Journal of Virological Methods 230 (2016) 53–58

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Incidence of Lettuce mosaic virus in lettuce and its detection by polyclonal antibodies produced against recombinant coat protein expressed in Escherichia coli Prachi Sharma a,∗ , Susheel Sharma b , Jasvir Singh a , Swati Saha c , V.K Baranwal a a

Advanced Centre for Plant Virology, Division of Plant Pathology, Indian Agricultural Research Institute (IARI), New Delhi 110012, India School of Biotechnology, Sher-e-Kashmir University of Agricultural Sciences and Technology of Jammu (SKUAST-J), Jammu and Kashmir 180009, India c Division of Vegetable Sciences, IARI, New Delhi 110012, India b

a b s t r a c t Article history: Received 5 November 2014 Received in revised form 22 December 2015 Accepted 31 January 2016 Available online 2 February 2016 Keywords: Lactuca sativa Mosaic Polyclonal antibodies Potyviridae PTA-ELISA Western blot

Lettuce mosaic virus (LMV), a member of the genus Potyvirus of family Potyviridae, causes mosaic disease in lettuce has recently been identified in India. The virus is seed borne and secondary infection occurs through aphids. To ensure virus freedom in seeds it is important to develop diagnostic tools, for serological methods the production of polyclonal antibodies is a prerequisite. The coat protein (CP) gene of LMV was amplified, cloned and expressed using pET-28a vector in Escherichia coli BL21DE3 competent cells. The LMV CP was expressed as a fusion protein containing a fragment of the E. coli His tag. The LMV CP/His protein reacted positively with a commercial antiserum against LMV in an immunoblot assay. Polyclonal antibodies purified from serum of rabbits immunized with the fusion protein gave positive results when LMV infected lettuce (Lactuca sativa) was tested at 1:1000 dilution in PTA-ELISA. These were used for specific detection of LMV in screening lettuce accessions. The efficacy of the raised polyclonal antiserum was high and it can be utilized in quarantine and clean seed production. © 2016 Elsevier B.V. All rights reserved.

1. Introduction LeBTuce (Lactuca sativa) is the most economically important vegetable crop belonging to family Composite (Krause-Sakate et al., 2001) and typically eaten cold, raw, in salads, sandwiches, hamburgers, tacos and in many other dishes throughout the world (Fletcher et al., 2005). Lettuce mosaic is the main viral disease of this crop and was identified more than 80 years ago (Jagger, 1921) and slowly became a worldwide serious economic problem largely due to its seed borne nature (Newhall, 1923; Ryder et al., 2003). In India also, natural occurrence of LMV was reported on lettuce recently (Sharma et al., 2013). The causal organism is Lettuce mosaic virus (LMV), a member of the genus potyvirus in the family Potyviridae, it is seed-borne and disseminated by aphids in a non-persistent manner by Myzus persicae and Macrosiphum euphorbiae (Retana et al., 2008). LMV consists of flexuous virus particles of 680–900 nm × 11–15 nm, encapsidating a monopartite

∗ Corresponding author. Present Address: Department of Plant Pathology, Sher-eKashmir University of Agricultural Sciences and Technology of Jammu (SKUAST-J), Jammu and Kashmir, 180009, India. E-mail address: [email protected] (P. Sharma). http://dx.doi.org/10.1016/j.jviromet.2016.01.014 0166-0934/© 2016 Elsevier B.V. All rights reserved.

positive ssRNA genome with a VPg at the 5 end and a 3 poly-A tract expressed as a polyprotein that cleaves to functional proteins (Lopez-Moya and García, 1999; Hull, 2002). Symptoms caused by LMV vary considerably depending on the genotype, infective strain or stage of infection and environmental conditions. The characteristic symptoms on susceptible lettuce cultivars include dwarfism, mosaic, leaf distortion, vein clearing and yellowing of the leaves with sometimes a much reduced heart of lettuce leading to failure to form heads and necrotic reactions (Dinant and Lot, 1992; Revers et al., 1997; Candresse et al., 2007). Among the various diagnostic techniques, the immuno-based detection has been routinely used for virus detection (Hull, 2002). Availability of good qualitative polyclonal antibodies is important to achieve specificity and sensitivity. The use of purified virus preparations is usually a time consuming procedure and presents problems with regard to purity and difficulty in obtaining a high concentration of virus particles (Carvalho et al., 2013). To overcome this problem, recombinant proteins expressed in prokaryotic systems such as Escherichia coli are frequently used in research, being stable, abundant and easily purified (Hull, 2002; Alkowni et al., 2011; Khatabi et al., 2012. In the present study, we describe the cloning and expression of recombinant fusion protein containing the complete coat protein (CP) of LMV with a His-tag followed by the production of polyclonal

