCR showed that there were no significant differences in COL10A1, Runx-2 and COL1A1 mRNA expression in hiPSC-chondrogenic pellets compared to undifferentiated hiPSCs or EBs. Of note, undifferentiated hBMMSCs had 10-fold greater gene expression of COL10A1 than undifferentiated hiPSCs (P < 0.05). The difference in COL10A1 level was even larger, over 100-fold, between hiPSC-chondrogenic pellets and hBMMSC-chondrogenic pellets (P < 0.01). Undifferentiated hBMMSCs also had 11-fold and 27-fold greater gene expression of Runx-2 and COL1A1 (P < 0.05 and P < 0.01 respectively) than undifferentiated hiPSCs. As Runx-2 and COL1A1 mRNA level significantly decreased with chondroinduction in hBMMSCs (P < 0.01 and P < 0.05 respectively), the difference in Runx-2 and COL1A1 gene expression between hiPSCchondrogenic pellets and hBMMSC-chondrogenic pellets became less prominent, but was still significant (P < 0.05, Fig. 5A).

3576

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581

SOX9

3

**

2

** **

**

1 0

20

hiPSCs hBMMSCs

##

mRNA relative expression

mRNA relative expression

4

hiPSCs hBMMSCs

15

**

10

C SOX9

B

Aggrecan

COL2A1

**

5 0

mRNA relative expression

A

*

** ##

hiPSC-Pellet DAPI

Merge

SOX9

##

6 4

hiPSCs hBMMSCs

*

2

** ** ##

0

hiBMMSC-Pellet Merge DAPI

COL2A1

DAPI

Merge

COL2A1

DAPI

Merge

Aggrecan

DAPI

Merge

Aggrecan

DAPI

Merge

SOX9 COL2A1 Aggrecan GAPDH

Day 21

Day 21

30μm

Fig. 4. RT-qPCR for chondrogenic genes SOX-9, COL2A1 and aggrecan from hiPSCs and hBMMSCs that underwent chondrogenic induction in pellets (A). Western blotting (B) and IHC (C) for chondrogenic markers SOX-9, COL2A1 and aggrecan from undifferentiated hiPSCs, EBs, hBMMSCs, hiPSC-pellets and hBMMSC-pellets after 21 days of chondro-induction. Bar represents mean  SE. N ¼ 3, *P < 0.05, **P < 0.01 versus day 0, ##P < 0.01 versus hiPSCs.

Western blotting for COL10A1, Runx-2 and COL1A1 on day 21 also paralleled the findings from RT-qPCR (Fig. 5B). From IHC, all of these markers were clearly detected in hBMMSC-chondrogenic pellets while no signal was visible in hiPSC-chondrogenic pellets on day 21 (Fig. 5C). These findings suggest that hiPSC-chondrogenic pellets, unlike hBMMSC-chondrogenic pellets, have very low expression of hypertrophic or osteogenic markers. 3.6. Greater methylation of COL10A1 promoter in hiPSCs compared with hBMMSCs In order to determine whether epigenetic difference explains the low expression of the hypertrophic marker COL10A1 in hiPSCs compared with hBMMSCs, we checked the methylation status of the promoter regions covering approximately 5.0 kb from the TSS of COL10A1 from genomic DNA isolated from hiPSCs and hBMMSCs via MSP and BSQ. COL10A1 promoter has no CpG islands up to the promoter site of 5.0 kb, and only 2 regions were available for MSP. Methylation was increased in hiPSCs compared to hBMMSC in the R1 (from 3514 to 3374) of COL10A1 promoter [MI (hiPSCs ¼ 0.62, hBMMSCs ¼ 0.53), P < 0.05] (Fig. 6A). We then investigated if decreased methylation of promoter really increase the expression of COL10A1 gene and protein expression by treating hiPSCs and hBMMSCs with 5-AzaC, a

