World J Microbiol Biotechnol DOI 10.1007/s11274-014-1640-1
ORIGINAL PAPER
Induction, resuscitation and quantitative real-time polymerase chain reaction analyses of viable but nonculturable Vibrio vulnificus in artificial sea water Namrata V. Rao • Ravindranath Shashidhar Jayant R. Bandekar
•
Received: 14 November 2013 / Accepted: 16 March 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Vibrio vulnificus, an important food-borne pathogen, is known to enter viable but nonculturable (VBNC) state under low temperature and low nutrition stress conditions. Present study examined the time required for induction of VBNC state and temperature which induces resuscitation of V. vulnificus YJ016. The change in cell morphology and gene expression during VBNC state and in resuscitated cells was also examined. V. vulnificus incubated in artificial sea water at 4 °C entered VBNC state after considerably extended time (70 days). An increase in temperature by 6 °C from the VBNC induction temperature (4 °C) resulted in resuscitation of VBNC cells; however, maximum resuscitation was observed when VBNC cells were held at 23 °C for 24 h. VBNC cells changed their morphology from comma shape to coccoid shape. Two rounds of induction of VBNC and resuscitation were possible with V. vulnificus cells; however, there was progressive reduction in number of resuscitated cells and after 190 days cells failed to resuscitate. Significant up-regulation of genes related to membrane proteins [porinH (10.4-fold), ompU (2.9-fold)], regulatory proteins [envZ (5.6fold), toxR (4.5-fold), toxS (4.8-fold)], oxidative stress related protein katG (2.3-fold), cell division/maintenance proteins [ftsZ (4.3), mreB (6.5-fold)] and resuscitating promoter factor yeaZ (fourfold) was observed during resuscitation with respect to VBNC state indicating that these genes play a role during resuscitation. Gene expression data presented here would enhance our understanding of resuscitation of V. vulnificus from VBNC state. The results also highlight the importance of maintenance of low temperature during storage of seafood. N. V. Rao R. Shashidhar J. R. Bandekar (&) Food Technology Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400085, India e-mail: [email protected]
Keywords Vibrio vulnificus VBNC Gene expression Resuscitation
Introduction Vibrio vulnificus which is found in estuarine and coastal waters is capable of causing septicemia in compromised hosts with underlying liver disease after ingestion of raw and undercooked shellfish. Around 95 % of all seafood-associated fatalities in the United States are caused by V. vulnificus (Nowakowska and Oliver 2013). It enters viable but nonculturable (VBNC) state at low temperature in a nutrient limiting medium (Wolf and Oliver 1992) and these VBNC cells retain viability and cause infection (Smith and Oliver 2006). The VBNC cells exhibit various modifications, which include changes in cell size, proteome alterations, and changes in the membrane fatty acid composition, decreased macromolecular synthesis and respiration rates (Oliver 2000; Chen et al. 2009). Even though there are several reports on the VBNC state in bacteria, the existence of VBNC state has still been debated for many years (Coutard et al. 2007; Barcina and Arana 2009). Several arguments state that the appearance of colonies after temperature upshift is due to regrowth of a few culturable cells instead of true resuscitation. However, some studies employed extensive diluted populations of VBNC cells in which it was unlikely for any culturable cells to be present which could subsequently regrow (Whitesides and Oliver 1997). This VBNC state of pathogens raises serious questions about the interpretation of routine water and food testing when these cells are not detectable. Furthermore, knowledge of change in storage temperature that could lead to resuscitation of VBNC cells can be useful in designing of microbial quality testing of food samples.
