Arch Virol DOI 10.1007/s00705-014-2098-z
ORIGINAL ARTICLE
In vivo delivery of interleukin-35 relieves coxsackievirus-B3induced viral myocarditis by inhibiting Th17 cells Yadong Hu • Chunsheng Dong • Yan Yue Sidong Xiong
•
Received: 14 November 2013 / Accepted: 21 April 2014 Ó Springer-Verlag Wien 2014
Abstract Interleukin (IL)-35 is a new member of the IL12 cytokine family. The suppressive role of IL-35 in the immune response to parasitic and bacterial infections and in autoimmunity has been demonstrated in terms of its antiinflammatory properties. However, the functional role of IL-35 in viral myocarditis has not been investigated. In this study, IL-35 expression was measured in heart tissues with coxsackievirus B3 (CVB3)-induced myocarditis. It was significantly reduced in the late stage of viral infection and correlated negatively with disease severity. To examine the therapeutic role of IL-35 in viral myocarditis, an IL-35expressing plasmid (pIL-35-FC) was packaged with polyethyleneimine and delivered intraperitoneally to BALB/c male mice before and after CVB3 infection. The severity of myocarditis was assessed 7 days after infection. The in vivo delivery of IL-35 significantly ameliorated the severity of viral myocarditis, reflected in an increased survival rate and increased bodyweights, and reduced serum creatine kinase (CK) and CK-MB activities, cardiac pathological scores, and viral replication. We also show that the overexpression of IL-35 reduced splenic Th17 cells and Th17-related proinflammatory cytokines in heart tissues. In conclusion, our data indicate that IL-35 effectively protects the myocardium from the pathogenesis of CVB3induced viral myocarditis, which may be attributable to reduced Th17 production. This suggests that supplementation with IL-35 could be a novel therapeutic treatment for viral myocarditis.
Y. Hu C. Dong Y. Yue S. Xiong (&) Jiangsu Key Laboratory of Infection and Immunity, Institutes of Biology and Medical Science, Soochow University, Suzhou 215123, China e-mail: [email protected]
Introduction Viral myocarditis is a frequent cause of sudden death in young adults and can progress to acute myocarditis, chronic dilated cardiomyopathy, and even heart failure associated with an autoimmune response [9]. It is clinically defined as cardiac disease associated with inflammation of the myocardium and necrosis in the absence of an ischemic event. Infectious agents, especially coxsackieviruses, are thought to be the most important etiological agents of myocarditis [24, 36]. Coxsackieviruses are non-enveloped, single-stranded RNA viruses with a genome of approximately 7,500 nt, belonging to the family Picornaviridae. During infection, viral RNA enters the cytoplasm and acts as a template for both genomic replication and protein synthesis. The four capsid proteins (VP1, VP2, VP3 and VP4) and seven nonstructural proteins (2A, 2B, 2C, 3A, 3B, 3C and 3D) are generated by viral-protease-mediated processing of the single polyprotein translated from the genomic RNA [28]. No effective preventative or therapeutic strategy for viral myocarditis is yet available in the clinical context, predominantly because the pathogenesis of viral myocarditis is not well understood. However, increasing evidence supports the idea that tissue injury from an excessively activated immune response, rather than that from direct viral infection [1, 14, 17], plays a critical pathogenetic role in the course of viral myocarditis [11, 12, 18]. Interleukin (IL)-35 is a newly discovered immunosuppressive cytokine belonging to the IL-12 family that is exclusively produced by Treg cells and consists of p35 and EBI3 subunits [2, 6]. IL-35 stimulates the expansion of CD4?CD25? T cells, suppresses the proliferation of CD4?CD25- T cells, and inhibits the differentiation of Th17 cells to attenuate disease in models of collagen-
123
Y. Hu et al.
induced arthritis and inflammatory bowel disease [5, 25]. Liu and colleagues showed that IL-35 can be detected in the peripheral blood of patients with chronic hepatitis B, whereas it is undetectable in healthy individuals [20]. Wirtz and others recently confirmed that IL-35, rather than IL-27, significantly suppresses Th1- and Th17-cell proliferation and reduces the development of experimental colitis [38]. IL-35 is also reported to have an inhibitory effect on demyelination by preventing the development of autoaggressive T cells [42]. All these data indicate the potential utility of IL-35 in therapies for some inflammatory and autoimmune diseases based on its immunosuppressive function. However, the presence of IL-35 in coxsackievirus B3 (CVB3)-induced myocarditis and its anti-inflammatory function in viral myocarditis have not been evaluated. In this study, we examined the potential effects of IL-35 on CVB3-induced myocarditis. The kinetics of IL-35 expression in the heart tissues of mice with viral myocarditis was determined. A polyethyleneimine (PEI)-packaged IL-35-expressing plasmid was delivered intraperitoneally to male BALB/c mice and the therapeutic effects of this strategy on viral myocarditis were assessed.
Materials and methods Animals Six-week-old male BALB/c (H-2d) mice were purchased from the Experimental Animal Centre of the Chinese Academy of Sciences (Shanghai, P.R. China) and bred in a specific-pathogen-free facility. All animal experiments were carried out in strict accordance with the recommendations of the Guide for the Care and Use of Medical Laboratory Animals (Ministry of Health, P.R. China, 1998). The study protocol was approved by the Ethical Committee of Soochow University. Virus CVB3 (Nancy strain) was maintained by passage in HeLa cells (ATCC CCL-2). The viral titer was determined using a 50 % tissue culture infectious dose (TCID50) assay on HeLa cell monolayers and calculated by the Reed-Muench method. Mice were infected with an intraperitoneal injection of 0.1 mL of phosphate-buffered saline (PBS) containing 103 TCID50 of the virus. In vivo delivery of IL-35 Mice were injected intraperitoneally with 103 TCID50 of CVB3 on day 0, and then intraperitoneally received 50 lg
123
of pIL-35-FC plasmid DNA packaged with 0.258 ng of PEI (Polyscience) in 0.2 mL of PBS 1 day before CVB3 infection and on day 1 and day 3 after CVB3 infection. The control group of mice received pFC plasmid DNA, administered in the same way. Each group contained eight mice. Cardiac IL-35 enzyme-linked immunosorbent assay (ELISA) Freshly isolated heart tissue was ground to a fine powder under liquid nitrogen. Each sample (100 mg of powdered tissue) was homogenized in 0.5 mL of RIPA buffer and then centrifuged in a cooled microcentrifuge for 8 min. The supernatants were then subjected to ELISA with a mouse IL-35 ELISA kit (Cusabio Biotec, China) according to the manufacturer’s instructions. Histopathological analysis and myocarditis scoring Hearts were collected from the infected mice on day 7, fixed in 10 % buffered formalin solution, and embedded in paraffin. Sections (5 lm thick) were cut and stained with hematoxylin and eosin (H&E). The extent of the myocardial lesions was quantified and scored for severity as follows: 0 = no inflammation; 1 = one to five distinct mononuclear inflammatory foci, with the involvement of 5 % or less of the cross-sectional area; 2 = more than five distinct mononuclear inflammatory foci, or the involvement of over 5 % but not over 20 % of the cross-sectional area; 3 = diffuse mononuclear inflammation involving over 20 % of the area, without necrosis; and 4 = diffuse inflammation with necrosis. The analysis was performed in a double-blinded manner by a trained pathologist. Real-time PCR Total RNA was isolated from each preparation using TRIzolÒ Reagent (Invitrogen, USA) according to the manufacturer’s instructions and converted into cDNA using M-MuLV reverse transcriptase (Fermentas International Inc., Canada). The cDNA was amplified with SYBR Green Master Mix (TaKaRa, China) using an ABI 7500 thermocycler (Applied Biosystems). The 2-DDCT method was used to normalize the transcription of IL-35 mRNA to that of GAPDH mRNA and to calculate the fold induction relative to the control [30]. The primer pairs that were used are shown in Table 1. To determine the myocardial viral RNA loads, hearts were collected and homogenized 7 days after infection with 103 TCID50 of CVB3. The total RNA was reverse transcribed to cDNA using a CVB3-specific positive-strand RNA primer (50 -CACCGGATGGCCAATCCA-30 ) or a
Role of interleukin-35 in CVB3-induced myocarditis Table 1 Real-time PCR primers Gene
Primer sequence (50 -30 )
IL-17A
Sense: CCGCAATGAAGACCCTGATAGAT
IL-6
Sense: ACAACCACGGCCTTCCCTACTT
IL-21
Sense: GGCCAAACTCAAGCCATCAA
ROR ct
Sense: CCGCTGAGAGGGCTTCAC
Antisense: AGAATTCATGTGGTCCAGC Antisense: CACGATTTCCCAGAGAACATGTG
were added to triplicate wells and incubated at 37 °C for 2 h. After the samples were washed, the biotinylated detection antibody was added for 1 h, followed by 100 mL of streptavidin-conjugated horseradish peroxidase, and the samples were incubated for 1 h at 37 °C. TMB substrate (eBioscience) was added to each well. After 10 min, 50 mL of stop solution (2 N H2SO4) was added and the absorbance was measured at 450 nm.