demethylating agent. Treatment of 5-AzaC significantly reduced the methylation index of both hiPSCs and hBMMSCs, by three-fifths in R1 and by half to two-fifth in R2 (P < 0.05) as measured by MSP. The COL10A1 mRNA significantly increased in both cells, by 5-fold in hiPSCs and 3.6-fold in hBMMSCs (P < 0.05). The COL10A1 protein expression also significantly increased by 2.5-fold in hiPSCs and 2.2-fold in hBMMSCs (P < 0.05, Supplementary Fig. 1). COL10A1 promoter has a cell-type-specific enhancer element between 2.4 and 0.9 kb which is active only in hypertrophic chondrocytes [39]. As the region of 2.6 kb upstream of the COL10A1 TSS contains only 9 CpG sites, all of these 9 CpG sites were analyzed from 6 BSQ regions. Of 9 CpG sites, 5 sites were fully methylated in both hiPSCs and hBMMSCs, while 3 CpG sites in the 1718 w 758 region within BSQ region 1e3 showed significantly lower methylation in hBMMSCs than in hiPSCs (P < 0.05). As a next step, changes in the methylation status of COL10A1 promoter with chondroinduction were examined. While chondro-induction significantly reduced methylation of COL10A1 promoter in both hiPSCs and hBMMSCs (P < 0.05), chondro-induced hiPSCs still had significantly greater methylation than chondro-induced hBMMSCs in BSQ regions 1e3 and 4e6 of COL10A1 promoter (P < 0.05, Fig. 6B). Finally, to investigate if the change in the methylation within the COL10A1 proximal promoter region affected the binding affinity of transcription factors, we investigated whether the Sp1 site within

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581

COL10A1

A mRNA relative expression

200 150

10

#

12 9

#

6

NS

NS

**

##

*

30 25

10

NS

5

0

0

35

20 15

3

5

*

*

15

**

15

COL1A1

Runx2

**

3577

0

B COL10A1 Runx2 COL1A1 GAPDH

Runx2

COL10A1

COL1A1

Runx2

COL1A1

hBMMSC-Pellet

COL10A1

hiPSC-Pellet

C

30μm Fig. 5. Hypertrophic and osteogenic markers from hiPSCs, EBs, hBMMSCs, hiPSC-pellets and hBMMSC-pellets after 21 days of chondro-induction. RT-qPCR for COL10A1, Runx-2 and COL1A1 (A). Western blotting (B) and IHC (merged) for COL10A1, Runx-2 and COL1A1 (C). Bar represents mean  SE. N ¼ 3, *P < 0.05, **P < 0.01, #P < 0.05, ##P < 0.01 versus hiPSC.

the COL10A1 proximal promoter specifically interacted with Sp1 protein in nuclear extracts from hiPSCs and hBMMSCs. Methylated Sp1 probe had reduced binding affinity to Sp1 protein in both hiPSCs and hBMMSCs than unmethylated probe, indicating that methylation in CpG site of COL10A1 proximal promoter reduced the binding of Sp1 transcription factor (Fig. 6C).

with alginate alone (group 2) showed little evidence of cartilage regeneration (Fig. 7B). IHC for human nuclear antigen in groups 3 and 4 revealed that the majority of cells inside the regenerated cartilage were implanted hiPSCs (Fig. 7C). Macroscopic score was significantly better in group 3 and 4 than in groups 1 and 2 (P < 0.05). Groups 3 and 4 also had significantly better histological score than group 1 (P < 0.05, Fig. 7D).

3.7. Chondro-induced hiPSCs promote the healing of the osteochondral defects

4. Discussion

To investigate whether chondro-induced hiPSCs promote cartilage repair, hiPSCs in either pellet state or in alginate hydrogel were implanted in the osteochondral defects created on the patellar groove of immunosuppressed rats and the status of the created defects were observed 12 weeks after implantation. The defects treated with chondro-induced hiPSCs implantation were repaired with smooth, glistening, firm tissue while the control defects showed raw surface with or without thin fibrous covering tissue (Fig. 7A). Histological appearance revealed good restoration of the articular surface albeit with reduced amount of proteoglycan compared with adjacent normal cartilage in the defects treated with hiPSC-pellets (group 3) or hiPSC-alginate hydrogel (group 4). On the other hand, the control defects (group 1) and defects treated

