[20]
INDUCIBLE EXPRESSION OF REGULATORY GENES
223
Acknowledgments I thank Mark Guyer, Stephen Fahnestock, Charles Saunders, and Ethel N. Jackson for critical discussions during the course of this work and Leo Thompson for the construction of aDr-spa. This work was performed at Gene× Corporation, Gaithersburg MD 20877.
[20] Inducible Expression of Regulatory Bacillus subtilis
G e n e s in
B y DENNIS J. H E N N E R
Introduction The ability to manipulate the expression of a gene of interest easily can be a valuable means to regulate gene expression. In Bacillus subtilis, the homologous recombination of nonreplicative plasmids into the chromosome makes it particularly simple to inactivate genes, to produce gene duplications, and to put any gene under the control of a regulated promoter. By this means, one can study the consequences of the loss of expression of an essential gene, or the inappropriate expression of a gene product. There are many examples of such studies in other organisms. For example, a system devised to put the Escherichia coli signal peptidase under control of the araC promoter was used to show that the signal peptidase was essential for cell viability.~ In yeast, the plasma membrane ATPase was put under the control of a galactose-inducible promoter, and it was shown that the cells were not viable unless inducer was present3 This article describes a very simple system for placing genes under control of an inducible promoter in B. subtilis. Design of Regulatory System As previously described in this volume by Le Grice) the simplest approach to an inducible promoter system in B. subtilis was to import one from E. coll. The hybrid promoter that we constructed, designated spac-1, contains the RNA polymerase recognition site from an early promoter of the B. subtilis phage SPO- 1 and the lac operator.' The lacI gene, encoding the lac repressor, was placed under the control of the Bacillus licheniformis penicillinase transcriptional and translational control signals to ensure expression in B. subtilis. 4 ' R. E. Dalbey and W. Wickner, J. Biol. Chem. 260, 15925 (1985). 2 A. Cid, R. Perona, and R. Serrano, Curr. Genet. 12, 105 (1987). 3 S. F. J. Le Grice, this volume, [18]. 4 D. Yansura and D. J. Henner, Proc. Natl. Acad Sci. U.S.A. 81, 439 (1984).
METHODS IN ENZYMOLOGY, VOL. 185
Copyright© 1990by AcademicPress,Inc. All rightsof reproductionin any formreserved.
224
EXPRESSION IN B. subtilis
120]
Figure 1 shows the structure of the integration plasmids that have been constructed. These plasmids have the pBR322 origin of replication and ampicillin resistance gene. A cat gene derived from plasmid pC194 allows selection for integration in B. subtilis on plates containing chloramphenicol. The polylinkers following the two plasmids provide a variety of sites to allow insertion of DNA fragments. Pspac= I ,a.
a
m
p
polylinker
~
p
/Y pDH87,88
pC194 cat
pDH87 Hindlll
Xbal
5all
Pstl
Sphl
AAGCTTAAGGAGGTGATCTAGAGTCGACCTGCAGGCATGC
pDH88
Hlndlll
Smal
Xbal
Hpal
Bglll
AAGCTTTTCCCGGGTTTCTAGATTTGTTAACTTAGATCT Clal Sphl TTATCGATTTGCATGC
FIG. 1. Structure of plasmids pDH87 and pDH88. The locations of the spac-1 promoter, polylinker, lacI gene, and pC914 cat gene are as shown and are approximately to scale. The rest of the plasmid is derived from pBR322 and contains the origin of replication and ampicillin resistance gene (ampr). The sequences of the polylinkers of the two plasmids are shown below, along with the relevant restriction sites. All of the restriction sites listed, with the exceptions of the PstI site in pDH87 and the HpaI site in pDH88, are unique in each plasmid.