Antisense: GCCACGAGGTCAATGATGAA
Statistical analysis
Antisense: TGCAGGAGTAGGCCACATTACA
negative-strand RNA primer (50 -GCGAAGAGTCTATTG AGCTA-30 ) and then subjected to SYBR Green real-time PCR using CVB3 primers (50 -ATCAAGTTGCGTGCT GTG-30 and 50 -TGCGAAATGAAAGGAGTGT-30 ). The expression of the viral RNA load was normalized to mouse GAPDH expression using the 2-DDCT method. Flow-cytometric analysis Splenocytes were isolated and suspended in RPMI 1640 containing 10 % fetal bovine serum, and red blood cells were lysed by incubation for 3 min in ACK lysis buffer (Tiangen, China). The cells were collected and resuspended at a density of 1.0 9 106 cell/mL. The cells were then stimulated for 4 h with 50 ng phorbol 12-myristate 13 acetate and 1 lg ionomycin per mL (Sigma-Aldrich, St. Louis, MO, USA), and cytokine secretion was blocked with 10 lg/mL brefeldin A (Sigma-Aldrich) at 37 °C under 5 % CO2 in a 24-well culture plate (Corning Costar, Corning, NY, USA) in RPMI 1640 medium supplemented with 100 U penicillin and 100 lg streptomycin per mL and 10 % fetal bovine serum. Surface markers were stained with PE-labeled anti-mouse CD4 antibody (Biolegend). After the cells were washed, fixed, and permeabilized according to the manufacturer’s instructions (Biolegend), they were stained intracellularly with an APC-conjugated anti-mouse IL-17A antibody (eBiosciences). After incubation at 4 °C for 30 min, the samples were washed in staining buffer and measured by flow cytometry on a FACSCalibur cell sorter. The data were analyzed using CellQuest software (BD Biosciences). Cytokine ELISAs The amounts of IL-17A, IL-6, tumor necrosis factor a (TNF-a), and IL-10 in the homogenized heart tissues were measured using ELISAs (R&D Systems) according to the manufacturer’s instructions. In brief, plates were coated with the diluted capture antibody (100 mL/well) and incubated overnight at 4 °C. The samples and standards
Data are presented as means ± SEM. Differences between experimental groups were analyzed for statistical significance using an unpaired Student’s t-test in GraphPad Prism version 4.01 (GraphPad Software Inc.). A value of P \ 0.05 was considered significant.
Results Expression of IL-35 during viral myocarditis and its negative correlation with disease severity To generate an acute viral myocarditis model, male BALB/c mice were injected intraperitoneally with 103 TCID50 of CVB3, as described previously [13]. As expected, the bodyweights of the CVB3-infected mice decreased continuously from day 3 post-infection compared with those of normal mice (Fig. 1A). Consistent with this, a histological analysis of the cardiac tissues on days 0, 3, 5, and 7 showed slight myocardial injury on day 3, which increased markedly in subsequent days (Fig. 1B and C). We then examined the kinetic expression of IL-35 after CVB3 infection. As shown in Fig. 1D, IL-35 peaked in the cardiac tissues on day 3 but then rapidly declined during the late infectious stage of CVB3 on day 7, the severe course of viral myocarditis. To further investigate the involvement of IL-35 in the pathological processes of viral myocarditis, the correlation between cardiac IL-35 expression and disease severity, including bodyweight loss and the myocardial pathological score, were analyzed on day 7 after CVB3 infection, when the pathological peak of acute viral myocarditis occurs. The IL-35 level correlated negatively with bodyweight loss (r = -0.6579, p = 0.0056) and the heart pathological score (r = -0.6026, p = 0.0135), implying that IL-35 exerts a protective effect against CVB3-induced myocarditis (Fig. 1E and F). Overexpression of IL-35 significantly alleviates CVB3induced myocarditis Next, we examined whether IL-35 has a therapeutic effect on CVB3-induced myocarditis. To investigate this, we
123
Y. Hu et al.
Fig. 1 Expression kinetics of IL-35 and its correlations with the severity of acute myocarditis. Male BALB/c mice were infected with 103TCID50 of CVB3 at day 0. (A) Body weight changes were monitored daily until day 9 post-infection. (B) H&E staining of heart tissue sections prepared on days 0, 3, 5 and 7 post-infection. Cardiac inflammation is indicated by the arrows (magnification: 9200). (C) The severity of myocarditis was scored using a standard 0–4 scale based on foci of mononuclear infiltration and myocardial necrosis. (D) Hearts were collected and homogenized on days 0, 1, 3, 5, 7, 9
post-infection. The expression of IL-35 in cardiac tissue was analyzed by ELISA assay. Correlations were found between IL-35 expression levels in cardiac tissues and measures of the severity of acute myocarditis ([E] body weight loss or [F] myocarditis pathological score) on day 7 following 103 TCID50 CVB3 inoculation. Results are presented as the means ± SEM of three separate experiments. *, P \ 0.05; **, P \ 0.01. Each group contained eight mice. For the correlation analysis, sixteen surviving mice from five experiments were tested
overexpressed IL-35 by introducing pIL-35-FC, a plasmid encoding IL-35 with the secretory signal from Igj, into mice with CVB3-induced myocarditis [25]. The PEIpackaged plasmid was delivered intraperitoneally to the mice. Cardiac IL-35 was measured at the indicated time points. The level of IL-35 reached 1400 pg/100 mg tissue 3 days after injection and 2024 pg/100 mg tissue 7 days after injection in the pIL-35-FC-treated mice. This was dramatically higher than its levels in the pFC-treated control mice, suggesting that the PEI-delivered pIL-35-FC plasmid greatly enhanced the cardiac expression of IL-35 and maintained it at a high level for several days (Fig. 2A). The male mice were then injected intraperitoneally three times with pIL-35-FC or p-FC: 1 day before and 1 and 3 days after infection with 103 TCID50 of CVB3. The severity of myocarditis was carefully studied. As shown in Figure 2B and C, the mice in the group treated with p-FC or in the untreated group underwent marked and continuous bodyweight loss of up to 29 %, and more than 70 % of the mice died within 10 days of infection. In contrast, the bodyweights of mice that received pIL-35-FC showed negligible fluctuation and the mice displayed a significantly
improved survival rate (75 %). Consistent with these findings, the serum CK and CK-MB activities, indices of myocardial injury, were significantly reduced in the mice treated with pIL-35-FC (Fig. 2D and E). Importantly, improved histopathology of the heart tissues, with less inflammation and limited necrotic lesions (Fig. 2F), was also observed in the pIL-35-FC-treated mice, indicating the amelioration of their myocarditis. Furthermore, the relative genome copy level in the pIL-35-FC-treated myocarditisaffected mice was reduced when compared to control groups (Fig. 2G). All these data indicate that the in vivo delivery of IL-35 efficiently protected mice from myocarditis caused by CVB3 infection.
123
Overexpression of IL-35 reduced the number of Th17 cells in CVB3-induced myocarditis Recently, we and others have found that Th17 cells play an important role in the pathogenesis of CVB3-induced myocarditis [8, 19, 41]. Moreover, the suppression of Th17 cells has been reported to be one of the functions of IL-35 [25]. Therefore, using real-time PCR, we explored the
Role of interleukin-35 in CVB3-induced myocarditis
Fig. 2 pIL-35-FC administration ameliorates CVB3-induced myocarditis. (A) Expression of IL-35 in heart tissues of CVB3-infected mice after pIL-35-FC plasmid injection. Mice were injected intraperitoneally with 50 lg of pIL-35-FC or p-FC packaged with PEI 1 day before CVB3 infection and on day 1 and day 3 after CVB3 infection. The expression level of IL-35 in heart tissues on days 0, 1, 3, 5, 7 after CVB3 infection was detected by ELISA. (B) The survival rate and (C) Body weight change were monitored daily until day 9 and day 8 post-infection, respectively. Serological indices of myocarditis, (D) the activity of CK and (E) level of CK-MB, were also determined on day 8 post-infection. (F) Paraffin sections of heart
tissues were prepared, and the arrows indicate the cardiac inflammation stained with H&E. The severity of myocarditis was scored using a standard 0–4 scale based on foci of mononuclear infiltration and myocardial necrosis (right). (G) Myocardial virus replication was also detected using real-time PCR assays. Normal, normal mice; w/o treatment, CVB3-infected mice without plasmid injection; IL-35, CVB3-infected mice with pIL-35-FC injection; FC, CVB3-infected mice with p-FC injection. Results are presented as the means ± SEM of three separate experiments.*, P \ 0.05; **, P \ 0.01; ***, P \ 0.001. Each group contained eight mice
potential therapeutic mechanism of IL-35 treatment by assessing the splenic Th17 frequencies, the characteristic cytokines, and the expression of transcription factors on day 7 after infection. As shown in Figure 3A and B, the frequency of CD4?IL-17? T cells was reduced threefold by pIL-35-FC treatment compared with the frequency observed after p-FC treatment. Similar results were observed for the Th17-associated cytokines (IL-17A and IL-6) and the master transcription factor RORct, confirming that pIL-35-FC treatment significantly reduces the frequency of splenic Th17 cells in viral myocarditis (Fig. 3C).