The overall results demonstrated successful induction of chondrogenesis and repair of cartilage defect with hiPSCs. Apparently better quality of in vitro chondrogenic differentiation compared to hBMMSCs was demonstrated by histological appearance and greater expression of chondrogenic markers including GAG, SOX-9, COL2A1 and aggrecan. Another important point was very low expression of hypertrophic markers including COL10A1 and Runx-2 in hiPSCs, contrasting with hBMMSCs wherein COL10A1 expression markedly increased with chondrogenic induction. The COL10A1 promoters in hiPSCs were hypermethylated compared to hBMMSCs, suggesting the epigenetic disparity as the cause of the difference in hypertrophy. Adult MSCs are currently tested for their clinical applications in the orthopedic and cardiac fields. However, isolation of MSCs is

3578

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581

A -4,201 R1

-4,200

-3,490

-3,400 -3,396 -2,600

U M

-3,401

hiPSCs

-2,601

hBMMSCs

-1,801

-1,800

R2

-1,000

-372 -280

U M

-1,001

hiPSCs

-201

hBMMSCs

-200

U M

R2 U M

U M

Methylation Index (MI)

-5,000

R1

R1

U M

0.8

0.7 0.4 0.6

0.2 0

-1,000

-200

-1,001

-1,680; -1,674 BSQ3 BSQ4 - 936

BSQ5

- 547

-201 - 372 -280 -223

BSQ6

-1

-138

1

4 5

9

1

4 5

120 100

60 40 20 hBM hBM MSCs MSC- P

1

. N1 . N2

Before chondro-induction

hiPSCs hiPSC -P

*

100

*

80

0

9

*

45

*

80 60 40

20 0

9

hiPSCs hiPSC -P

1

4 5

hBM MSCs

C

hBM MSC - P

9

. N1 . N2

After chondro-induction

. N3

. N3 hiPSCs

hBM MSCs

*

*

% of methylated CpGsites

-1,800

-1,800

-2,447 BSQ2

hiPSCs

BSQ4 ~ 6

* % of methylated CpG sites

-2,600

0.5

hBM MSCs

hiPSCs

BSQ1 ~ 3 BSQ1

NS

0.6

-1

B

R2

*

0.7

hBMMSCs

hiPSC-P

COL10A1 proximal promoter SP1 EMSA

Methylated SP1 probe Unmethylated SP1 SP1 probe -150 GAGAGCCCAGCCCGATCTTGTGTGCCTACCCAATAGAACTTTCCACCATA -101 -138

hiPSC nuclear extracts

+

-

-

+

hBMMSC-P

hBMMSC nuclear extracts

+

-

-

+ SP1 + SP1 probe

EMSA Free SP1 probe

Fig. 6. The methylation status of COL10A1 promoter. hBMMSCs are from 3 different individuals. Scheme of MSP analysis for COL10A1 promoter. R1: regions from 3514 to 3,374, R2: regions from 394 to 258. CpG sites are denoted as short vertical lines. Bands from MSP on COL10A1 promoter from gDNA isolated from hiPSCs and hBMMSCs. U: unmethylated primer, M: methylated primer. Methylation index for COL10A1 promoter obtained from MSP bands (A). Scheme of BSQ for COL10A1 distal promoter. Dot diagram are drawn from BSQ results on COL10A1 promoter in undifferentiated hiPSCs, undifferentiated hBMMSCs, hiPSC-chondrogenic pellets (hiPSC-P), hBMMSC-chondrogenic pellets (hBMMSC-P). Black circle means methylated form and open circle means unmethylated form in CpG site. N1, N2, and N3 mean different hBMMSC donors. Total methylation rate on BSQ regions are compared among each subset. Bars represent mean  SE. N ¼ 3, *P < 0.05 (B). The location of Sp1 binding site on proximal COL10A1 promoter and the results EMSA for Sp1 probe binding to nuclear extracts from hiPSCs and hBMMSCs (C).