[20]
INDUCIBLE EXPRESSION OF REGULATORY GENES
225
Placing Bacillus subtilis spoOA G e n e u n d e r Inducible Control The B. subtilis spoOA gene is essential for sporulation, and mutations at this locus block sporulation at a very early stage) An approximately 210-bp fragment of the spoOA gene was isolated and ligated behind the spac-I promoter in the polylinker. This fragment contains about 30 nucleotides preceding the spoOA initiation codon, which includes the natural ribosome binding site, and extends through the first 62 of the 267 codons of the gene.6 The fragment does not contain the spoOA promoter. The plasmid carrying the spoOA fragment was designated pDH86. As shown in Fig. 2, integration by a crossover event within the spoOA gene fragment on the plasmid results in a truncated copy of the spoOA gene behind the natural spoOA promoter, and a complete copy of the gene behind the spac-1 promoter. A point of caution must be raised, the copy number of the integrated plasmid can be higher than one, especially if higher levels of chloramphenicol are used. In such cases, the spac-1 promoter would also drive the expression of the truncated protein. There is always a possibility that the truncated protein could have an unanticipated effect. Transformation of Bacillus subtilis with Integrative Plasmids 1. Grow the recipient strain overnight at 30 ° on a TBAB (tryptose, blood, agar base; Difco, Detroit, MI) plate. 2. Resuspend cells from the overnight plate into stage 1 medium at an OD6oo of approximately 0.1. Incubate with good aeration at 37 ° for 4 5 hr. 3. Add 0. l ml of the stage l culture to 0.9 ml of stage 2 medium containing 5/A of the appropriate plasmid from any standard miniprep protocol or approximately 0.5/~g of DNA. 4. Continue incubation at 37 ° for 60-90 rain. 5. Plate 0.1-ml aliquots on TBAB plates supplemented with chloramphenicol at 5 #g/ml. 6. Streak individual transformants for single colonies on TBAB plates supplemented with chloramphenicol at 5 pg/ml. Control of Sporulation by I P T G As shown in Table I, a strain carrying pDH86 now shows isopropyl-~D-thiogalactopyranoside (IPTG)-inducible sporulation. At the highest IPTG concentration, the sporulation frequency of the 168/pDH86 is indistinguishable from its parent. Intermediate levels of IPTG give intermediate s j. A. Hoch,Adv. Genet. 18, 69 (1976). 6 F. A. Ferrari, K. Trach, D. LeCoq,J. Spence,E. Ferrari,and J. A. Hoch,Proc. Natl.Acad. Sci. U.S.A.82, 2647 (1985).
EXPRESSION IN B. subtilis
226
[20]
pDH86 • o spo0A,
p
spo0a
I
spc0A
Pspo0A [ spo0A' • I PpenP lacI1
-cL
/j
I
p spac l
spo0A
[
FIG. 2. Integration of pDH86 by homologous recombination. The plasmid sequenc~ is indicated by solid lines, the chromosomal sequences by dotted lines. The boxes indicate the spoOAand lac/coding regions, and the jagged ends of the spoOA"indicate a truncated copy of the gene. The positions of the promoters are shown by P ~ and P,~oa. The figure is not to
scale. levels of sporulation, and the uninduced cultures have sporulation frequencies six orders of magnitude below that of the fully induced cultures. Even this low level of sporulation indicates some leakiness of the control system, as a strain with a deletion of the spoOA gene can produce no spores at all. A further point to be noted is that the integration event shown in Fig. 1 is a reversible process, and that cells that lose the integrated plasmid would score as SPO+ and chloramphenicol sensitive. Although no such recombinants were seen in this experiment, they can be easily avoided by maintaining selective pressure for chloramphenicol.
Induction Ratio of spac-1 P r o m o t e r The above experiment with the spoOA gene demonstrates that this system can be used to regulate a biological response. The induction ratio of the system cannot be easily determined, since the role of the spoOA gene product in sporulation has not been determined, nor how much of the gene product is necessary for function. To determine the induction ratio, a similar plasmid was constructed using the E. coli lacZ gene. Plasmid pDH90 contains a spoVG'-'lacZ fragment that has the spoVG ribosome binding site and initiation codon, and the first 275 codons of the lacZ gene.