Reduced proinflammatory cytokine expression in heart tissue after pIL-35-FC treatment One of the biological characteristics of viral myocarditis is the inflammation produced by excessive proinflammatory cytokines during the acute stage of the disease [7]. Proinflammatory cytokines, such as IL-17, IL-6, and TNF-a, are involved in Th17-mediated inflammation [37]. Therefore, using ELISAs, we assessed the expression of IL-17A, IL-6, and TNF-a in cardiac tissues after pIL-35-FC treatment. Interestingly, significantly lower levels of IL-17A, IL-6, and TNF-a expression were seen in the heart tissues of
123
Y. Hu et al.
Fig. 3 Reduced Th17 cell expression in mouse spleen after in vivo delivery of pIL-35-FC. Mice were infected with 103 TCID50 doses of CVB3 and were received intraperitoneally with 50 lg of pIL-35-FC or p-FC packaged with PEI 1 day before CVB3 infection and on day 1 and day 3 after CVB3 infection. Mice were sacrificed on day 7 postinfection. (A) Splenocytes prepared from mice. These cells were stimulated for 4 h in vitro and then stained with anti-CD4-PE and
anti-IL-17-APC. The percentage of Th17 cells was then determined by FACS plot. (B) Statistical analysis of the splenic Th17 cell frequency. (C) Expression of IL-17A, IL-6, IL-21 and RORct in the spleen was detected by quantitative PCR. Results are presented as the mean ± SEM of three separate experiments.*, P \ 0.05; ***, P \ 0.001; ns, no significance. Each group contained eight mice
mice treated with pIL-35-FC (Fig. 4A–C). We and others have also reported that the immunoregulatory cytokine IL10 exerts a protective effect on viral myocarditis [16, 26]. However, there was no difference in the expression of IL10 between the groups tested here (Fig. 4D). These results suggest that a reduction in cardiac proinflammatory cytokines contributes to the alleviation of CVB3-induced myocardial injury.
cardiac inflammatory infiltration (Fig. 1), suggesting that the inhibition of the inflammatory response might be an effective treatment for viral myocarditis. IL-35 is a newly identified heterodimeric IL-12 family cytokine containing the Epstein-Barr-virus-induced gene 3 (EBI3) and IL-27p35 subunits [6, 31, 33]. It has been reported that the source of IL-35 differs from that of the other IL-12 family cytokines, IL-12, IL-23, and IL-27. These three cytokines are all primarily secreted by antigenpresenting cells, including macrophages, monocytes, and dendritic cells, which are activated by a combination of pathogen-specific patterns [15, 21, 27]. However, IL-35 is only produced by forkhead box protein 3 (Foxp3)? regulatory T cells [4]. Its biological functions include directly suppressing Teff-cell proliferation, suppressing Th17 development, and mediating the proliferation of CD4?CD25? T cells [25]. It is a novel cytokine with therapeutic potential for inflammation, autoimmunity, and other immunological disorders [3, 35]. In this study, we first detected the kinetic expression of cardiac IL-35 in CVB3infected mice and found that high levels of IL-35 were induced on day 3 after CVB3 infection. Interestingly, these declined from day 3 and were maintained at a low level until day 9, appearing in a time-dependent manner. It is noteworthy that the severity of viral myocarditis correlated
Discussion Viral myocarditis is a life-threatening disease characterized by heart tissue inflammation induced by enteroviral or adenoviral infections. It is the composite result of both viral infection and uncontrolled host immune reactions [34]. During the early viremic period, CVB3 infects the heart tissues by receptor-mediated endocytosis [32] and may cause myocardiocyte dysfunction by disrupting dystrophin-sarcoglycan complexes or cleaving eukaryotic initiation factor 4 [22]. At a later stage of infection, proinflammatory cytokines and chemokines are robustly expressed, resulting in massive inflammation and aggravated injury in the heart [23]. In our study, we noted that greater bodyweight loss correlated with higher levels of
123
Role of interleukin-35 in CVB3-induced myocarditis
Fig. 4 Decreased proinflammatory cytokines expression in VMC mice after overexpression of IL-35. Mice were infected with 103 TCID50 doses of CVB3 and were injected intraperitoneally with 50 lg of pIL-35-FC or p-FC packaged with PEI at 1 before CVB3 infection and on day 1 and day 3 after CVB3 infection. Mice were
sacrificed on day 7, and heart tissue was homogenized. The expression level of (A) TNF-a, (B) IL-6, (C) IL-17A and (D) IL-10 in heart tissue was determined by ELISA. Each group contained eight mice. The p-value represents the significance of comparison between the IL-35 and FC groups
negatively with cardiac levels of IL-35 (Fig. 1), providing further support for the treatment of viral myocarditis with IL-35. Therefore, we overexpressed IL-35 in vivo with the intraperitoneal delivery of PEI-packaged pIL-35-FC plasmid. The injected PEI/plasmid complex can target to multiple cells and be expressed in some of the major organs, including the heart, according our previous work. The in vivo delivery of IL-35 significantly alleviated the severity of CVB3-induced viral myocarditis in mice, with reduced inflammatory infiltration, reduced cardiac injury, and an improved survival rate (Fig. 2). Our results indicate that IL-35 could be a therapeutic cytokine for the treatment of viral myocarditis as well as other inflammatory diseases [38, 42]. It is well established that the bias of the T-cell immune response markedly affects the severity of myocarditis [7, 10]. CVB3-induced myocarditis represents a predominantly pathological cell-mediated cardiac inflammatory disease, rather than a direct virus-mediated cardiac inflammatory disease. Although strong host Th1 immune responses may play a critical pathogenetic role in the course of viral myocarditis, especially in the subacute stage (days 4–14), increasing evidence indicates that besides CD4? Th1 cells, Th17 cells are also involved in the pathogenesis of viral myocarditis [8, 39– 41]. As important effector cells in several inflammatory states, Th17 cells are positioned at a major nexus between the innate and adaptive immune responses and play a critical role in the host defenses and
immunopathology. We have previously reported that the induction of distinct Th17 populations contributes to sexbased differences in the susceptibility to CVB3-induced myocarditis [19]. Consistent with a report by Niedbala et al. that IL-35 inhibits the differentiation of Th17 cells in vitro [25], we observed a reduction in Th17 cells in the spleens of infected mice after IL-35 treatment in vivo. Interestingly, we also found that viral replication was significantly inhibited in CVB3-infected mice treated with pIL-35-FC. It has been reported that the neutralization of IL-17 increases the number of Th1 CD4? and CD8? T cells, which ameliorates the pathological cardiac changes and reduces viral replication [40]. We observed increased Th1 CD4? and CD8? IFN-c? T cells in the spleen after IL-35 treatment (data not shown), and this might reflect a balance between antiviral immunity and autoimmunity during viral myocarditis. Several reports have shown that the inflammatory cytokines are the dominant inflammatory mediators of myocardial injury in the inflammatory phase of viral myocarditis [29]. In this study, we observed that the expression of the Th17-related cytokines IL-6 and TNF-a [37] declined, together with reductions in both IL-17A and CVB3 replication, suggesting that reduced production of Th17 cells might lead to the attenuation of their inflammatory cardiac cytokines. Thus, we speculate that the therapeutic effect of IL-35 on CVB3-induced viral myocarditis is partially attributable to the decline in Th17 cells, together with reduced viral replication.
123
Y. Hu et al.
In this study, we have shown for the first time that the delivery of IL-35 in vivo can relieve CVB3-induced myocardial inflammation and alleviate the severity of myocarditis. The inhibition of Th17 cell production by IL-35 may account for the suppression of the CVB3-induced inflammatory response and cardiac viral replication. Therefore, the immunosuppressive cytokine IL-35 may be a new therapeutic candidate for treatment of viral myocarditis and other inflammatory diseases. Acknowledgments The authors thank Prof. Foo Y. Liew at the University of Glasgow for providing mouse IL-35 expression plasmids. This work was supported by grants from the National Natural Science Foundation of China (81072413, 31270977, 31270973, 31170878), Major State Basic Research Development Program of China (2013CB530501, 2013CB531502), Jiangsu ‘‘PanDeng’’ Project (BK2010004), the Natural Science Foundation of the Jiangsu Higher Education Institutions (12KJB310015), Jiangsu ‘‘333’’ Project of Cultivation of High-Level Talents and Jiangsu Provincial Innovative Team, Qing Lan Project of the Jiangsu Higher Education Institutions, Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) and Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT-IRT1075). The authors have no conflicting financial interests.