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581

A

Control

hiPSC-Pellet

B

Alginate

Alginate-hiPSCs

3579

Control

Alginate

hiPSC-Pellet

Alginate-hiPSCs

2mm

Alginate-hiPSCs

1mm

Histological Score

hiPSC-Pellet

Alginate

ICRS Macroscopic Score

D Control

1mm

*

C

NS

12 9

NS

6 3 0

Control (Gr 1) Gr 1

Gr 2 Gr 3

Gr 4

*

15

Alginate (Gr 2) hiPSC-Pellet (Gr 3) Alginate-hiPSCs (Gr 4)

10

NS

5 0

Gr 1

Gr 2

Gr 3

Gr 4

Fig. 7. In vivo repair of osteochondral defects using chondro-induced hiPSCs. Gross appearance of the defects: yellow dots outline the defect margin (A), histological finding of the defect from Safranin-O staining: arrows denote the margin of the defects (B), IHC for human antigen: positive cells are bright green (C), and ICRS macroscopic score and histological grading scale 12 weeks after implantation of hiPSCs (D). Bar represents mean  SE. N ¼ 6, *P < 0.05. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

associated with painful and invasive procedures. In addition, advanced age of the donor and culture time limit the potential of harvested cells to proliferate and differentiate into functional tissues [40,41]. AC does not have a capacity for self-regeneration when damaged and is therefore an interesting target for the development of tissue engineering strategies. The rational for using iPSCs comes from the idea of unlimited number of cells for regeneration. These cells can be expanded indefinitely in an undifferentiated state, enabling the derivation of an adequate number of differentiated progeny. In contrast, most adult stem cells such as MSCs and adipose stem cells show changes in differentiation potential after w4 passages in culture [42]. Derivation of iPSCs from minimally invasive sources such as skin fibroblasts or from joint cells obtained during surgery allows for patient-matched engineered tissues even from elderly patients or those with OA [43e45]. However, before iPSCs are applied for clinical treatment, the proofs that the cell differentiation process results in a homogenous population of therapeutically-relevant cell types, and that the differentiated phenotype can be retained in vivo are necessary. The differentiation of pluripotent cells toward the chondrogenic lineage is a complex process that typically involves multiple steps.

Several studies with mouse or human iPSCs have used 3D embryoid bodies as an intermediate step leading to subsequent chondrogenic differentiation [43,45,46]. Short-term exposure to BMP-4 in serumfree micromass cultures was effective in initiating chondrogenesis from mouse iPSCs, followed by the second phase of differentiation in which TGF-b3 was used to promote matrix formation. The two step procedure was used to avoid the terminal hypertrophic or osteogenic differentiation which can occur with long-term BMP stimulation [27,47]. However, for simplicity, we applied the same protocol (TGF-b3 in chondrogenic medium for 21 days) as used for MSCs in our laboratory to induce chondrogenesis from hiPSCs which had been dissociated into single cell from EB. Pellets which were chondro-induced thereby demonstrated robust production of chondrogenic markers, and had low level of hypertrophic chondrocyte markers and osteogenic markers. The lack of hypertrophic chondrocyte phenotypes in hiPSCs was particularly interesting as hypertrophy has been reported to occur inevitably during chondrogenesis from adult stem cells [48]. We assumed that one of the key explaining mechanisms lied in the different epigenetic status in the promoter region of these marker genes between hiPSCs and hBMMSCs, hinted from the report that