54

P. Sharma et al. / Journal of Virological Methods 230 (2016) 53–58

antibodies. The antibodies were subsequently used for detection of LMV using plate trapped antigen (PTA)-ELISA for screening lettuce accessions.

2. Materials and methods 2.1. Virus source, PCR amplification and cloning A LMV clone containing the 3 terminal region of nucleotide sequence consisting of the partial NIb, complete CP and 3 UTR (GenBank, NCBI accession no. JQ794776) originally isolated from lettuce, (Sharma et al., 2013) was used for designing primers for amplifying the full length CP. The primer pair LMVCPF: 5’CCATGGGAATGGTAGACGCAAAGCTT3’ and LMVCPR: 5 GAATTCGTGCAACCCTCTCACGCC3 with NcoI and EcoRI restriction sites respectively (bold italics) were designed for directional cloning. PCR profile consisted of a single cycle of 2 min at 95 ◦ C, 30 cycles of 30 s at 94 ◦ C, 45 s at 55 ◦ C and 1 min at 72 ◦ C; and a final extension for 10 min at 72 ◦ C. Amplified products were analyzed by agarose gel electrophoresis (1.2% gel). PCR amplicons were purified from agarose gel using SV wizard PCR clean up system (Promega) and recloned into pGEMT-Easy vector (Promega), then transformed into Esherichia coli strain DH5␣ following standard protocols (Sambrook and Russell, 2001). Recombinant clones were identified using colony PCR, plasmid PCR and restriction digestion of plasmid with NcoI and EcoRI.

Fig. 1. An agarose gel following electrophoresis showing PCR amplification of CP gene from a LMV positive clone. M: 1 kb DNA ladder (Fermentas), Lanes1–4: LMV CP amplicon.

2.2. Production of polyclonal antibodies 2.2.1. Construction of prokaryotic expression vector pET-28a-LMV CP Coat protein cloned into pGEM-T easy vector was double digested with NcoI and EcoRI restriction enzyme and the resulting fragment was cloned into NcoI and EcoRI digested pET-28a expression vector generating pET-28a-LMV CP. The recombinant DNA was transformed into an E. coli BL21 (DE3 strain) to express His-tagged LMV CP. 2.2.2. Expression and purification of recombinant pET-28a-LMV CP The E. coli strain BL21 was transformed with the recombinant plasmid construct (pET-28a-LMV CP) and selected on LB agar plate supplemented with 30 ␮g/ml of kanamycin. The transformants were grown in 5 ml LB containing 30 ␮g/ml ◦ kanamycin at 37 C, 200 rpm for 2 h and induced by isopropyl-␤d-thiogalactopyranoside (IPTG) at a final concentration of 1 mM for an additional 3 h. The expressed recombinant protein was analyzed by SDS-PAGE (Laemmli, 1970) using 5% stacking and 12% resolving gels. Electrophoresis was done at 95 mA for 2 h and gels were stained with coomassie brilliant blue R 250 stain (Sigma, St. Louis, USA). Protein was mixed with 80 ␮l of 2× SDS loading dye containing ␤-mercaptoethanol and denatured at 100 ◦ C for 5 min prior to PAGE. An aliquot of 10 ␮l was analyzed in 10% SDS-PAGE. An uninduced control culture was analyzed in parallel. Similarly, expression was carried out at large scale with 2 litres of LB for purification. The crude expressed protein was loaded into the SDS gel along with the pre-stained marker and after electrophoresis the band containing the expressed protein was cut with sharp sterilized scalpel blade, crushed in 10% SDS and stored at 0 ◦ C overnight followed by centrifugation. The clear supernatant acted as pure protein. It was dialysed using small wonder lyser kit (Promega, USA) to remove the impurities and quantified using a NanodropTM 1000 spectrophotometer (ThermoScientific, USA) and subsequently used for western blot and immunization.