References 1. Badorff C, Fichtlscherer B, Rhoads RE, Zeiher AM, Muelsch A, Dimmeler S, Knowlton KU (2000) Nitric oxide inhibits dystrophin proteolysis by coxsackieviral protease 2A through S-nitrosylation: a protective mechanism against enteroviral cardiomyopathy. Circulation 102:2276–2281 2. Bardel E, Larousserie F, Charlot-Rabiega P, Coulomb-L’Hermine A, Devergne O (2008) Human CD4? CD25? Foxp3? regulatory T cells do not constitutively express IL-35. J Immunol 181:6898–6905 3. Castellani ML, Anogeianaki A, Felaco P, Toniato E, De Lutiis MA, Shaik B, Fulcheri M, Vecchiet J, Tete S, Salini V, Theoharides TC, Caraffa A, Antinolfi P, Frydas I, Conti P, Cuccurullo C, Ciampoli C, Cerulli G, Kempuraj D (2010) IL-35, an antiinflammatory cytokine which expands CD4?CD25? Treg cells. J Biol Regul Homeost Agents 24:131–135 4. Collison LW, Workman CJ, Kuo TT, Boyd K, Wang Y, Vignali KM, Cross R, Sehy D, Blumberg RS, Vignali DA (2007) The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature 450:566–569 5. Collison LW, Chaturvedi V, Henderson AL, Giacomin PR, Guy C, Bankoti J, Finkelstein D, Forbes K, Workman CJ, Brown SA, Rehg JE, Jones ML, Ni HT, Artis D, Turk MJ, Vignali DA (2010) IL-35-mediated induction of a potent regulatory T cell population. Nat Immunol 11:1093–1101 6. Devergne O, Birkenbach M, Kieff E (1997) Epstein-Barr virusinduced gene 3 and the p35 subunit of interleukin 12 form a novel heterodimeric hematopoietin. Proc Natl Acad Sci USA 94:12041–12046 7. Esfandiarei M, McManus BM (2008) Molecular biology and pathogenesis of viral myocarditis. Annu Rev Pathol 3:127–155 8. Fan Y, Weifeng W, Yuluan Y, Qing K, Yu P, Yanlan H (2011) Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation. Virol J 8:17
123
9. Feldman AM, McNamara D (2000) Myocarditis. N Engl J Med 343:1388–1398 10. Frisancho-Kiss S, Coronado MJ, Frisancho JA, Lau VM, Rose NR, Klein SL, Fairweather D (2009) Gonadectomy of male BALB/c mice increases Tim-3(?) alternatively activated M2 macrophages, Tim-3(?) T cells, Th2 cells and Treg in the heart during acute coxsackievirus-induced myocarditis. Brain Behav Immun 23:649–657 11. Fuse K, Chan G, Liu Y, Gudgeon P, Husain M, Chen M, Yeh WC, Akira S, Liu PP (2005) Myeloid differentiation factor-88 plays a crucial role in the pathogenesis of Coxsackievirus B3induced myocarditis and influences type I interferon production. Circulation 112:2276–2285 12. Guthrie M, Lodge PA, Huber SA (1984) Cardiac injury in myocarditis induced by Coxsackievirus group B, type 3 in Balb/c mice is mediated by Lyt 2? cytolytic lymphocytes. Cell Immunol 88:558–567 13. He J, Yue Y, Dong C, Xiong S (2013) MiR-21 confers resistance against CVB3-induced myocarditis by inhibiting PDCD4-mediated apoptosis. Clin Invest Med 36:E103–E111 14. Henke A, Nestler M, Strunze S, Saluz HP, Hortschansky P, Menzel B, Martin U, Zell R, Stelzner A, Munder T (2001) The apoptotic capability of coxsackievirus B3 is influenced by the efficient interaction between the capsid protein VP2 and the proapoptotic host protein Siva. Virology 289:15–22 15. Hibbert L, Pflanz S, De Waal Malefyt R, Kastelein RA (2003) IL27 and IFN-alpha signal via Stat1 and Stat3 and induce T-Bet and IL-12Rbeta2 in naive T cells. J Interferon Cytokine Res 23:513–522 16. Jiang Z, Xu W, Li K, Yue Y, Xu L, Ye F, Xiong S (2008) Remission of CVB3-induced viral myocarditis by in vivo Th2 polarization via hydrodynamics-based interleukin-4 gene transfer. J Gene Med 10:918–929 17. Klingel K, Kandolf R (1993) The role of enterovirus replication in the development of acute and chronic heart muscle disease in different immunocompetent mouse strains. Scand J Infect Dis Suppl 88:79–85 18. Leipner C, Grun K, Borchers M, Stelzner A (2000) The outcome of coxsackievirus B3-(CVB3-) induced myocarditis is influenced by the cellular immune status. Herz 25:245–248 19. Li Z, Yue Y, Xiong S (2013) Distinct Th17 inductions contribute to the gender bias in CVB3-induced myocarditis. Cardiovasc Pathol 22:373–382 20. Liu F, Tong F, He Y, Liu H (2011) Detectable expression of IL35 in CD4? T cells from peripheral blood of chronic hepatitis B patients. Clin Immunol 139:1–5 21. Ma X, Chow JM, Gri G, Carra G, Gerosa F, Wolf SF, Dzialo R, Trinchieri G (1996) The interleukin 12 p40 gene promoter is primed by interferon gamma in monocytic cells. J Exp Med 183:147–157 22. Maekawa Y, Ouzounian M, Opavsky MA, Liu PP (2007) Connecting the missing link between dilated cardiomyopathy and viral myocarditis: virus, cytoskeleton, and innate immunity. Circulation 115:5–8 23. Maier R, Krebs P, Ludewig B (2004) Immunopathological basis of virus-induced myocarditis. Clin Dev Immunol 11:1–5 24. Muir P, Kammerer U, Korn K, Mulders MN, Poyry T, Weissbrich B, Kandolf R, Cleator GM, van Loon AM (1998) Molecular typing of enteroviruses: current status and future requirements. The European Union concerted action on virus meningitis and encephalitis. Clin Microbiol Rev 11:202–227 25. Niedbala W, Wei XQ, Cai B, Hueber AJ, Leung BP, McInnes IB, Liew FY (2007) IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol 37:3021–3029
Role of interleukin-35 in CVB3-induced myocarditis 26. Nishio R, Matsumori A, Shioi T, Ishida H, Sasayama S (1999) Treatment of experimental viral myocarditis with interleukin-10. Circulation 100:1102–1108 27. Pflanz S, Hibbert L, Mattson J, Rosales R, Vaisberg E, Bazan JF, Phillips JH, McClanahan TK, de Waal Malefyt R, Kastelein RA (2004) WSX-1 and glycoprotein 130 constitute a signal-transducing receptor for IL-27. J Immunol 172:2225–2231 28. Racaniello VR (2007) Picornaviridae: the virus and their replication. In: Knipe DM, Howley PM, Griffin DE, Lamb RA, Straus SE, Martin MA, Roizman B (eds) Fields virology, 5th edn. Lippincott, Philadelphia 29. Ritter JT, Tang-Feldman YJ, Lochhead GR, Estrada M, Lochhead S, Yu C, Ashton-Sager A, Tuteja D, Leutenegger C, Pomeroy C (2010) In vivo characterization of cytokine profiles and viral load during murine cytomegalovirus-induced acute myocarditis. Cardiovasc Pathol 19:83–93 30. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101–1108 31. Schoenhaut DS, Chua AO, Wolitzky AG, Quinn PM, Dwyer CM, McComas W, Familletti PC, Gately MK, Gubler U (1992) Cloning and expression of murine IL-12. J Immunol 148:3433–3440 32. Shi Y, Chen C, Lisewski U, Wrackmeyer U, Radke M, Westermann D, Sauter M, Tschope C, Poller W, Klingel K, Gotthardt M (2009) Cardiac deletion of the Coxsackievirus-adenovirus receptor abolishes Coxsackievirus B3 infection and prevents myocarditis in vivo. J Am Coll Cardiol 53:1219–1226 33. Stern AS, Podlaski FJ, Hulmes JD, Pan YC, Quinn PM, Wolitzky AG, Familletti PC, Stremlo DL, Truitt T, Chizzonite R et al (1990) Purification to homogeneity and partial characterization of cytotoxic lymphocyte maturation factor from human B-lymphoblastoid cells. Proc Natl Acad Sci USA 87:6808–6812 34. Tam PE (2006) Coxsackievirus myocarditis: interplay between virus and host in the pathogenesis of heart disease. Viral Immunol 19:133–146
35. Vojdani A, Lambert J (2011) The role of Th17 in neuroimmune disorders: target for CAM therapy. Part I. Evid Based Complement Altern Med 2011:927294 36. Why HJ, Meany BT, Richardson PJ, Olsen EG, Bowles NE, Cunningham L, Freeke CA, Archard LC (1994) Clinical and prognostic significance of detection of enteroviral RNA in the myocardium of patients with myocarditis or dilated cardiomyopathy. Circulation 89:2582–2589 37. Wilson NJ, Boniface K, Chan JR, McKenzie BS, Blumenschein WM, Mattson JD, Basham B, Smith K, Chen T, Morel F, Lecron JC, Kastelein RA, Cua DJ, McClanahan TK, Bowman EP, de Waal Malefyt R (2007) Development, cytokine profile and function of human interleukin 17-producing helper T cells. Nat Immunol 8:950–957 38. Wirtz S, Billmeier U, McHedlidze T, Blumberg RS, Neurath MF (2011) Interleukin-35 mediates mucosal immune responses that protect against T-cell-dependent colitis. Gastroenterology 141:1875–1886 39. Xie Y, Chen R, Zhang X, Chen P, Liu X, Xie Y, Yu Y, Yang Y, Zou Y, Ge J, Chen H (2011) The role of Th17 cells and regulatory T cells in Coxsackievirus B3-induced myocarditis. Virology 421:78–84 40. Yuan J, Yu M, Lin QW, Cao AL, Yu X, Dong JH, Wang JP, Zhang JH, Wang M, Guo HP, Cheng X, Liao YH (2010) Th17 cells contribute to viral replication in coxsackievirus B3-induced acute viral myocarditis. J Immunol 185:4004–4010 41. Yuan J, Yu M, Lin QW, Cao AL, Yu X, Dong JH, Wang JP, Zhang JH, Wang M, Guo HP, Cheng X, Liao YH (2011) Th17 cells contribute to viral replication in coxsackievirus B3-induced acute viral myocarditis. J Immunol 185:4004–4010 42. Zandian M, Mott KR, Allen SJ, Dumitrascu O, Kuo JZ, Ghiasi H (2011) Use of cytokine immunotherapy to block CNS demyelination induced by a recombinant HSV-1 expressing IL-2. Gene Ther 18:734–742
123
ORIGINAL ARTICLE
In vivo delivery of interleukin-35 relieves coxsackievirus-B3induced viral myocarditis by inhibiting Th17 cells Yadong Hu • Chunsheng Dong • Yan Yue Sidong Xiong
•
Received: 14 November 2013 / Accepted: 21 April 2014 Ó Springer-Verlag Wien 2014
Abstract Interleukin (IL)-35 is a new member of the IL12 cytokine family. The suppressive role of IL-35 in the immune response to parasitic and bacterial infections and in autoimmunity has been demonstrated in terms of its antiinflammatory properties. However, the functional role of IL-35 in viral myocarditis has not been investigated. In this study, IL-35 expression was measured in heart tissues with coxsackievirus B3 (CVB3)-induced myocarditis. It was significantly reduced in the late stage of viral infection and correlated negatively with disease severity. To examine the therapeutic role of IL-35 in viral myocarditis, an IL-35expressing plasmid (pIL-35-FC) was packaged with polyethyleneimine and delivered intraperitoneally to BALB/c male mice before and after CVB3 infection. The severity of myocarditis was assessed 7 days after infection. The in vivo delivery of IL-35 significantly ameliorated the severity of viral myocarditis, reflected in an increased survival rate and increased bodyweights, and reduced serum creatine kinase (CK) and CK-MB activities, cardiac pathological scores, and viral replication. We also show that the overexpression of IL-35 reduced splenic Th17 cells and Th17-related proinflammatory cytokines in heart tissues. In conclusion, our data indicate that IL-35 effectively protects the myocardium from the pathogenesis of CVB3induced viral myocarditis, which may be attributable to reduced Th17 production. This suggests that supplementation with IL-35 could be a novel therapeutic treatment for viral myocarditis.