3580

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581

the methylation status of two CpG sites in the promoters of COL10A1 are increased in MSCs compared with articular chondrocytes [35]. Our MSP and BSQ studies first confirmed a greater degree of methylation on several CpG sites in the COL10A1 promoter region of hiPSCs compared to hBMMSCs. After verifying that 5-AzaC treatment reduced the methylation of COL10A1 promoters and increased the expression of COL10A1 gene and protein, we also found that while chondro-induced hiPSCs had greater methylation than chondro-induced hBMMSCs, chondro-induction generally decreased methylation of COL10A1 promoters in both cell types. This finding can explain the increased COL10A1 expression in hBMMSCs with chondro-induction. However, persistently low level of COL10A1 gene and protein in chondro-induced hiPSCs suggests that some specific CpG sites, such as one located at 138 bp which was confirmed by EMSA in this study, are more important for COL10A1 expression than other sites. These results from methylation studies lend support to the concept that iPSCs have an epigenetic status distinct from MSCs, and consequently show different responses to chondro-inductive signals. Maintaining stable cell lineage commitment in vivo poses a significant challenge in tissue engineering with stem cells. In vitro induction of differentiation does not guarantee stable lineage commitment and phenotypes in vivo [49,50]. While hMSCs are being applied allogeneically in clinical settings today owing to their immunosuppressive properties, allogeneic iPSCs are not expected to share similar immunological properties. On the other hand, the immune privilege of cartilage can provide a special expansion in the application of allogeneic iPSCs for chondral repair. While patientspecific iPSCs are free from immune responses, successful results with allogeneic iPSCs will greatly lower the cost of cell therapy, considering low current efficiency of creating patient-specific iPSCs. With immunosuppression for rats in this study, there was a lack of inflammation or lymphocytic infiltration in the hiPSC-treated osteochondral defects. Still, inadequate matrix formation despite the persistence of implanted hiPSCs in situ implies that some unexpected factors play a role during in vivo chondrogenesis with hiPSCs. 3D scaffold serves as a delivery vehicle for in vivo application of chondro-induced iPSCs and supports cell attachment, growth and differentiation. We preferred alginate for in vivo implantation because it is a hydrogel amenable to minimally invasive injection via an arthroscopic procedure. In a future study, hyaluronates or other synthetic hydrogels may be also tried as a carrier of iPSCs for in vivo cartilage regeneration. 5. Conclusion This study elucidated the chondrogenic features of hiPSCs which are different from hBMMSCs and can be more desirable for successful cartilage repair as well as the underlying epigenetic causes of the difference. Despite the successful induction of chondrogenesis with improved biochemical characteristics, more investigations are warranted to establish a clinically applicable cartilage repair strategies using hiPSCs. Acknowledgment This work was supported by the Bio & Medical Technology Development Program of the National Research Foundation (NRF) funded by the Korean government (MEST) (2012M3A9B4028566). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.biomaterials.2014.01.009.