Fig. 2. An SDS PAGE gel following electrophoresis showing the expression of the LMV CP cloned in pET-28a. Lane 1: Protein prestained ladder, Lane 2: Uninduced pET-28a, Lane 3: Induced pET-28a.

2.2.3. Western blotting The specificity of the expressed His-LMV CP fusion protein was determined using commercial polyclonal antibodies (PAbs) to LMV (Agdia, 1:200) in western blot (O’Donell et al., 1982). The purified recombinant protein separated by SDS-PAGE gel was transferred to nitrocellulose membrane (Porablot NC membrane, MachereyNagel, Germany) using iblot (Invitrogen). The membrane was incubated with blocking solution (5% BSA in PBS) for 1 h at 37 ◦ C. After 3 washings with PBS, the membrane was incubated with LMV polyclonal antibodies (PAbs). The membrane was washed three times and incubated with goat antirabbit IgG alkaline phosphataseconjugated secondary antibody at 1:30000 dilution (Sigma, USA). Detection was accomplished by the addition of 5-bromo-4-chloro3-indolylphosphate-nitroblue tetrazolium (BCIP/NBT) substrate solution (Genei, Bangalore, India). 2.2.4. Immunization of rabbit Immunization of white New Zealand rabbit was performed by injecting the purified recombinant LMV CP/His fusion protein (200 ␮g) emulsified with Freund’s complete adjuvant (1:1 v/v; Santacruz, USA) intramuscularly into the hind legs of the rabbit followed by 4 injections (100 ␮g) emulsified with Freund’s incomplete adjuvant (Genei, Bangalore India) at weeks interval after 15 days of 1st injection. 2.2.5. Antiserum collection The rabbits were bled three times (one bleed per week) after one week of the 5th injection. Blood was collected from the ear vein, settled for 1 h at room temperature and keptat 4 ◦ C overnight. Serum was separated after overnight incubation by centrifuga-

P. Sharma et al. / Journal of Virological Methods 230 (2016) 53–58

55

tion at 7000 × g for 15 min, mixed with 100% glycerol (1:1 v/v) and stored at −80 ◦ C until use. 2.3. Purification of Immunoglobulin (IgG) from crude antiserum IgG fractions were purified from crude antisera by IgG purification kit (Thermoscientific, USA). Protein A column was equilibrated by application of 5 ml of binding buffer and was allowed to drain through the column. Antiserum (5 ml) was diluted with equal volume of binding buffer and allowed to pass through the column. The bound IgG was eluted with 5 ml of elution buffer and each 1 ml fraction was neutralized by addition of 50 ␮l of 1 M Tris pH 9.5. Absorbance of each fraction was measured at 280 nm using Nanodrop. This was designated as purified antiserum. 2.4. Antiserum titer analysis Sensitivity and specificity of purified antiserum against LMV CP was evaluated by PTA-ELISA. The purified fusion protein was used as antigen. Two fold dilution 1:64, 1:128, 1:256, 1:512, 1:1024, 1:2048 and 1:4096 was used for purified antiserum to determine the titre by PTA-ELISA. Once working dilution of purified antiserum was determined then infected sample was used as antigen.

Fig. 3. A western blot of the expressed LMV proteins probed using commercial LMV antiserum. Lane 1: Induced pET-28a with LMV CP, Lane 2: Uninduced pET-28a with LMV CP, Lane 3: Protein prestained ladder.

In order to compare the efficacy of the raised antiserum, PTAELISA was performed using in house generated purified antiserum at 1:1000 dilution as well as commercial LMV antiserum (Agdia) at 1:200 (recommended dilution). A total of 56 samples belonging to different accessions collected from New Delhi and Jammu and Kashmir state (Chatha and Rajouri) were used to detect the presence of LMV. Healthy lettuce (LMV negative in RT-PCR) was maintained in glasshouse as control for PTA-ELISA.