Y. Hu C. Dong Y. Yue S. Xiong (&) Jiangsu Key Laboratory of Infection and Immunity, Institutes of Biology and Medical Science, Soochow University, Suzhou 215123, China e-mail: [email protected]
Introduction Viral myocarditis is a frequent cause of sudden death in young adults and can progress to acute myocarditis, chronic dilated cardiomyopathy, and even heart failure associated with an autoimmune response [9]. It is clinically defined as cardiac disease associated with inflammation of the myocardium and necrosis in the absence of an ischemic event. Infectious agents, especially coxsackieviruses, are thought to be the most important etiological agents of myocarditis [24, 36]. Coxsackieviruses are non-enveloped, single-stranded RNA viruses with a genome of approximately 7,500 nt, belonging to the family Picornaviridae. During infection, viral RNA enters the cytoplasm and acts as a template for both genomic replication and protein synthesis. The four capsid proteins (VP1, VP2, VP3 and VP4) and seven nonstructural proteins (2A, 2B, 2C, 3A, 3B, 3C and 3D) are generated by viral-protease-mediated processing of the single polyprotein translated from the genomic RNA [28]. No effective preventative or therapeutic strategy for viral myocarditis is yet available in the clinical context, predominantly because the pathogenesis of viral myocarditis is not well understood. However, increasing evidence supports the idea that tissue injury from an excessively activated immune response, rather than that from direct viral infection [1, 14, 17], plays a critical pathogenetic role in the course of viral myocarditis [11, 12, 18]. Interleukin (IL)-35 is a newly discovered immunosuppressive cytokine belonging to the IL-12 family that is exclusively produced by Treg cells and consists of p35 and EBI3 subunits [2, 6]. IL-35 stimulates the expansion of CD4?CD25? T cells, suppresses the proliferation of CD4?CD25- T cells, and inhibits the differentiation of Th17 cells to attenuate disease in models of collagen-
123
Y. Hu et al.
induced arthritis and inflammatory bowel disease [5, 25]. Liu and colleagues showed that IL-35 can be detected in the peripheral blood of patients with chronic hepatitis B, whereas it is undetectable in healthy individuals [20]. Wirtz and others recently confirmed that IL-35, rather than IL-27, significantly suppresses Th1- and Th17-cell proliferation and reduces the development of experimental colitis [38]. IL-35 is also reported to have an inhibitory effect on demyelination by preventing the development of autoaggressive T cells [42]. All these data indicate the potential utility of IL-35 in therapies for some inflammatory and autoimmune diseases based on its immunosuppressive function. However, the presence of IL-35 in coxsackievirus B3 (CVB3)-induced myocarditis and its anti-inflammatory function in viral myocarditis have not been evaluated. In this study, we examined the potential effects of IL-35 on CVB3-induced myocarditis. The kinetics of IL-35 expression in the heart tissues of mice with viral myocarditis was determined. A polyethyleneimine (PEI)-packaged IL-35-expressing plasmid was delivered intraperitoneally to male BALB/c mice and the therapeutic effects of this strategy on viral myocarditis were assessed.
Materials and methods Animals Six-week-old male BALB/c (H-2d) mice were purchased from the Experimental Animal Centre of the Chinese Academy of Sciences (Shanghai, P.R. China) and bred in a specific-pathogen-free facility. All animal experiments were carried out in strict accordance with the recommendations of the Guide for the Care and Use of Medical Laboratory Animals (Ministry of Health, P.R. China, 1998). The study protocol was approved by the Ethical Committee of Soochow University. Virus CVB3 (Nancy strain) was maintained by passage in HeLa cells (ATCC CCL-2). The viral titer was determined using a 50 % tissue culture infectious dose (TCID50) assay on HeLa cell monolayers and calculated by the Reed-Muench method. Mice were infected with an intraperitoneal injection of 0.1 mL of phosphate-buffered saline (PBS) containing 103 TCID50 of the virus. In vivo delivery of IL-35 Mice were injected intraperitoneally with 103 TCID50 of CVB3 on day 0, and then intraperitoneally received 50 lg
123
of pIL-35-FC plasmid DNA packaged with 0.258 ng of PEI (Polyscience) in 0.2 mL of PBS 1 day before CVB3 infection and on day 1 and day 3 after CVB3 infection. The control group of mice received pFC plasmid DNA, administered in the same way. Each group contained eight mice. Cardiac IL-35 enzyme-linked immunosorbent assay (ELISA) Freshly isolated heart tissue was ground to a fine powder under liquid nitrogen. Each sample (100 mg of powdered tissue) was homogenized in 0.5 mL of RIPA buffer and then centrifuged in a cooled microcentrifuge for 8 min. The supernatants were then subjected to ELISA with a mouse IL-35 ELISA kit (Cusabio Biotec, China) according to the manufacturer’s instructions. Histopathological analysis and myocarditis scoring Hearts were collected from the infected mice on day 7, fixed in 10 % buffered formalin solution, and embedded in paraffin. Sections (5 lm thick) were cut and stained with hematoxylin and eosin (H&E). The extent of the myocardial lesions was quantified and scored for severity as follows: 0 = no inflammation; 1 = one to five distinct mononuclear inflammatory foci, with the involvement of 5 % or less of the cross-sectional area; 2 = more than five distinct mononuclear inflammatory foci, or the involvement of over 5 % but not over 20 % of the cross-sectional area; 3 = diffuse mononuclear inflammation involving over 20 % of the area, without necrosis; and 4 = diffuse inflammation with necrosis. The analysis was performed in a double-blinded manner by a trained pathologist. Real-time PCR Total RNA was isolated from each preparation using TRIzolÒ Reagent (Invitrogen, USA) according to the manufacturer’s instructions and converted into cDNA using M-MuLV reverse transcriptase (Fermentas International Inc., Canada). The cDNA was amplified with SYBR Green Master Mix (TaKaRa, China) using an ABI 7500 thermocycler (Applied Biosystems). The 2-DDCT method was used to normalize the transcription of IL-35 mRNA to that of GAPDH mRNA and to calculate the fold induction relative to the control [30]. The primer pairs that were used are shown in Table 1. To determine the myocardial viral RNA loads, hearts were collected and homogenized 7 days after infection with 103 TCID50 of CVB3. The total RNA was reverse transcribed to cDNA using a CVB3-specific positive-strand RNA primer (50 -CACCGGATGGCCAATCCA-30 ) or a
Role of interleukin-35 in CVB3-induced myocarditis Table 1 Real-time PCR primers Gene
Primer sequence (50 -30 )
IL-17A
Sense: CCGCAATGAAGACCCTGATAGAT
IL-6
Sense: ACAACCACGGCCTTCCCTACTT
IL-21
Sense: GGCCAAACTCAAGCCATCAA
ROR ct
Sense: CCGCTGAGAGGGCTTCAC
Antisense: AGAATTCATGTGGTCCAGC Antisense: CACGATTTCCCAGAGAACATGTG
were added to triplicate wells and incubated at 37 °C for 2 h. After the samples were washed, the biotinylated detection antibody was added for 1 h, followed by 100 mL of streptavidin-conjugated horseradish peroxidase, and the samples were incubated for 1 h at 37 °C. TMB substrate (eBioscience) was added to each well. After 10 min, 50 mL of stop solution (2 N H2SO4) was added and the absorbance was measured at 450 nm.