References [1] Buckwalter JA, Mankin HJ. Articular cartilage: degeneration and osteoarthritis, repair, regeneration, and transplantation. Instr Course Lect 1988;47:487e504. [2] Caplan AI, Goldberg VM. Principles of tissue engineered regeneration of skeletal tissues. Clin Orthop Relat Res 1999;367:S12e6. [3] Brittberg M, Lindahl A, Nilsson A, Ohlsson C, Isaksson O, Peterson L. Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation. N Engl J Med 1994;331(14):889e95. [4] Benya PD, Padilla SR, Nimni ME. Independent regulation of collagen types by chondrocytes during the loss of differentiated function in culture. Cell 1978;15(4):1313e21. [5] DeLise AM, Fischer L, Tuan RS. Cellular interactions and signaling in cartilage development. Osteoarthr Cartil 2000;8(5):309e34. [6] Tuan RS. Biology of developmental and regenerative skeletogenesis. Clin Orthop Relat Res 2004;427:S105e17. [7] Ingber DE, Mow VC, Butler D, Niklason L, Huard J, Mao J, et al. Tissue engineering and developmental biology: going biomimetic. Tissue Eng 2006;12(12):3265e83. [8] Goepfert C, Slobodianski A, Schilling AF, Adamietz P, Pörtner R. Cartilage engineering from mesenchymal stem cells. Adv Biochem Eng Biotechnol 2010;123:163e200. [9] Ichinose S, Tagami M, Muneta T, Sekiya I. Morphological examination during in vitro cartilage formation by human mesenchymal stem cells. Cell Tissue Res 2005;322(2):217e26. [10] Im GI, Kim DY, Shin JH, Hyun CW, Cho WH. Repair of cartilage defect in the rabbit with cultured mesenchymal stem cells from bone marrow. J Bone Joint Surg Br 2001;83(2):289e94. [11] Kadiyala S, Young RG, Thiede MA, Bruder SP. Culture expanded canine mesenchymal stem cells possess osteochondrogenic potential in vivo and in vitro. Cell Transplant 1997;6(2):125e34. [12] Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284(5411):143e7. [13] Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282(5391):1145e7. [14] Lerou PH, Daley GQ. Therapeutic potential of embryonic stem cells. Blood Rev 2005;19(6):321e31. [15] Gaspar-Maia A, Alajem A, Meshorer E, Ramalho-Santos M. Open chromatin in pluripotency and reprogramming. Nat Rev Mol Cell Biol 2011;12(1):36e47. [16] Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006;126(4): 663e76. [17] Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131(5):861e72. [18] Wernig M, Meissner A, Foreman R, Brambrink T, Ku M, Hochedlinger K, et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 2007;448(7151):318e24. [19] Yamanaka S. Strategies and new developments in the generation of patientspecific pluripotent stem cells. Cell Stem Cell 2007;1(1):39e49. [20] Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, et al. Induced pluripotent stem cell lines derived from human somatic cells. Science 2007;318(5858):1917e20. [21] Itoh M, Kiuru M, Cairo MS, Christiano AM. Generation of keratinocytes from normal and recessive dystrophic epidermolysis bullosa-induced pluripotent stem cells. Proc Natl Acad Sci U S A 2011;108(21):8797e802. [22] Lian Q, Zhang Y, Zhang J, Zhang HK, Wu X, Zhang Y, et al. Functional mesenchymal stem cells derived from human induced pluripotent stem cells attenuate limb ischemia in mice. Circulation 2010;121(9):1113e23. [23] Li F, Bronson S, Niyibizi C. Derivation of murine induced pluripotent stem cells (iPS) and assessment of their differentiation toward osteogenic lineage. J Cell Biochem 2010;109(4):643e52. [24] Mizuno Y, Chang H, Umeda K, Niwa A, Iwasa T, Awaya T, et al. Generation of skeletal muscle stem/progenitor cells from murine induced pluripotent stem cells. FASEB J 2010;24(7):2245e53. [25] Tashiro K, Inamura M, Kawabata K, Sakurai F, Yamanishi K, Hayakawa T, et al. Efficient adipocyte and osteoblast differentiation from mouse induced pluripotent stem cells by adenoviral transduction. Stem Cells 2009;27(8): 1802e11. [26] Taura D, Sone M, Homma K, Oyamada N, Takahashi K, Tamura N, et al. Induction and isolation of vascular cells from human induced pluripotent stem cellsebrief report. Arterioscler Thromb Vasc Biol 2009;29(7):1100e3. [27] Diekman BO, Christoforou N, Willard VP, Sun H, Sanchez-Adams J, Leong KW, et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci U S A 2012;109(47): 19172e7. [28] Bilousova G, Jun du H, King KB, De Langhe S, Chick WS, Torchia EC, et al. Osteoblasts derived from induced pluripotent stem cells form calcified structures in scaffolds both in vitro and in vivo. Stem Cells 2011;29(2):206e16. [29] Kim D, Kim CH, Moon JI, Chung YG, Chang MY, Han BS, et al. Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell 2009;4(6):472e6.