OD at 405 nm

2.5. Comparative analysis of commercial antiserum with raised antiserum

4.5 4 3.5 3 2.5 2 1.5 1 0.5 0

Healthy Protein Infected

2.6. Decoration using electron microscope (EM) Purified antibodies were diluted (1:10 in phospahate buffer) to coat copper grids (3.5 mm diameter, 400 mesh) to decorate the virus particles using positive infected sample of lettuce using standard protocol (Derrick, 1973) to observe the specificity in EM (Jeol JEM1011). 3. Results 3.1. Virus CP, cloning, expression and purification recombinant LMV CP in E. coli PCR amplification with full length LMV CP specific primers yielded an amplicon of ∼834 base pairs (Fig. 1) encoding 278 amino acids expressed in the pET-28a (+) vector downstream of the Histag. SDS-PAGE analysis of total proteins from IPTG-induced E. coli cells revealed that the CP was expressed with an estimated molecular weight of 32 kDa (Fig. 2). In contrast, expression of 32 kDa protein was absent in E. coli cells collected prior to the addition of IPTG (Fig. 2). The induced LMV protein produced as a recombinant protein reacted positively with the commercial antiserum in western blot (Fig. 3) showing specific reactivity of the produced antisera. 3.2. Production of antiserum, IgG purification and validation The raised antiserum reacted positively with LMV protein upto1:12800 dilution in PTA-ELISA (Fig. 4). In order to reduce high background reaction with crude antiserum, IgGs were purified. The

LMV antiserum dilutions Fig. 4. Analysis of polyclonal antibodies raised to the recombinant CP of LMV in PTA-ELISA. Optical density (OD) values shown were recorded at 1 h after substrate hydrolysis and represent the net values after deducting the corresponding backgrounds. Each of the OD values represents mean value of two replications. Bars indicate standard error.

purified IgG fraction showing highest absorption at 280 nm (2nd fraction; 3.35 mg/ml with absorbance 4.583) was used to detect natural infection of LMV. The ELISA results showed that the purified antiserum produced against LMV recombinant coat protein, was of good quality and specific for LMV detection, as it was capable of detecting LMV isolates irrespective of their origin. Moreover, comparative analysis of commercial antiserum along with the raised antiserum showed that raised antiserum was more efficacious as it was able to detect LMV even at 1:1000 dilution in comparison to commercial antiserum recommended to be used at 1:200 dilution. Also, infected lettuce samples were decorated specifically with raised purified antibodies in EM. (Fig. 5) 3.3. Incidence of LMV and screening of lettuce accessions Since 2012, the incidence of LMV is increasing every year (21% in 2012 and 64% in 2013) in the same field under study. In year 2014, maximum incidence of LMV was recorded up to 76% in the field based on symptoms (Fig. 6) as well as PTA-ELISA results. The lettuce plants exhibiting mosaic symptoms as well as

56

P. Sharma et al. / Journal of Virological Methods 230 (2016) 53–58

Table 1 Detection of Lettuce mosaic virus (LMV) using polyclonal antibodies (PAbs) generated against recombinant CP of LMV in PTA-ELISA. Virus

Host

Accession name

Source

No. of ELISA positive samples/No. of samples tested (A 405 nm a,b )d

Lettuce mosaic virus

Lactuca sativa (Lettuce)

Stem lettuce HRL 10:006619 Valmaine cos Wonder Von Stuttgart IHRGRU 10:006780 L-S-3 Romaine Rouge d Hiver Cappaciuno Regina di gacchi Stanton favourite Waldsman dark green Imperial 152 Imperial winter reselected Parris island cos LT-5(1) Granpa NL-1 Balmoral Iceberg Dublin F1Hybrid NVRS 10:004443 Parris island cos Yellow lettuce Bogampo Great lakes Progambo HRI 10:001730 L-S-1 LT-5 (2) Grand rapid Simpson IHRGRU 10:008206 Lettuce UVRD Lettuce VVRD Lolla rosa HRI 10:001730 Iceberg NVRS Webbs wonderful Imperial 152 New chicken Iceberg Dublin F1 hybrid Curled lettuce (1) IHRGRU 10: 006620 HRI 10:001165 GR-603 Tezier lactuca batavia Lettuce stem augustana Curled lettuce (2) IHRGRU 10:00614 Rj-1c Rj-2c Rj-3c Rj-4c Rj-5c Rj-6c Clause Balmoral Balmoral Lolla rosa

New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi New Delhi Rajouri, Jammu and Kashmir Rajouri, Jammu and Kashmir Rajouri, Jammu and Kashmir Rajouri, Jammu and Kashmir Rajouri, Jammu and Kashmir Rajouri, Jammu and Kashmir Chatha, Jammu and Kashmir Chatha, Jammu and Kashmir Chatha, Jammu and Kashmir