Antisense: GCCACGAGGTCAATGATGAA
Statistical analysis
Antisense: TGCAGGAGTAGGCCACATTACA
negative-strand RNA primer (50 -GCGAAGAGTCTATTG AGCTA-30 ) and then subjected to SYBR Green real-time PCR using CVB3 primers (50 -ATCAAGTTGCGTGCT GTG-30 and 50 -TGCGAAATGAAAGGAGTGT-30 ). The expression of the viral RNA load was normalized to mouse GAPDH expression using the 2-DDCT method. Flow-cytometric analysis Splenocytes were isolated and suspended in RPMI 1640 containing 10 % fetal bovine serum, and red blood cells were lysed by incubation for 3 min in ACK lysis buffer (Tiangen, China). The cells were collected and resuspended at a density of 1.0 9 106 cell/mL. The cells were then stimulated for 4 h with 50 ng phorbol 12-myristate 13 acetate and 1 lg ionomycin per mL (Sigma-Aldrich, St. Louis, MO, USA), and cytokine secretion was blocked with 10 lg/mL brefeldin A (Sigma-Aldrich) at 37 °C under 5 % CO2 in a 24-well culture plate (Corning Costar, Corning, NY, USA) in RPMI 1640 medium supplemented with 100 U penicillin and 100 lg streptomycin per mL and 10 % fetal bovine serum. Surface markers were stained with PE-labeled anti-mouse CD4 antibody (Biolegend). After the cells were washed, fixed, and permeabilized according to the manufacturer’s instructions (Biolegend), they were stained intracellularly with an APC-conjugated anti-mouse IL-17A antibody (eBiosciences). After incubation at 4 °C for 30 min, the samples were washed in staining buffer and measured by flow cytometry on a FACSCalibur cell sorter. The data were analyzed using CellQuest software (BD Biosciences). Cytokine ELISAs The amounts of IL-17A, IL-6, tumor necrosis factor a (TNF-a), and IL-10 in the homogenized heart tissues were measured using ELISAs (R&D Systems) according to the manufacturer’s instructions. In brief, plates were coated with the diluted capture antibody (100 mL/well) and incubated overnight at 4 °C. The samples and standards
Data are presented as means ± SEM. Differences between experimental groups were analyzed for statistical significance using an unpaired Student’s t-test in GraphPad Prism version 4.01 (GraphPad Software Inc.). A value of P \ 0.05 was considered significant.
Results Expression of IL-35 during viral myocarditis and its negative correlation with disease severity To generate an acute viral myocarditis model, male BALB/c mice were injected intraperitoneally with 103 TCID50 of CVB3, as described previously [13]. As expected, the bodyweights of the CVB3-infected mice decreased continuously from day 3 post-infection compared with those of normal mice (Fig. 1A). Consistent with this, a histological analysis of the cardiac tissues on days 0, 3, 5, and 7 showed slight myocardial injury on day 3, which increased markedly in subsequent days (Fig. 1B and C). We then examined the kinetic expression of IL-35 after CVB3 infection. As shown in Fig. 1D, IL-35 peaked in the cardiac tissues on day 3 but then rapidly declined during the late infectious stage of CVB3 on day 7, the severe course of viral myocarditis. To further investigate the involvement of IL-35 in the pathological processes of viral myocarditis, the correlation between cardiac IL-35 expression and disease severity, including bodyweight loss and the myocardial pathological score, were analyzed on day 7 after CVB3 infection, when the pathological peak of acute viral myocarditis occurs. The IL-35 level correlated negatively with bodyweight loss (r = -0.6579, p = 0.0056) and the heart pathological score (r = -0.6026, p = 0.0135), implying that IL-35 exerts a protective effect against CVB3-induced myocarditis (Fig. 1E and F). Overexpression of IL-35 significantly alleviates CVB3induced myocarditis Next, we examined whether IL-35 has a therapeutic effect on CVB3-induced myocarditis. To investigate this, we
123
Y. Hu et al.
Fig. 1 Expression kinetics of IL-35 and its correlations with the severity of acute myocarditis. Male BALB/c mice were infected with 103TCID50 of CVB3 at day 0. (A) Body weight changes were monitored daily until day 9 post-infection. (B) H&E staining of heart tissue sections prepared on days 0, 3, 5 and 7 post-infection. Cardiac inflammation is indicated by the arrows (magnification: 9200). (C) The severity of myocarditis was scored using a standard 0–4 scale based on foci of mononuclear infiltration and myocardial necrosis. (D) Hearts were collected and homogenized on days 0, 1, 3, 5, 7, 9
post-infection. The expression of IL-35 in cardiac tissue was analyzed by ELISA assay. Correlations were found between IL-35 expression levels in cardiac tissues and measures of the severity of acute myocarditis ([E] body weight loss or [F] myocarditis pathological score) on day 7 following 103 TCID50 CVB3 inoculation. Results are presented as the means ± SEM of three separate experiments. *, P \ 0.05; **, P \ 0.01. Each group contained eight mice. For the correlation analysis, sixteen surviving mice from five experiments were tested
overexpressed IL-35 by introducing pIL-35-FC, a plasmid encoding IL-35 with the secretory signal from Igj, into mice with CVB3-induced myocarditis [25]. The PEIpackaged plasmid was delivered intraperitoneally to the mice. Cardiac IL-35 was measured at the indicated time points. The level of IL-35 reached 1400 pg/100 mg tissue 3 days after injection and 2024 pg/100 mg tissue 7 days after injection in the pIL-35-FC-treated mice. This was dramatically higher than its levels in the pFC-treated control mice, suggesting that the PEI-delivered pIL-35-FC plasmid greatly enhanced the cardiac expression of IL-35 and maintained it at a high level for several days (Fig. 2A). The male mice were then injected intraperitoneally three times with pIL-35-FC or p-FC: 1 day before and 1 and 3 days after infection with 103 TCID50 of CVB3. The severity of myocarditis was carefully studied. As shown in Figure 2B and C, the mice in the group treated with p-FC or in the untreated group underwent marked and continuous bodyweight loss of up to 29 %, and more than 70 % of the mice died within 10 days of infection. In contrast, the bodyweights of mice that received pIL-35-FC showed negligible fluctuation and the mice displayed a significantly
improved survival rate (75 %). Consistent with these findings, the serum CK and CK-MB activities, indices of myocardial injury, were significantly reduced in the mice treated with pIL-35-FC (Fig. 2D and E). Importantly, improved histopathology of the heart tissues, with less inflammation and limited necrotic lesions (Fig. 2F), was also observed in the pIL-35-FC-treated mice, indicating the amelioration of their myocarditis. Furthermore, the relative genome copy level in the pIL-35-FC-treated myocarditisaffected mice was reduced when compared to control groups (Fig. 2G). All these data indicate that the in vivo delivery of IL-35 efficiently protected mice from myocarditis caused by CVB3 infection.
123
Overexpression of IL-35 reduced the number of Th17 cells in CVB3-induced myocarditis Recently, we and others have found that Th17 cells play an important role in the pathogenesis of CVB3-induced myocarditis [8, 19, 41]. Moreover, the suppression of Th17 cells has been reported to be one of the functions of IL-35 [25]. Therefore, using real-time PCR, we explored the
Role of interleukin-35 in CVB3-induced myocarditis
Fig. 2 pIL-35-FC administration ameliorates CVB3-induced myocarditis. (A) Expression of IL-35 in heart tissues of CVB3-infected mice after pIL-35-FC plasmid injection. Mice were injected intraperitoneally with 50 lg of pIL-35-FC or p-FC packaged with PEI 1 day before CVB3 infection and on day 1 and day 3 after CVB3 infection. The expression level of IL-35 in heart tissues on days 0, 1, 3, 5, 7 after CVB3 infection was detected by ELISA. (B) The survival rate and (C) Body weight change were monitored daily until day 9 and day 8 post-infection, respectively. Serological indices of myocarditis, (D) the activity of CK and (E) level of CK-MB, were also determined on day 8 post-infection. (F) Paraffin sections of heart
tissues were prepared, and the arrows indicate the cardiac inflammation stained with H&E. The severity of myocarditis was scored using a standard 0–4 scale based on foci of mononuclear infiltration and myocardial necrosis (right). (G) Myocardial virus replication was also detected using real-time PCR assays. Normal, normal mice; w/o treatment, CVB3-infected mice without plasmid injection; IL-35, CVB3-infected mice with pIL-35-FC injection; FC, CVB3-infected mice with p-FC injection. Results are presented as the means ± SEM of three separate experiments.*, P \ 0.05; **, P \ 0.01; ***, P \ 0.001. Each group contained eight mice
potential therapeutic mechanism of IL-35 treatment by assessing the splenic Th17 frequencies, the characteristic cytokines, and the expression of transcription factors on day 7 after infection. As shown in Figure 3A and B, the frequency of CD4?IL-17? T cells was reduced threefold by pIL-35-FC treatment compared with the frequency observed after p-FC treatment. Similar results were observed for the Th17-associated cytokines (IL-17A and IL-6) and the master transcription factor RORct, confirming that pIL-35-FC treatment significantly reduces the frequency of splenic Th17 cells in viral myocarditis (Fig. 3C).