[20]
INDUCIBLE EXPRESSION OF REGULATORY GENES
227
TABLE I INDUCTION OF SPORULATON WITH IPTG oF STRAIN 168/pDH68 Spores/ml ° IPTG [M] 0 5 X 10-s 10-4 5 X 10.-4 10-3
168 1X 7.1 X 8X 5.7 X 7.5 X
108 107 107 107 107
168/pDH86 1X 9.5 X 2.1 X 3.5 X 8X
102 10~ 10+ 107 107
~Cultures were grown in liquid SM medium at 37 ° to late logarithmic phase and then diluted into 5 ml of prewarmed SM medium containing the indicated concentrations of IPTG. After 24 hr at 37 ° with aeration, 0.6 ml of chloroform was added and the tubes were vortexed vigorously for 10 sec. Serial dilutions of the cultures were made in fresh SM medium and aliquots plated on SM plates. After incubation at 37 ° for 36 hr, the plates were scored. None of the 168/pDH86 colonies scored as Spo + was genotypically spoOA+.
A recipient strain that had a single copy of the lacZ gene under the control of the aprE promoter was used. 7 Transformation was carried out as above, and the induction of fl-galactosidase at different concentrations of IPTG was determined as shown in Table II. The induction ratio for the system was at least 200-fold. Since the parent strain BG125 has a small background level of fl-galactosidase activity, the induction ratio of 200 is a minimal estimate of the true induction ratio of the lacZ gene. Media
10X MG (minimal glucose) salts: Add per 100 ml: 14 g of K2HPO 4, 6 g of KH2PO4, 2 g of (NH4)2SO4, and I g of Na3C6HsO7.2H20 (trisodium citrate) Stage 1 transformation medium: 1)< MG salts, 2.5 mM MgSO4, 0.5% (w/v) glucose, 5 X 10-3 mM FeC13, 2 × 10-2 mM MnCI2, 0.02% (w/v) casamino acids, 0.02% (w/v) yeast extract, 50 #g of required amino acids per milliliter, and 10/zg of required bases per milliliter 7 E. Ferrari, D. J. Henner, M. Perego, and J. A. Hoch, J. Bacteriol. 170, 289 (1988).
EXPRESSION IN B. subtilis
228
[20]
TABLE II IPTG INDUCTIONOFfl-GALACTOSIDASE fl-Galactosidase (units/mgP IPTG [M]
BG 125
pDH90A
pDH90B
10-3 10-4 10-s 0
0.4 ND ND 0.4
118 27 0.4 0.3
102 20 0.5 0.5
~Cultures of BGI25 (trpC2, hisAl, thr-5) or BG4089/pDH90 (trpC2, hisA 1, thr-5, amyE::[ermC, aprE'-'lacZ]) were grown at 37* in 2YT medium to the late logarithmic phase of growth and diluted to an OD~o of approximately 0.1 in the same medium containing the indicated concentrations of IPTG. The cultures were grown at 37" with aeration until an OD~o of 1.5. Samples were harvested in triplicate for the determination of fl-galactosidase activity and the values shown are the averages of these determinations. The pDH90A and pDH90B are two independent transformants of plasmid pDH90 into strain BG4089.
Stage 2 transformation medium: I X M G salts, 5.0 m M MgSO4, 0.5% glucose, 5 × 10 -3 m M FeCI3, 2 X 10-2 m M MnCI2, 0.01% casa m i n o acids, and 10/~g o f required a m i n o acids or bases per milliliter S M (Schaeffer's medium): A d d per liter: 8 g o f nutrient broth, 1 g, o f KC1, 0.125 g o f MgSO4, p H to 7 and autoclave. Add 1 m l per liter: 1 mMFe2(SO4)3, 1 M N a 2 S O 4 , and 10 mMMnC12 2YT medium: Add per liter: 16 g o f t r y p t o n e , 10 g o f yeast extract, a n d 5 g o f NaCI
Acknowledgments I would liketo acknowledge Alan Grossman, who firstused an integrativeplasmid in an identicalfashion as described here for controlledexpression of the B. subtilisspoOH genc and shared his dam prior to itspublication.Plasmid p D H 8 7 described here isidenticalto plasmid p A G 5 8 cons~uctcd by him. I would also like to thank Jim Hoch for analyzing the sporulalion of 168/pDH86.