J.-Y. Ko et al. / Biomaterials 35 (2014) 3571e3581 [30] Xu C, Inokuma MS, Denham J, Golds K, Kundu P, Gold JD, et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol 2001;19(10):971e4. [31] Akopian V, Andrews PW, Beil S, Benvenisty N, Brehm J, Christie M, et al. Comparison of defined culture systems for feeder cell free propagation of human embryonic stem cells. Vitro Cell Dev Biol Anim 2010;46(3e4):247e58. [32] Li W, Zhou H, Abujarour R, Zhu S, Young Joo J, Lin T, et al. Generation of human-induced pluripotent stem cells in the absence of exogenous Sox2. Stem Cells 2009;27(12):2992e3000. [33] Lee JM, Im GI. SOX trio-co-transduced adipose stem cells in fibrin gel to enhance cartilage repair and delay the progression of osteoarthritis in the rat. Biomaterials 2012;33(7):2016e24. [34] Kim HJ, Im GI. The effects of ERK1/2 inhibitor on the chondrogenesis of bone marrow- and adipose tissue-derived multipotent mesenchymal stromal cells. Tissue Eng Part A 2010;16(3):851e60. [35] Zimmermann P, Boeuf S, Dickhut A, Boehmer S, Olek S, Richter W. Correlation of COL10A1 induction during chondrogenesis of mesenchymal stem cells with demethylation of two CpG sites in the COL10A1 promoter. Arthritis Rheum 2008;58(9):2743e53. [36] van den Borne MP, Raijmakers NJ, Vanlauwe J, Victor J, de Jong SN, Bellemans J, et al. International Cartilage Repair Society (ICRS) and Oswestry macroscopic cartilage evaluation scores validated for use in Autologous Chondrocyte Implantation (ACI) and microfracture. Osteoarthr Cartil 2007;15(12):1397e402. [37] Wakitani S, Goto T, Pineda SJ, Young RG, Mansour JM, Caplan AI, et al. Mesenchymal cell-based repair of large, full-thickness defects of articular cartilage. J Bone Joint Surg Am 1994;76(4):574e92. [38] Toh WS, Lee EH, Guo XM, Chan JK, Yeow CH, Choo AB, et al. Cartilage repair using hyaluronan hydrogel-encapsulated human embryonic stem cell-derived chondrogenic cells. Biomaterials 2010;31(27):6968e80. [39] Beier FS, Vornehm E, Poschl K, von der Mark K, Lammi MJ. Localization of silencer and enhancer elements in the human type X collagen gene. J Cell Biochem 1997;66(2):210e8. [40] Fehrer C, Lepperdinger G. Mesenchymal stem cell aging. Exp Gerontol 2005;40(12):926e30.

3581

[41] Stolzing A, Scutt A. Age-related impairment of mesenchymal progenitor cell function. Aging Cell 2006;5(3):213e24. [42] Solchaga LA, Penick K, Goldberg VM, Caplan AI, Welter JF. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A 2010;16(3):1009e19. [43] Kim MJ, Son MJ, Son MY, Seol B, Kim J, Park J, et al. Generation of human induced pluripotent stem cells from osteoarthritis patient-derived synovial cells. Arthritis Rheum 2011;63(10):3010e21. [44] Wei Y, Zeng W, Wan R, Wang J, Zhou Q, Qiu S, et al. Chondrogenic differentiation of induced pluripotent stem cells from osteoarthritic chondrocytes in alginate matrix. Eur Cell Mater 2012;12(23):1e12. [45] Medvedev SP, Grigor’eva EV, Shevchenko AI, Malakhova AA, Dementyeva EV, Shilov AA, et al. Human induced pluripotent stem cells derived from fetal neural stem cells successfully undergo directed differentiation into cartilage. Stem Cells Dev 2011;20(6):1099e112. [46] Teramura T, Onodera Y, Mihara T, Hosoi Y, Hamanishi C, Fukuda K. Induction of mesenchymal progenitor cells with chondrogenic property from mouseinduced pluripotent stem cells. Cell Reprogr 2010;12(3):249e61. [47] Hellingman CA, Davidson EN, Koevoet W, Vitters EL, van den Berg WB, van Osch GJ, et al. Smad signaling determines chondrogenic differentiation of bone-marrow-derived mesenchymal stem cells: inhibition of Smad1/5/8P prevents terminal differentiation and calcification. Tissue Eng Part A 2011;17(7e8):1157e67. [48] Dickhut A, Pelttari K, Janicki P, Wagner W, Eckstein V, Egermann M, et al. Calcification or dedifferentiation: requirement to lock mesenchymal stem cells in a desired differentiation stage. J Cell Physiol 2009;219(1):219e26. [49] Pelttari K, Winter A, Steck E, Goetzke K, Hennig T, Ochs BG, et al. Premature induction of hypertrophy during in vitro chondrogenesis of human mesenchymal stem cells correlates with calcification and vascular invasion after ectopic transplantation in SCID mice. Arthritis Rheum 2006;54(10): 3254e66. [50] Lee HJ, Lee JS, Chansakul T, Yu C, Elisseeff JH, Yu SM. Collagen mimetic peptide-conjugated photopolymerizable PEG hydrogel. Biomaterials 2006;27(30):5268e76.