Reduced proinflammatory cytokine expression in heart tissue after pIL-35-FC treatment One of the biological characteristics of viral myocarditis is the inflammation produced by excessive proinflammatory cytokines during the acute stage of the disease [7]. Proinflammatory cytokines, such as IL-17, IL-6, and TNF-a, are involved in Th17-mediated inflammation [37]. Therefore, using ELISAs, we assessed the expression of IL-17A, IL-6, and TNF-a in cardiac tissues after pIL-35-FC treatment. Interestingly, significantly lower levels of IL-17A, IL-6, and TNF-a expression were seen in the heart tissues of
123
Y. Hu et al.
Fig. 3 Reduced Th17 cell expression in mouse spleen after in vivo delivery of pIL-35-FC. Mice were infected with 103 TCID50 doses of CVB3 and were received intraperitoneally with 50 lg of pIL-35-FC or p-FC packaged with PEI 1 day before CVB3 infection and on day 1 and day 3 after CVB3 infection. Mice were sacrificed on day 7 postinfection. (A) Splenocytes prepared from mice. These cells were stimulated for 4 h in vitro and then stained with anti-CD4-PE and
anti-IL-17-APC. The percentage of Th17 cells was then determined by FACS plot. (B) Statistical analysis of the splenic Th17 cell frequency. (C) Expression of IL-17A, IL-6, IL-21 and RORct in the spleen was detected by quantitative PCR. Results are presented as the mean ± SEM of three separate experiments.*, P \ 0.05; ***, P \ 0.001; ns, no significance. Each group contained eight mice
mice treated with pIL-35-FC (Fig. 4A–C). We and others have also reported that the immunoregulatory cytokine IL10 exerts a protective effect on viral myocarditis [16, 26]. However, there was no difference in the expression of IL10 between the groups tested here (Fig. 4D). These results suggest that a reduction in cardiac proinflammatory cytokines contributes to the alleviation of CVB3-induced myocardial injury.
cardiac inflammatory infiltration (Fig. 1), suggesting that the inhibition of the inflammatory response might be an effective treatment for viral myocarditis. IL-35 is a newly identified heterodimeric IL-12 family cytokine containing the Epstein-Barr-virus-induced gene 3 (EBI3) and IL-27p35 subunits [6, 31, 33]. It has been reported that the source of IL-35 differs from that of the other IL-12 family cytokines, IL-12, IL-23, and IL-27. These three cytokines are all primarily secreted by antigenpresenting cells, including macrophages, monocytes, and dendritic cells, which are activated by a combination of pathogen-specific patterns [15, 21, 27]. However, IL-35 is only produced by forkhead box protein 3 (Foxp3)? regulatory T cells [4]. Its biological functions include directly suppressing Teff-cell proliferation, suppressing Th17 development, and mediating the proliferation of CD4?CD25? T cells [25]. It is a novel cytokine with therapeutic potential for inflammation, autoimmunity, and other immunological disorders [3, 35]. In this study, we first detected the kinetic expression of cardiac IL-35 in CVB3infected mice and found that high levels of IL-35 were induced on day 3 after CVB3 infection. Interestingly, these declined from day 3 and were maintained at a low level until day 9, appearing in a time-dependent manner. It is noteworthy that the severity of viral myocarditis correlated
Discussion Viral myocarditis is a life-threatening disease characterized by heart tissue inflammation induced by enteroviral or adenoviral infections. It is the composite result of both viral infection and uncontrolled host immune reactions [34]. During the early viremic period, CVB3 infects the heart tissues by receptor-mediated endocytosis [32] and may cause myocardiocyte dysfunction by disrupting dystrophin-sarcoglycan complexes or cleaving eukaryotic initiation factor 4 [22]. At a later stage of infection, proinflammatory cytokines and chemokines are robustly expressed, resulting in massive inflammation and aggravated injury in the heart [23]. In our study, we noted that greater bodyweight loss correlated with higher levels of
123
Role of interleukin-35 in CVB3-induced myocarditis
Fig. 4 Decreased proinflammatory cytokines expression in VMC mice after overexpression of IL-35. Mice were infected with 103 TCID50 doses of CVB3 and were injected intraperitoneally with 50 lg of pIL-35-FC or p-FC packaged with PEI at 1 before CVB3 infection and on day 1 and day 3 after CVB3 infection. Mice were
sacrificed on day 7, and heart tissue was homogenized. The expression level of (A) TNF-a, (B) IL-6, (C) IL-17A and (D) IL-10 in heart tissue was determined by ELISA. Each group contained eight mice. The p-value represents the significance of comparison between the IL-35 and FC groups
negatively with cardiac levels of IL-35 (Fig. 1), providing further support for the treatment of viral myocarditis with IL-35. Therefore, we overexpressed IL-35 in vivo with the intraperitoneal delivery of PEI-packaged pIL-35-FC plasmid. The injected PEI/plasmid complex can target to multiple cells and be expressed in some of the major organs, including the heart, according our previous work. The in vivo delivery of IL-35 significantly alleviated the severity of CVB3-induced viral myocarditis in mice, with reduced inflammatory infiltration, reduced cardiac injury, and an improved survival rate (Fig. 2). Our results indicate that IL-35 could be a therapeutic cytokine for the treatment of viral myocarditis as well as other inflammatory diseases [38, 42]. It is well established that the bias of the T-cell immune response markedly affects the severity of myocarditis [7, 10]. CVB3-induced myocarditis represents a predominantly pathological cell-mediated cardiac inflammatory disease, rather than a direct virus-mediated cardiac inflammatory disease. Although strong host Th1 immune responses may play a critical pathogenetic role in the course of viral myocarditis, especially in the subacute stage (days 4–14), increasing evidence indicates that besides CD4? Th1 cells, Th17 cells are also involved in the pathogenesis of viral myocarditis [8, 39– 41]. As important effector cells in several inflammatory states, Th17 cells are positioned at a major nexus between the innate and adaptive immune responses and play a critical role in the host defenses and
immunopathology. We have previously reported that the induction of distinct Th17 populations contributes to sexbased differences in the susceptibility to CVB3-induced myocarditis [19]. Consistent with a report by Niedbala et al. that IL-35 inhibits the differentiation of Th17 cells in vitro [25], we observed a reduction in Th17 cells in the spleens of infected mice after IL-35 treatment in vivo. Interestingly, we also found that viral replication was significantly inhibited in CVB3-infected mice treated with pIL-35-FC. It has been reported that the neutralization of IL-17 increases the number of Th1 CD4? and CD8? T cells, which ameliorates the pathological cardiac changes and reduces viral replication [40]. We observed increased Th1 CD4? and CD8? IFN-c? T cells in the spleen after IL-35 treatment (data not shown), and this might reflect a balance between antiviral immunity and autoimmunity during viral myocarditis. Several reports have shown that the inflammatory cytokines are the dominant inflammatory mediators of myocardial injury in the inflammatory phase of viral myocarditis [29]. In this study, we observed that the expression of the Th17-related cytokines IL-6 and TNF-a [37] declined, together with reductions in both IL-17A and CVB3 replication, suggesting that reduced production of Th17 cells might lead to the attenuation of their inflammatory cardiac cytokines. Thus, we speculate that the therapeutic effect of IL-35 on CVB3-induced viral myocarditis is partially attributable to the decline in Th17 cells, together with reduced viral replication.
123
Y. Hu et al.
In this study, we have shown for the first time that the delivery of IL-35 in vivo can relieve CVB3-induced myocardial inflammation and alleviate the severity of myocarditis. The inhibition of Th17 cell production by IL-35 may account for the suppression of the CVB3-induced inflammatory response and cardiac viral replication. Therefore, the immunosuppressive cytokine IL-35 may be a new therapeutic candidate for treatment of viral myocarditis and other inflammatory diseases. Acknowledgments The authors thank Prof. Foo Y. Liew at the University of Glasgow for providing mouse IL-35 expression plasmids. This work was supported by grants from the National Natural Science Foundation of China (81072413, 31270977, 31270973, 31170878), Major State Basic Research Development Program of China (2013CB530501, 2013CB531502), Jiangsu ‘‘PanDeng’’ Project (BK2010004), the Natural Science Foundation of the Jiangsu Higher Education Institutions (12KJB310015), Jiangsu ‘‘333’’ Project of Cultivation of High-Level Talents and Jiangsu Provincial Innovative Team, Qing Lan Project of the Jiangsu Higher Education Institutions, Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) and Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT-IRT1075). The authors have no conflicting financial interests.