INDUCIBLE EXPRESSION OF REGULATORY GENES
223
Acknowledgments I thank Mark Guyer, Stephen Fahnestock, Charles Saunders, and Ethel N. Jackson for critical discussions during the course of this work and Leo Thompson for the construction of aDr-spa. This work was performed at Gene× Corporation, Gaithersburg MD 20877.
[20] Inducible Expression of Regulatory Bacillus subtilis
G e n e s in
B y DENNIS J. H E N N E R
Introduction The ability to manipulate the expression of a gene of interest easily can be a valuable means to regulate gene expression. In Bacillus subtilis, the homologous recombination of nonreplicative plasmids into the chromosome makes it particularly simple to inactivate genes, to produce gene duplications, and to put any gene under the control of a regulated promoter. By this means, one can study the consequences of the loss of expression of an essential gene, or the inappropriate expression of a gene product. There are many examples of such studies in other organisms. For example, a system devised to put the Escherichia coli signal peptidase under control of the araC promoter was used to show that the signal peptidase was essential for cell viability.~ In yeast, the plasma membrane ATPase was put under the control of a galactose-inducible promoter, and it was shown that the cells were not viable unless inducer was present3 This article describes a very simple system for placing genes under control of an inducible promoter in B. subtilis. Design of Regulatory System As previously described in this volume by Le Grice) the simplest approach to an inducible promoter system in B. subtilis was to import one from E. coll. The hybrid promoter that we constructed, designated spac-1, contains the RNA polymerase recognition site from an early promoter of the B. subtilis phage SPO- 1 and the lac operator.' The lacI gene, encoding the lac repressor, was placed under the control of the Bacillus licheniformis penicillinase transcriptional and translational control signals to ensure expression in B. subtilis. 4 ' R. E. Dalbey and W. Wickner, J. Biol. Chem. 260, 15925 (1985). 2 A. Cid, R. Perona, and R. Serrano, Curr. Genet. 12, 105 (1987). 3 S. F. J. Le Grice, this volume, [18]. 4 D. Yansura and D. J. Henner, Proc. Natl. Acad Sci. U.S.A. 81, 439 (1984).
METHODS IN ENZYMOLOGY, VOL. 185
Copyright© 1990by AcademicPress,Inc. All rightsof reproductionin any formreserved.
224
EXPRESSION IN B. subtilis
120]
Figure 1 shows the structure of the integration plasmids that have been constructed. These plasmids have the pBR322 origin of replication and ampicillin resistance gene. A cat gene derived from plasmid pC194 allows selection for integration in B. subtilis on plates containing chloramphenicol. The polylinkers following the two plasmids provide a variety of sites to allow insertion of DNA fragments. Pspac= I ,a.
a
m
p
polylinker
~
p
/Y pDH87,88
pC194 cat
pDH87 Hindlll
Xbal
5all
Pstl
Sphl
AAGCTTAAGGAGGTGATCTAGAGTCGACCTGCAGGCATGC
pDH88
Hlndlll
Smal
Xbal
Hpal
Bglll
AAGCTTTTCCCGGGTTTCTAGATTTGTTAACTTAGATCT Clal Sphl TTATCGATTTGCATGC
FIG. 1. Structure of plasmids pDH87 and pDH88. The locations of the spac-1 promoter, polylinker, lacI gene, and pC914 cat gene are as shown and are approximately to scale. The rest of the plasmid is derived from pBR322 and contains the origin of replication and ampicillin resistance gene (ampr). The sequences of the polylinkers of the two plasmids are shown below, along with the relevant restriction sites. All of the restriction sites listed, with the exceptions of the PstI site in pDH87 and the HpaI site in pDH88, are unique in each plasmid.