2/2 (0.800–0.811) 2/3 (1.029–1.038) 2/2 (0.117–0.209) 1/1 (1.407) 3/3 (1.921–1.923) 1/1 (0.861) 2/3 (0.048–0.868) 3/3 (0.948–0.950) 3/3 (1.019–1.026) 5/5 (1.272–1.873) 1/1 (0.906) 2/2 (1.189–1.196) 1/1 (0.956) 1/2 (0.117–1.291) 3/5 (0.064–1.024) 0/1 (0.001) 0/3 (0.007–0.134) 0/2 (0.002–0.024) 0/2 (0.120–0.123) 0/3 (0.089–0.098) 1/1 (0.412) 0/1 (0.055) 0/1 (0.092) 1/1 (0.487) 2/3 (0.040–0.142) 0/1 (0.065) 4/5 (0.089–0.803) 0/1 (0.019) 0/2 (0.004–0.049) 1/3 (0.129–0.404) 1/1 (0.836) 1/1 (0.824) 1/1 (0.574) 2/2 (0. 371–0.383) 2/2 (0.371–0.412) 2/2 (0.481–0.494) 1/2 (0.01–0.197) 2/2 (0.183–0.289) 2/2 (0.442–0.455) 2/2 (0.429–0.437) 3/3 (0.422–0.429) 2/2 (0.321–0.383) 3/3 (0.348–0.415) 3/3 (0.364–0.457) 5/5 (2.001–2.516) 1/1 (0.573) 2/2 (0.403–0.414) 3/3 (0.274–0.290) 2/3 (0.167–0.189) 3/3 (0.452–0.501) 2/3 (0.181–0.199) 0/3 (0.101–0.102) 0/3 (0.069–0.092) 3/3 (0.141–0.501) 3/3 (0.006–0.114) 3/3 (0.002–0.104)

a The absorbance value at 405 nm was recorded 1 h after adding substrate, p-nitrophenyl phosphate. The average absorbance value at A405 was obtained by combining the absorbance value of two replicates. An average absorbance higher than two times that of the healthy control was considered a positive reaction. b The absorbance values in healthy test plant extracts (lettuce) ranged from 0.04 to 0.07. c Accessions name not known. d LMV PAbs were used at 1:1000 dilution.

asymptomatic plants were used to specifically detect the presence of LMV using purified antibodies at 1:1000 dilution in PTA-ELISA. Out of 56 samples tested, 44 reacted positively and showed the presence of LMV (Table 1). The absorbance values at 405 nm in healthy test plant extracts (lettuce) ranged from 0.04–0.07 and samples with absorbance values more than two times that of the healthy control were considered to be positive. LMV was

even detected in accessions which were not exhibiting any kind of mosaic symptoms. However, OD values were less compared to accessions exhibiting severe mosaic symptoms. Since, Lettuce accessions collected from Jammu and Kashmir also showed the presence of LMV, thereby confirming the existence of LMV in this unexplored state.

P. Sharma et al. / Journal of Virological Methods 230 (2016) 53–58

57

Fig. 6. Mosaic symptoms caused by LMV in accessions (a) IHRGRU 10:006620 and (b) Stem lettuce. Fig. 5. Immuno-decoration of LMV particles (a) Negative staining showing flexuous virus particle of LMV (b) Virus particle decorated with the polyclonal antibodies raised to the recombinant CP of LMV in this study.

4. Discussion LMV is potentially the most destructive virus of lettuce crop worldwide (Krause-Krause-Sakate et al., 2004; Pavan et al., 2008). To prevent the further spread of this invasive virus due to seed borne nature during transboundary movement, a rapid sensitive and inexpensive serological diagnostic method is needed to complement the current RT-PCR procedure (Locali et al., 2003). Recombinant technology has great potential for producing virus antigen used during the production of antibodies. In many cases making a recombinant antigen is faster compared to the labor-intensive in-planta virus multiplication and difficult virus purification methods. (Tatineni et al., 2013). These problems can be circumvented by expressing viral proteins in E. coli, and these proteins can be used to produce polyclonal antibodies. This strategy of antibodies production has been successfully used for several plant viruses. (Cerovska et al., 2003; Iracheta-Cardenas et al., 2008; Lee and Chang, 2008; Ling et al., 2007; Raikhy et al., 2007). In the present study, we exploited recombinant technology to generate PAbs for the detection of LMV, which can be used as a large scale screening tool and can complement the available RT-PCR assay.We used bacterial expression system E. coli BL21 strain DE3 (Novagen, San Diego, USA) and pET-28a vector having His fusion tag for production of PAbs. Another advantage of this recombinant system is that the clones carrying LMV CP gene can be stored indefinitely at