References 1. Badorff C, Fichtlscherer B, Rhoads RE, Zeiher AM, Muelsch A, Dimmeler S, Knowlton KU (2000) Nitric oxide inhibits dystrophin proteolysis by coxsackieviral protease 2A through S-nitrosylation: a protective mechanism against enteroviral cardiomyopathy. Circulation 102:2276–2281 2. Bardel E, Larousserie F, Charlot-Rabiega P, Coulomb-L’Hermine A, Devergne O (2008) Human CD4? CD25? Foxp3? regulatory T cells do not constitutively express IL-35. J Immunol 181:6898–6905 3. Castellani ML, Anogeianaki A, Felaco P, Toniato E, De Lutiis MA, Shaik B, Fulcheri M, Vecchiet J, Tete S, Salini V, Theoharides TC, Caraffa A, Antinolfi P, Frydas I, Conti P, Cuccurullo C, Ciampoli C, Cerulli G, Kempuraj D (2010) IL-35, an antiinflammatory cytokine which expands CD4?CD25? Treg cells. J Biol Regul Homeost Agents 24:131–135 4. Collison LW, Workman CJ, Kuo TT, Boyd K, Wang Y, Vignali KM, Cross R, Sehy D, Blumberg RS, Vignali DA (2007) The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature 450:566–569 5. Collison LW, Chaturvedi V, Henderson AL, Giacomin PR, Guy C, Bankoti J, Finkelstein D, Forbes K, Workman CJ, Brown SA, Rehg JE, Jones ML, Ni HT, Artis D, Turk MJ, Vignali DA (2010) IL-35-mediated induction of a potent regulatory T cell population. Nat Immunol 11:1093–1101 6. Devergne O, Birkenbach M, Kieff E (1997) Epstein-Barr virusinduced gene 3 and the p35 subunit of interleukin 12 form a novel heterodimeric hematopoietin. Proc Natl Acad Sci USA 94:12041–12046 7. Esfandiarei M, McManus BM (2008) Molecular biology and pathogenesis of viral myocarditis. Annu Rev Pathol 3:127–155 8. Fan Y, Weifeng W, Yuluan Y, Qing K, Yu P, Yanlan H (2011) Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation. Virol J 8:17
123
9. Feldman AM, McNamara D (2000) Myocarditis. N Engl J Med 343:1388–1398 10. Frisancho-Kiss S, Coronado MJ, Frisancho JA, Lau VM, Rose NR, Klein SL, Fairweather D (2009) Gonadectomy of male BALB/c mice increases Tim-3(?) alternatively activated M2 macrophages, Tim-3(?) T cells, Th2 cells and Treg in the heart during acute coxsackievirus-induced myocarditis. Brain Behav Immun 23:649–657 11. Fuse K, Chan G, Liu Y, Gudgeon P, Husain M, Chen M, Yeh WC, Akira S, Liu PP (2005) Myeloid differentiation factor-88 plays a crucial role in the pathogenesis of Coxsackievirus B3induced myocarditis and influences type I interferon production. Circulation 112:2276–2285 12. Guthrie M, Lodge PA, Huber SA (1984) Cardiac injury in myocarditis induced by Coxsackievirus group B, type 3 in Balb/c mice is mediated by Lyt 2? cytolytic lymphocytes. Cell Immunol 88:558–567 13. He J, Yue Y, Dong C, Xiong S (2013) MiR-21 confers resistance against CVB3-induced myocarditis by inhibiting PDCD4-mediated apoptosis. Clin Invest Med 36:E103–E111 14. Henke A, Nestler M, Strunze S, Saluz HP, Hortschansky P, Menzel B, Martin U, Zell R, Stelzner A, Munder T (2001) The apoptotic capability of coxsackievirus B3 is influenced by the efficient interaction between the capsid protein VP2 and the proapoptotic host protein Siva. Virology 289:15–22 15. Hibbert L, Pflanz S, De Waal Malefyt R, Kastelein RA (2003) IL27 and IFN-alpha signal via Stat1 and Stat3 and induce T-Bet and IL-12Rbeta2 in naive T cells. J Interferon Cytokine Res 23:513–522 16. Jiang Z, Xu W, Li K, Yue Y, Xu L, Ye F, Xiong S (2008) Remission of CVB3-induced viral myocarditis by in vivo Th2 polarization via hydrodynamics-based interleukin-4 gene transfer. J Gene Med 10:918–929 17. Klingel K, Kandolf R (1993) The role of enterovirus replication in the development of acute and chronic heart muscle disease in different immunocompetent mouse strains. Scand J Infect Dis Suppl 88:79–85 18. Leipner C, Grun K, Borchers M, Stelzner A (2000) The outcome of coxsackievirus B3-(CVB3-) induced myocarditis is influenced by the cellular immune status. Herz 25:245–248 19. Li Z, Yue Y, Xiong S (2013) Distinct Th17 inductions contribute to the gender bias in CVB3-induced myocarditis. Cardiovasc Pathol 22:373–382 20. Liu F, Tong F, He Y, Liu H (2011) Detectable expression of IL35 in CD4? T cells from peripheral blood of chronic hepatitis B patients. Clin Immunol 139:1–5 21. Ma X, Chow JM, Gri G, Carra G, Gerosa F, Wolf SF, Dzialo R, Trinchieri G (1996) The interleukin 12 p40 gene promoter is primed by interferon gamma in monocytic cells. J Exp Med 183:147–157 22. Maekawa Y, Ouzounian M, Opavsky MA, Liu PP (2007) Connecting the missing link between dilated cardiomyopathy and viral myocarditis: virus, cytoskeleton, and innate immunity. Circulation 115:5–8 23. Maier R, Krebs P, Ludewig B (2004) Immunopathological basis of virus-induced myocarditis. Clin Dev Immunol 11:1–5 24. Muir P, Kammerer U, Korn K, Mulders MN, Poyry T, Weissbrich B, Kandolf R, Cleator GM, van Loon AM (1998) Molecular typing of enteroviruses: current status and future requirements. The European Union concerted action on virus meningitis and encephalitis. Clin Microbiol Rev 11:202–227 25. Niedbala W, Wei XQ, Cai B, Hueber AJ, Leung BP, McInnes IB, Liew FY (2007) IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol 37:3021–3029
Role of interleukin-35 in CVB3-induced myocarditis 26. Nishio R, Matsumori A, Shioi T, Ishida H, Sasayama S (1999) Treatment of experimental viral myocarditis with interleukin-10. Circulation 100:1102–1108 27. Pflanz S, Hibbert L, Mattson J, Rosales R, Vaisberg E, Bazan JF, Phillips JH, McClanahan TK, de Waal Malefyt R, Kastelein RA (2004) WSX-1 and glycoprotein 130 constitute a signal-transducing receptor for IL-27. J Immunol 172:2225–2231 28. Racaniello VR (2007) Picornaviridae: the virus and their replication. In: Knipe DM, Howley PM, Griffin DE, Lamb RA, Straus SE, Martin MA, Roizman B (eds) Fields virology, 5th edn. Lippincott, Philadelphia 29. Ritter JT, Tang-Feldman YJ, Lochhead GR, Estrada M, Lochhead S, Yu C, Ashton-Sager A, Tuteja D, Leutenegger C, Pomeroy C (2010) In vivo characterization of cytokine profiles and viral load during murine cytomegalovirus-induced acute myocarditis. Cardiovasc Pathol 19:83–93 30. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101–1108 31. Schoenhaut DS, Chua AO, Wolitzky AG, Quinn PM, Dwyer CM, McComas W, Familletti PC, Gately MK, Gubler U (1992) Cloning and expression of murine IL-12. J Immunol 148:3433–3440 32. Shi Y, Chen C, Lisewski U, Wrackmeyer U, Radke M, Westermann D, Sauter M, Tschope C, Poller W, Klingel K, Gotthardt M (2009) Cardiac deletion of the Coxsackievirus-adenovirus receptor abolishes Coxsackievirus B3 infection and prevents myocarditis in vivo. J Am Coll Cardiol 53:1219–1226 33. Stern AS, Podlaski FJ, Hulmes JD, Pan YC, Quinn PM, Wolitzky AG, Familletti PC, Stremlo DL, Truitt T, Chizzonite R et al (1990) Purification to homogeneity and partial characterization of cytotoxic lymphocyte maturation factor from human B-lymphoblastoid cells. Proc Natl Acad Sci USA 87:6808–6812 34. Tam PE (2006) Coxsackievirus myocarditis: interplay between virus and host in the pathogenesis of heart disease. Viral Immunol 19:133–146
35. Vojdani A, Lambert J (2011) The role of Th17 in neuroimmune disorders: target for CAM therapy. Part I. Evid Based Complement Altern Med 2011:927294 36. Why HJ, Meany BT, Richardson PJ, Olsen EG, Bowles NE, Cunningham L, Freeke CA, Archard LC (1994) Clinical and prognostic significance of detection of enteroviral RNA in the myocardium of patients with myocarditis or dilated cardiomyopathy. Circulation 89:2582–2589 37. Wilson NJ, Boniface K, Chan JR, McKenzie BS, Blumenschein WM, Mattson JD, Basham B, Smith K, Chen T, Morel F, Lecron JC, Kastelein RA, Cua DJ, McClanahan TK, Bowman EP, de Waal Malefyt R (2007) Development, cytokine profile and function of human interleukin 17-producing helper T cells. Nat Immunol 8:950–957 38. Wirtz S, Billmeier U, McHedlidze T, Blumberg RS, Neurath MF (2011) Interleukin-35 mediates mucosal immune responses that protect against T-cell-dependent colitis. Gastroenterology 141:1875–1886 39. Xie Y, Chen R, Zhang X, Chen P, Liu X, Xie Y, Yu Y, Yang Y, Zou Y, Ge J, Chen H (2011) The role of Th17 cells and regulatory T cells in Coxsackievirus B3-induced myocarditis. Virology 421:78–84 40. Yuan J, Yu M, Lin QW, Cao AL, Yu X, Dong JH, Wang JP, Zhang JH, Wang M, Guo HP, Cheng X, Liao YH (2010) Th17 cells contribute to viral replication in coxsackievirus B3-induced acute viral myocarditis. J Immunol 185:4004–4010 41. Yuan J, Yu M, Lin QW, Cao AL, Yu X, Dong JH, Wang JP, Zhang JH, Wang M, Guo HP, Cheng X, Liao YH (2011) Th17 cells contribute to viral replication in coxsackievirus B3-induced acute viral myocarditis. J Immunol 185:4004–4010 42. Zandian M, Mott KR, Allen SJ, Dumitrascu O, Kuo JZ, Ghiasi H (2011) Use of cytokine immunotherapy to block CNS demyelination induced by a recombinant HSV-1 expressing IL-2. Gene Ther 18:734–742
123