123
World J Microbiol Biotechnol
A few studies have been reported on the molecular aspects of VBNC state using reverse transcription PCR and comparative transcriptome analysis. Transcriptome studies on V. vulnificus cells in VBNC state showed increased gene expression of fliG, flaC, DNA polymerase B, ABC transporter and fadL-3 genes and these genes were described as viability markers (Asakura et al. 2007). Significant up-regulation of DNA polymerase II, fliG, ABC transporter, relA and flaC genes using the quantitative real-time analyses was observed in VBNC V. cholerae (Mishra et al. 2012). Expression of cytotoxin-haemolysin virulence gene (vvhA), rpoS, tufA, wza and wzb and relA have been demonstrated in VBNC V. vulnificus cells (Saux et al. 2002; Smith and Oliver 2006; Nowakowska and Oliver 2013). The induction of VBNC state and resuscitation has been demonstrated previously in V. vulnificus (Jiang and Chai 1996; Whitesides and Oliver 1997; Wong et al. 2004; Mishra et al. 2012); however, the effect of incubation temperature on resuscitation has not been studied extensively. Therefore, time taken for the entry into VBNC state was determined and the effect of increase in temperature on resuscitation was studied. The effect of repeated induction and resuscitation on V. vulnificus was also examined in an attempt to determine whether cells were capable of responding to more than one cycle of temperature up- and downshift. The expression of genes involved in cell division, outer membrane porin genes, genes encoding resuscitation promoting factor and periplasmic catalase during induction into and resuscitation from VBNC state was also studied by RT-qPCR.
Materials and methods Induction of VBNC state Vibrio vulnificus YJ016, a kind gift from Lien I Hor (National Cheng-Kung University, Tainan, Taiwan), was used in this study. The genomic information and other characteristics are explained elsewhere (Chen et al. 2003). Culture was stored at -70 °C. V. vulnificus was cultured at 35 °C on tryptic soy agar (TSA) or in tryptic soy broth (TSB, Himedia, India), with a supplement of 3 % NaCl (w/v). Microcosms were prepared by filtering artificial sea water (ASW) (g l-1 distilled water containing NaCl, 24.7; KCl, 0.67; CaCl2H2O, 1.36; MgCl26H2O, 4.66; MgSO47H2O, 6.29; NaHCO3, 0.18) through 0.22 lm pore size filter and used as starvation medium. Overnight grown V. vulnificus was inoculated into TSB ? 3 % NaCl and kept on shaker incubator (150 rpm). After 2 h of incubation, exponential phase cells were harvested by centrifugation at 10,0009g for 10 min at 4 °C and washed twice with ASW to remove nutrients. Cells were re-suspended in the sterile ASW at a final density of 108 cells ml-1 and maintained at
123
4 °C without shaking to induce VBNC state. The cell survival in ASW microcosm was evaluated at different time intervals by plating on TSA ? 3 % NaCl and incubating at 35 °C for 24 h. Validation of VBNC state Validation of VBNC state was carried out as described by Nilsson et al. (1991). In brief, one ml of VBNC state cell suspension (70 days of incubation in ASW at 4 °C) was plated on TSA ? 3 % NaCl and incubated for 24 h at 35 °C. When no colonies were found in 1 ml microcosm, 10 ml was filtered through a 0.22 lm pore size membrane filter, and filter was placed on TSA ? 3 % NaCl and incubated at 35 °C. The bacterial cells were considered to be in VBNC state when growth was not observed from 10 ml concentrate (\0.1 CFU ml-1). The VBNC cells were also confirmed by using Live and Dead BacLightTM detection kit according to manufactures instructions (Molecular probes, Invitrogen, USA) and observing under an epifluorescent microscope (Axiolab, Carl zeiss, Jena, Germany). Resuscitation from VBNC state Resuscitation was carried out by incubating 1 ml of VBNC state cell suspension (70 days of incubation in ASW at 4 °C) at room temperature (30 °C) for 24 h. Appropriate dilutions of resuscitated cells were plated on TSA ? 3 % NaCl agar. As control, 1 ml of VBNC state cell suspension without resuscitation was plated on TSA ? 3 % NaCl agar and also inoculated in TSB ? 3 % NaCl and incubated at 35 °C for 24 h. Resuscitation was considered only when growth was observed after resuscitation and no growth was observed in the control. Similar resuscitation experiments were also carried out to evaluate optimum resuscitation temperature by taking 1 ml aliquots from the microcosms and incubating at 8, 10, 15, 20, 23, 30 and 37 °C for 24 h. Morphological changes of V. vulnificus during entry into VBNC state The morphological changes in the size and shape of cells were monitored by SEM analysis during the incubation of cells. Specimens were mounted on stubs and bacteria were visualized by a Quanta 200 FEI scanning electron microscope in a low vacuum mode using the large field detector. Repeated induction and resuscitation of V. vulnificus cells Cells in VBNC state were kept for resuscitation at 30 °C for 24 h. These resuscitated cells were again kept at 4 °C