−80 ◦ C to ensure its continuous supply for long-term PAbs production. The purified expressed plant viral protein as a recombinant fusion protein has been used as an antigen for raising virus-specific antibodies for immunodiagnosis of Citrus leprosis virus C (CiLV-C), Triticum mosaic virus (TriMV) and Pelargonium zonate spot virus (PZSV) (Gulati-Sakhuja et al., 2009; Choudhary et al., 2013; Tatineni et al., 2013). The expression of the entire CP coding region of LMV CP as a fusion protein with His-tag was successfully achieved by induction with 1 mM IPTG. After eluting the expressed fusion protein from the SDS-PAGE gel and dialysis, the protein was immunogenic, yielding polyclonal antibodies able to detect LMV CP protein as well as natural infection of LMV in lettuce. To our knowledge, this is the first report for the production of polyclonal antiserum against recombinant coat protein of LMV and its suitability for serological testing by PTA-ELISA as well as the first report of LMV from Jammu and Kashmir state of India detected based on PTA-ELISA based diagnostics. Although, commercial antibodies to LMV are available, they are expensive and have low titre, it is not clear if they have been raised using purified virus or recombinant technology approach. The application of antiserum to rule out the association of LMV with lettuce germplasm in quarantine is of great significance as grow out tests followed by observation of symptoms may be unreliable due to variability and mild symptoms especially in those plants which have purple color phenotype. The raised LMV antiserum will be useful for detection, surveillance, seed certification programs and indexing of seeds in quarantine due to the seed borne nature of LMV.

58

P. Sharma et al. / Journal of Virological Methods 230 (2016) 53–58

Acknowledgements This study was supported by a grant received from ICAR-IARI, New Delhi and authors are thankful to Dr. R.K Jain (Joint Director Edu. & Dean, IARI) for his kind support. References Alkowni, R., Zhang, Y.P., Rowhani, A., Uyemoto, J.K., Minafra, A., 2011. Biological, molecular, and serological studies of a novel strain of grapevine leafroll-associated virus 2. Virus Genes 43, 102–110, http://dx.doi.org/10.1007/ s11262-011-0607-7. Candresse, T., Lot, H., German-Retana, S., Krause-Sakate, R., Thomas, J., Souche, S., Delaunay, T., Lanneau, M., Le Gall, O., 2007. Analysis of the serological variability of Lettuce mosaic virus using monoclonal antibodies and surface plasmon resonance technology. J. Gen.Virol. 88, 2605–2610. Carvalho, S.L.D., Silva, F.N.D., Zanardo, L.G., Almeida, A.M.R., Zerbini, F.M., Carvalho, C.M., 2013. Production of polyclonal antiserum against Cowpea mild mottle virus coat protein and its application in virus detection. Trop. Plant Pathol. 38, 49–54. Cerovska, N., Moravec, T., Rosecka, P., Dedic, P., Filigarova, M., 2003. Production of polyclonal antibodies to a recombinant coat protein of Potato mop-top virus. J. Phytopathol. 151, 195–200. Choudhary, N., Roy, A., Guillermo, L.M., Picton, D.D., Wei, G., Nakhla, M.K., Levy, L., Brlansky, R.H., 2013. Immunodiagnosis of Citrus leprosis virus C using a polyclonal antibody to an expressed putative coat protein. J. Virol. Methods 193, 548–553. Derrick, K.S., 1973. Quantitative assay for plant viruses using serologically specific electron microscopy. Virology 56, 652–653. Dinant, S., Lot, H., 1992. Lettuce mosaic virus: a review. Plant Pathol. 41, 528–542. Fletcher, J.D., France, C.M., Butler, R.C., 2005. Virus surveys of lettuce crops and management of lettuce big-vein disease in New Zealand. N. Z. Plant Prot. 58, 239–244. Gulati-Sakhuja, A., Sears, J.L., Nunez, A., Liu, H.Y., 2009. Production of polyclonal antibodies against Pelargonium zonate spot virus coat protein expressed in Escherichia coli and application for immunodiagnosis. J. Virol. Methods 160, 29–37. Hull, R., 2002. Matthews’ Plant Virology, Fourth edn. Academic Press, New York. Iracheta-Cardenas, M., Sandoval-Alejos, B.D., Roman-Calderon, M.E., Manjunath, K.L., Lee, R.F., Rocha-Pena, M.A., 2008. Production of poyclonal antibodies to the recombinant coat protein of Citrus tristeza virus and their effectiveness for virus detection. J. Phytopathol. 156, 243–250. Jagger, I.C., 1921. A transmissible mosaic disease of lettuce. J. Agric. Res. 20, 737–741. Khatabi, B., He, B., Hajimorad, M.R., 2012. Diagnostic potential of polyclonal antibodies against bacterially expressed recombinant coat protein of Alfalfa mosaic virus. Plant Dis. 96, 1352–1357.