[20]
INDUCIBLE EXPRESSION OF REGULATORY GENES
225
Placing Bacillus subtilis spoOA G e n e u n d e r Inducible Control The B. subtilis spoOA gene is essential for sporulation, and mutations at this locus block sporulation at a very early stage) An approximately 210-bp fragment of the spoOA gene was isolated and ligated behind the spac-I promoter in the polylinker. This fragment contains about 30 nucleotides preceding the spoOA initiation codon, which includes the natural ribosome binding site, and extends through the first 62 of the 267 codons of the gene.6 The fragment does not contain the spoOA promoter. The plasmid carrying the spoOA fragment was designated pDH86. As shown in Fig. 2, integration by a crossover event within the spoOA gene fragment on the plasmid results in a truncated copy of the spoOA gene behind the natural spoOA promoter, and a complete copy of the gene behind the spac-1 promoter. A point of caution must be raised, the copy number of the integrated plasmid can be higher than one, especially if higher levels of chloramphenicol are used. In such cases, the spac-1 promoter would also drive the expression of the truncated protein. There is always a possibility that the truncated protein could have an unanticipated effect. Transformation of Bacillus subtilis with Integrative Plasmids 1. Grow the recipient strain overnight at 30 ° on a TBAB (tryptose, blood, agar base; Difco, Detroit, MI) plate. 2. Resuspend cells from the overnight plate into stage 1 medium at an OD6oo of approximately 0.1. Incubate with good aeration at 37 ° for 4 5 hr. 3. Add 0. l ml of the stage l culture to 0.9 ml of stage 2 medium containing 5/A of the appropriate plasmid from any standard miniprep protocol or approximately 0.5/~g of DNA. 4. Continue incubation at 37 ° for 60-90 rain. 5. Plate 0.1-ml aliquots on TBAB plates supplemented with chloramphenicol at 5 #g/ml. 6. Streak individual transformants for single colonies on TBAB plates supplemented with chloramphenicol at 5 pg/ml. Control of Sporulation by I P T G As shown in Table I, a strain carrying pDH86 now shows isopropyl-~D-thiogalactopyranoside (IPTG)-inducible sporulation. At the highest IPTG concentration, the sporulation frequency of the 168/pDH86 is indistinguishable from its parent. Intermediate levels of IPTG give intermediate s j. A. Hoch,Adv. Genet. 18, 69 (1976). 6 F. A. Ferrari, K. Trach, D. LeCoq,J. Spence,E. Ferrari,and J. A. Hoch,Proc. Natl.Acad. Sci. U.S.A.82, 2647 (1985).
EXPRESSION IN B. subtilis
226
[20]
pDH86 • o spo0A,
p
spo0a
I
spc0A
Pspo0A [ spo0A' • I PpenP lacI1
-cL
/j
I
p spac l
spo0A
[
FIG. 2. Integration of pDH86 by homologous recombination. The plasmid sequenc~ is indicated by solid lines, the chromosomal sequences by dotted lines. The boxes indicate the spoOAand lac/coding regions, and the jagged ends of the spoOA"indicate a truncated copy of the gene. The positions of the promoters are shown by P ~ and P,~oa. The figure is not to
scale. levels of sporulation, and the uninduced cultures have sporulation frequencies six orders of magnitude below that of the fully induced cultures. Even this low level of sporulation indicates some leakiness of the control system, as a strain with a deletion of the spoOA gene can produce no spores at all. A further point to be noted is that the integration event shown in Fig. 1 is a reversible process, and that cells that lose the integrated plasmid would score as SPO+ and chloramphenicol sensitive. Although no such recombinants were seen in this experiment, they can be easily avoided by maintaining selective pressure for chloramphenicol.
Induction Ratio of spac-1 P r o m o t e r The above experiment with the spoOA gene demonstrates that this system can be used to regulate a biological response. The induction ratio of the system cannot be easily determined, since the role of the spoOA gene product in sporulation has not been determined, nor how much of the gene product is necessary for function. To determine the induction ratio, a similar plasmid was constructed using the E. coli lacZ gene. Plasmid pDH90 contains a spoVG'-'lacZ fragment that has the spoVG ribosome binding site and initiation codon, and the first 275 codons of the lacZ gene.