World J Microbiol Biotechnol
for VBNC induction. This cycle was repeated thrice. Dilutions were performed in ASW and plating was performed during each induction and resuscitation step on TSA ? 3 % NaCl at regular intervals to determine culturability. RNA isolation, cDNA preparation and primer design Total RNA was extracted from cultures using Triazol method (Tri-ReagentÒRT, Molecular Research Center Inc., Cincinnati, USA) according to manufacturer’s instructions. Thirty ml of control cells and cells in VBNC and resuscitated state were transferred to centrifuge tubes and centrifuged at 10,0009g for 5 min. Cells were lysed in TE buffer containing lysozyme and by liquid nitrogen freeze thawing. One ml Tri reagent was added to the sample and the mixture was centrifuged (10,0009g, 10 min, 4 °C). The supernatant was removed and treated with 300 ll chloroform to extract the RNA. The sample was vortexed and centrifuged again (10,0009g, 10 min, and 4 °C). The upper aqueous phase was mixed with equal volumes of isopropanol and the samples were centrifuged (12,5009g, 15 min, 4 °C). The RNA pellet was washed twice with 800 ll of chilled 70 % ethanol, air-dried and RNA resuspended in RNase free water. Samples were stored at -80 °C until use. RNA quantity and quality was measured at wavelength of 260 and 280 nm using spectrophotometer (Eppendorf, Germany). RNA quality was also tested by agarose gel electrophoresis. The RNA samples were treated with RNase free DNase I (Invitrogen, Carlsbad, CA, USA) to remove contaminating genomic DNA. DNase treated samples were tested by performing real-time PCR run to ensure removal of genomic DNA. About 1 lg DNase treated RNA was subjected to reverse transcription using DyNAmoTM cDNA synthesis kit (Finnzymes, Espoo, Finland) following the supplier’s directions. After cDNA was synthesized, cDNA was quantified by spectrophotometer and equal amount was taken in all control and test samples for analysis. The gene specific primers for genes involved in cell division and outer membrane porin genes (Table 1) were designed using integrated DNA technologies Primer Quest software (http://www.idtdna.com). The amplicon sizes ranged between 80 and 200 base pairs. The primers with melting temperatures of 60 °C (±2 °C) were designed. Primers were obtained from Metabion International (Germany).
Table 1 The primer sequences used for real-time PCR analysis of V. vulnificus cells in VBNC and resuscitated state Gene
Sequence 50 ? 30
16S rRNA/F
AGGTGTAGCGGTGAAATGCGTAGA
16S rRNA/R
AAGGCCACAACCTCCAAGTAGACA
envZ/F
CACGAATTCGCCTTGCGACTGAAA
envZ/R
TCGACCTCGGTGAAACTTTGCGTA
toxR/F
ATGCTGGCACGTCAACAAAGATGG
toxR/R
TGGTGAGCAAGACAACGCAAAGTG
toxS/F toxS/R
TTTGGCTGCATCGGCTGTGTTTAG AGTGGTCCGACGGAACCTTCATTT
ompU/F
TAGGTGGCAAGTTCGGTGAAGTGA
ompU/R
GCTAAGTGCGTCGAATTGGCCTTT
katG/F
ACCTCATCAGCATTCCAGTGACCA
katG/R
GCGCAACCCAGAATAGCCAAAGTT
yeaZ/F
ATTCTGAGCTGGGTAAGCCAAGGT
yeaZ/R
AATTGCAGAGCGATGAACAGCACC
porinH/F
GCGGTCTTGCACTGCTTGATTTGA
porinH/R
AGAAACGGAAACCTCGCTCTGGAT
ftsZ/F
TCGCGATTTCTACCGCAGACTTCA
ftsZ/R
TTTGGTTAACGAACTTCGCACCGC
mreB/F
TAACGGTCTCACTGGCAGCAGAAA
mreB/R
AAACCAAGACCCTGTCGGTCAAGA
consisting of denaturation at 95 °C for 10 s and annealing and extension at 56 °C for 10 s and at 72 °C for 20 s, respectively. Two microliters of the template was amplified in a 20 ll reaction volume containing primers at a final concentration of 0.5 lM, 10 ll of 2X DyNAmo Flash SYBR Green Master Mix and water. Relative ratios of the target gene transcript of cells that were adapted for 30 min in hyper- and hypoosmotic stress as compared with those of optimum condition were calculated according to Pfaffl method using 16S rRNA levels as the reference (Pfaffl 2001). The relative expression ratios were calculated using the REST-MCS version 2 software (http://www.genequantification.de/rest-mcs.html). RT-qPCR was performed with three biological and with three technical replicates. Only genes with a relative signal log2 ratio value above 1.0 or below -1.0 were considered significant.