Krause-Sakate, R., Mello, R.N., Pavan, M.A., Zambolim, E.M., Carvalho, M.G., Le Gall, O., Zerbini, F.M., 2001. Molecular characterization of two brazilian isolates of Lettuce mosaic virus with distinct biological properties. Fitopatol. Bras. 26, 153–157. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4 . Nature 277, 680–685. Lee, S.C., Chang, Y.C., 2008. Performances and application of antisera produced by recombinant capsid proteins of Cymbidium mosaic virus and Odontoglossum ringspot virus. Eur. J. Plant Pathol. 122, 297–306. Ling, K.S., Zhu, H.Y., Petrovic, N., Gonsalves, D., 2007. Serological detection of Grapevine leafroll virus 2 using an antiserum developed against the recombinant coat protein. J. Virol. Methods 121, 31–38. Locali, E.C., Freitas-Astua, J., Souza de, A.A., Takita, M.A., Astua-Monge, G., Antonioli, R., Kitajima, E.W., Machado, M.A., 2003. Development of a molecular tool for the diagnosis of leprosis, a major threat to citrus production in the Americas. Plant Dis. 87, 1317–1321. Lopez-Moya, J.J., Ja, García, 1999. Potyvirus (Potyviridae). In: Encyclopedia of Virology. Academic Press, San Diego, CA, USA, pp. 1369–1375. Newhall, A.G., 1923. Seed transmission of lettuce mosaic. Phytopathology 13, 104–106. O’Donell, I.J., Shukla, D.D., Gough, K.H., 1982. Electro-blot immunoassay of virus infected plant sap—a powerful technique for detecting plant viruses. J. Virol. Methods 4, 19–26. Pavan, M.A., Krause-Sakate, R., Da silva, N., Zerbini, F.M., Le Gall, O., 2008. Virus diseases of lettuce in Brazil. Plant Viruses 2 (1), 35–41. Raikhy, G., Hallan, V., Kulshrestha, S., Zaidi, A.A., 2007. Polyclonal antibodies to the coat protein of Carnation etched ring virus expressed in bacterial system: production and use in immunodiagnosis. J. Phytopathol. 155, 616–622. Revers, F., Lot, H., Souche, S., Le Gall, O., Candresse, T., Dunez, J., 1997. Biological and molecular variability of Lettuce Mosaic Virus isolates. Mol. Plant Pathol. 87, 397–403. Ryder, E.J., Grube, R.C., Subbarao, K.V., Koike, S.T., 2003. Breeding for resistance to diseases in lettuce. In: Th. van Hintum, J.L., Lebeda, A., Pink, D., Schut, J.W. (Eds.), Successes and Challenges Eucarpia Leafy Vegetables, 25–30. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A laboratory Manual, 3 volume set., 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, pp. p2344. Sharma, Prachi, Jain, R.K., Saha, S., Kalia, P., 2013. First report of Lettuce mosaic virus infecting Lactuca sativa in India. Plant Dis. 97 (6), 849.2. Tatineni, S., Sarath, G., Seifers, D., French, R., 2013. Immunodetection of Triticum mosaic virus by DAS- and DAC-ELISA using antibodies produced against coat protein expressed in Escherichia coli: Potential for high-throughput diagnostic methods. J. Virol. Methods 189, 196–203.