[20]
INDUCIBLE EXPRESSION OF REGULATORY GENES
227
TABLE I INDUCTION OF SPORULATON WITH IPTG oF STRAIN 168/pDH68 Spores/ml ° IPTG [M] 0 5 X 10-s 10-4 5 X 10.-4 10-3
168 1X 7.1 X 8X 5.7 X 7.5 X
108 107 107 107 107
168/pDH86 1X 9.5 X 2.1 X 3.5 X 8X
102 10~ 10+ 107 107
~Cultures were grown in liquid SM medium at 37 ° to late logarithmic phase and then diluted into 5 ml of prewarmed SM medium containing the indicated concentrations of IPTG. After 24 hr at 37 ° with aeration, 0.6 ml of chloroform was added and the tubes were vortexed vigorously for 10 sec. Serial dilutions of the cultures were made in fresh SM medium and aliquots plated on SM plates. After incubation at 37 ° for 36 hr, the plates were scored. None of the 168/pDH86 colonies scored as Spo + was genotypically spoOA+.
A recipient strain that had a single copy of the lacZ gene under the control of the aprE promoter was used. 7 Transformation was carried out as above, and the induction of fl-galactosidase at different concentrations of IPTG was determined as shown in Table II. The induction ratio for the system was at least 200-fold. Since the parent strain BG125 has a small background level of fl-galactosidase activity, the induction ratio of 200 is a minimal estimate of the true induction ratio of the lacZ gene. Media
10X MG (minimal glucose) salts: Add per 100 ml: 14 g of K2HPO 4, 6 g of KH2PO4, 2 g of (NH4)2SO4, and I g of Na3C6HsO7.2H20 (trisodium citrate) Stage 1 transformation medium: 1)< MG salts, 2.5 mM MgSO4, 0.5% (w/v) glucose, 5 X 10-3 mM FeC13, 2 × 10-2 mM MnCI2, 0.02% (w/v) casamino acids, 0.02% (w/v) yeast extract, 50 #g of required amino acids per milliliter, and 10/zg of required bases per milliliter 7 E. Ferrari, D. J. Henner, M. Perego, and J. A. Hoch, J. Bacteriol. 170, 289 (1988).
EXPRESSION IN B. subtilis
228
[20]
TABLE II IPTG INDUCTIONOFfl-GALACTOSIDASE fl-Galactosidase (units/mgP IPTG [M]
BG 125
pDH90A
pDH90B
10-3 10-4 10-s 0
0.4 ND ND 0.4
118 27 0.4 0.3
102 20 0.5 0.5
~Cultures of BGI25 (trpC2, hisAl, thr-5) or BG4089/pDH90 (trpC2, hisA 1, thr-5, amyE::[ermC, aprE'-'lacZ]) were grown at 37* in 2YT medium to the late logarithmic phase of growth and diluted to an OD~o of approximately 0.1 in the same medium containing the indicated concentrations of IPTG. The cultures were grown at 37" with aeration until an OD~o of 1.5. Samples were harvested in triplicate for the determination of fl-galactosidase activity and the values shown are the averages of these determinations. The pDH90A and pDH90B are two independent transformants of plasmid pDH90 into strain BG4089.
Stage 2 transformation medium: I X M G salts, 5.0 m M MgSO4, 0.5% glucose, 5 × 10 -3 m M FeCI3, 2 X 10-2 m M MnCI2, 0.01% casa m i n o acids, and 10/~g o f required a m i n o acids or bases per milliliter S M (Schaeffer's medium): A d d per liter: 8 g o f nutrient broth, 1 g, o f KC1, 0.125 g o f MgSO4, p H to 7 and autoclave. Add 1 m l per liter: 1 mMFe2(SO4)3, 1 M N a 2 S O 4 , and 10 mMMnC12 2YT medium: Add per liter: 16 g o f t r y p t o n e , 10 g o f yeast extract, a n d 5 g o f NaCI
Acknowledgments I would liketo acknowledge Alan Grossman, who firstused an integrativeplasmid in an identicalfashion as described here for controlledexpression of the B. subtilisspoOH genc and shared his dam prior to itspublication.Plasmid p D H 8 7 described here isidenticalto plasmid p A G 5 8 cons~uctcd by him. I would also like to thank Jim Hoch for analyzing the sporulalion of 168/pDH86.