Results Induction of VBNC state in V. vulnificus
Quantitative PCR conditions The RT-qPCR was performed using amplification master cyclerRep realplex (Eppendorf, Germany) and DyNAmoTM Flash SYBR GreenÒ qPCR Kit (Finnzymes, Espoo, Finland) at 94 °C for 10 min, followed by 40 cycles
After 70 days of incubation at 4 °C in ASW, no V. vulnificus YJ016 cells were culturable (Fig. 1) and were assumed to be in VBNC state. Cells from 10 ml ASW microcosm could not form any colonies which confirmed their VBNC state. The VBNC cells were also confirmed by
123
CFU/ml
World J Microbiol Biotechnol
10
9
10
8
10
7
10
6
10
5
10
4
10
3
10
2
10
1
10
0
0
10
20
30
40
50
60
70
80
Days
Fig. 1 Induction of VBNC state in V. vulnificus. VBNC state was induced by incubating V. vulnificus cells at 4 °C in ASW. Decline in culturability of V. vulnificus during incubation at 4 °C on TSA ? 3 % NaCl. Populations were classified as nonculturable when plate counts were \0.1 CFU ml-1. Experiments were performed in triplicates and the data represents average (±s.d.)
Fig. 2 Temperature dependent resuscitation of VBNC V. vulnificus cells. Resuscitation of VBNC cells at 8, 10, 15, 20, 23, 30 and 37 °C after incubating aliquots for 24 h. Colonies were counted on TSA ? 3 % NaCl. The data represent the average of three biological experiments (±s.d.)
10
Live and Dead BacLightTM detection kit, where most of the cells were stained green indicating that they were alive however, were unable to form colonies on TSA (data not shown).
10 10
Resuscitation is dependent on temperature and duration of incubation
cfu/ml
10 10 10
Resuscitation was observed even when VBNC cells were held at 10 °C in ASW (Fig. 2). Maximum resuscitation was seen at 23 °C (6 log increase) and the extent of resuscitation was same beyond this temperature (30 and 37 °C) (Fig. 2). Two log reduction in cell number was observed after resuscitation of VBNC V. vulnificus cells as compared to the initial cell number (108 CFU ml-1) (Fig. 3). When the resuscitated cells were incubated again at 4 °C in ASW, they entered VBNC state after further 70 days of incubation. During the second round of resuscitation, a five log decrease in cell number as compared to the initial cell number (108 CFU ml-1) was observed (Fig. 3). There was no increase in resuscitated cell number even after incubation of microcosm for further 4 days. Two cycles of resuscitation was possible before the cells became dead after 190 days. Morphological changes in VBNC state The morphology of V. vulnificus changed from curved rod to coccoidal shape in VBNC state (Fig. 4). The resuscitated cells also remained coccoidal (Fig. 4). Curved rods were
123
10 10 10
8
7
6
5
4
3
2
1
0
0
50
100
150
200
Days
Fig. 3 Pattern of induction and resuscitation of VBNC cells. Repeated induction and resuscitation of V. vulnificus was carried out. Cells in the VBNC state were kept for resuscitation at 30 °C for 24 h. Induction of VBNC state of these resuscitated cells was done by incubating the flasks again at 4 °C. The cycle was repeated twice. The number of culturable cells was counted on TSA ? 3 % NaCl. Experiment was performed twice and one representative graph is shown
seen only when resuscitated V. vulnificus cells were further grown in a rich medium (TSB ? 3 % NaCl). The cells from colonies formed from the resuscitated cells also showed original curved rod shape. SEM analysis also confirmed that prolonged incubation in the microcosms was associated with rounding and clumping of cells (Fig. 4).
World J Microbiol Biotechnol
Fig. 4 Scanning electron micrograph of V. vulnificus. The morphological changes observed in V. vulnificus cells during incubation under starvation and temperature stress conditions. Control cells were
seen as curved rods (a). Rounding of cells was observed for cells in the VBNC state (b). Clumping of cells was observed upon resuscitation in ASW at 30 °C (c)
Gene expression during entry into and resuscitation from VBNC state
2007); while, VBNC state was induced in 109 CFU ml-1 of exponential phase V. vulnificus NCIMB 2046 in 21 days (Johnston and Brown 2002). Exponential phase cells (106 CFU ml-1) of V. vulnificus F7472 required 35 days to enter VBNC state (Vora et al. 2005). Induction of VBNC state in 107 CFU ml-1 stationary phase V. vulnificus cells required 40 days of incubation (Wolf and Oliver 1992). Therefore, it seems that the time required to induce VBNC state in V. vulnificus varies widely and the variation in the time may be attributed to various factors like strain used, initial cell number, growth phase of cells, VBNC induction medium, cell washing, conditions of incubation. A comparative study using a number of V. vulnificus strains may be helpful in understanding the strain to strain variation in induction times. Resuscitation or ability of cells to form colonies on plate is considered as the final proof of viability (Pinto et al. 2013). The resuscitation of VBNC cells was performed by temperature upshift on 71st day of incubation. Resuscitation was previously reported at 26 °C for V. alginolyticus (Du et al. 2007), at 20 °C for V. vulnificus (Johnston and Brown 2002) and at 37 °C for V. parahaemolyticus (Coutard et al. 2007); however, these resuscitation studies did not check lower temperature at which resuscitation was possible. Our study is the first report which shows that resuscitation of few cells is possible even at 10 °C (Fig. 2). This further indicates that the storage temperature of seafood should be less than 10 °C. Excessive nutrients inhibit resuscitation of VBNC cells due to the presence of harmful radicals in the medium (Kong et al. 2004). Increase in temperature without providing nutrients might allow the synthesis of protective enzymes like catalase and super oxide dismutase and protect the recovering cells from the adverse effect of increased metabolic activity (Kong et al. 2004). The temperature upshift may trigger expression of genes that are
Expression of envZ, toxR, toxS, porinH, ompU, mreB, yeaZ and katG genes was significantly down-regulated (P \ 0.05) in VBNC cells (day 70) as compared to day zero cells (Fig. 5a). The expression of envZ (5.6-fold), toxR (4.5-fold), toxS (4.8-fold), porinH (10.4-fold), ompU (2.9fold), mreB (6.5-fold), ftsZ (4.3), yeaZ (fourfold) and katG (2.3-fold) in resuscitated cells was significantly up-regulated (P \ 0.05) as compared to the expression in VBNC cells (Fig. 5b). Expression of envZ, toxR, toxS, ompU, mreB, ftsZ, yeaZ and katG genes in resuscitated state was down-regulated (P \ 0.05) in comparison with day zero cells; however the expression of the gene encoding porin like protein H precursor showed 6.4-fold induction (Fig. 5c).
Discussion The VBNC state in bacteria represents a survival strategy in stress conditions. The aim of this study was to comprehensively understand VBNC and resuscitated state of V. vulnificus by maintaining the cells in artificial sea water at 4 °C. The time for the induction of VBNC state in V. vulnificus YJ016 observed in our study was much longer (70 days) (Fig. 1) than that reported in other studies. Saux et al. (2002) demonstrated that the time required for the induction of VBNC state in 106 CFU ml-1 exponential phase V. vulnificus C7184 cells was as early as 72 h; whereas, 106 CFU ml-1 exponential phase environmental isolates of V. vulnificus IFVv10 and IFVv18, entered VBNC state after 14 and 6 days, respectively. VBNC state induction in 108 CFU ml-1 of exponential phase V. vulnificus ATCC 27562 was observed after 18 days (Abe et al.
123
World J Microbiol Biotechnol
Expression ratio (2-log scale)
A
Expression ratio (2-log scale)
B
porin H envZ
ftsZ mreB katG yeaZ
toxR ompU toxS porin H envZ
ftsZ mreB katG yeaZ
toxR ompU toxS 0 -2 -4 -6 -8 -10 -12 -14
14 12 10 8 6 4 2 0
Expressionratio (2-log scale)
C
10 8 6 4 2 0 -2 -4 -6 -8 -10 toxR ompU toxS porin envZ
ftsZ mreB katG yeaZ
H
Fig. 5 Quantitative real time PCR analysis in V. vulnificus. a expression of genes in VBNC with respect to day 0 cells; b expression of genes in resuscitated cells in comparison with VBNC cells and c expression of genes resuscitated cells in comparison to day 0 cells. Data are presented as fold changes in log2 scale ratio with standard deviation as compared to that of respective control. Relative quantification of all real-time PCR results was normalized to that of 16S rRNA. The data represent the average of three biological and three technical replicates (±s.d.). The differences in the mean were found to be statistically significant at P \ 0.05 in the one way ANOVA test
necessary for the cells to resuscitate and form culturable colonies (Kong et al. 2004). Our observation of progressive decrease in the cell numbers during two cycles of induction into and resuscitation from VBNC state (Fig. 3) was different than that reported by Nilsson et al. (1991). They reported that there was no decrease in cell number during two cycles of induction into and resuscitation from VBNC state (Nilsson
123
et al. 1991). This dissimilarity may be attributed to different strains used and experimental protocol followed. The SEM images revealed that cells in VBNC state cells were coccoid and resuscitated cells were also in coccoid clusters (Fig. 4). The possible explanation could be that the cells were resuscitated in ASW, which does not have any nutrients; therefore, the cells could not revert back to original morphology. Change into coccoidal morphology is in agreement with the results reported for Campylobacter jejuni (Jang et al. 2007), V. alginolyitcus (Albertini et al. 2006) and V. cholera (Chaiyanan et al. 2007). A change in morphology and reduction in size have been proposed to be survival strategy of bacteria under starvation condition to minimize cell maintenance requirements (Jiang and Chai 1996). Though the expression of envZ, toxR, toxS, porinH, ompU, mreB, yeaZ and katG was down-regulated in VBNC cells of V. vulnificus (Fig. 5a), there was a low level expression of these genes including the pathogenicity regulators toxR/toxS (Fig. 5a). This result indicates that, V. vulnificus cells may retain pathogenicity during VBNC state. Oliver and Bockian (1995) have also demonstrated virulence using experimental VBNC Vibrio spp. cells in animal infections. Colwell et al. (1996) reported that VBNC V. cholerae cells retained virulence when tested in rabbit ligated ileal loop assays and could cause disease when fed to human volunteers. VBNC state is characterized by cell dwarfing and decreased nucleic acid content with cells undergoing reductive division. Also, the incubation of cells in nutrient starvation medium at low temperature may explain the low level gene expression in VBNC state in comparison to actively metabolizing cells. Up-regulation of these genes in resuscitated cells compared to VBNC cells indicates that they play significant role and that their expression is necessary for resuscitation from VBNC state. EnvZ, an osmolarity sensor protein, directs OmpR to modulate transcription of many genes such as outer membrane porins OmpF and OmpC. Protein corresponding to OmpF of E. coli is OmpU in V. cholera (Xu et al. 2004). ToxR is a transmembrane transcription activator that senses changes in the environment and ToxS is a transmembrane regulatory protein. The gene toxR is a major regulator of pathogenicity in Vibrio species and it also positively regulates the expression of ompU (Crawford et al. 1998; Beaubrun et al. 2008). Expression of porinH and ompU genes were found to be up-regulated. These proteins are known to be involved in passive diffusion of small molecules into the cell under nutrient starvation conditions. Expression of porins has also been linked to changes in cell size, an important parameter related to bacterial dormancy (Darcan et al. 2009). Genes mreB and ftsZ encode for the cytoskeletal proteins MreB and FtsZ. FtsZ polymerizes to form the Z-ring that governs cell
World J Microbiol Biotechnol
division during formation of septum in bacteria. Chen et al. (2009) demonstrated that MreB assembled into the helical filaments underneath the cell membrane of bacteria and is implicated in morphogenesis, cell polarity, chromosome segregation and sporulation, a reasonable amount of these cytoskeletal proteins, especially FtsZ protein, was probably required by V. parahaemolyticus under carbon starvation for the preparation of reductive cell division. Expression of these genes is necessary for change into coccoid form and reductive cell division. Periplasmic catalase encoding gene (katG) was up-regulated in cells after temperature upshift. During resuscitation after temperature upshift, the increased expression of katG might allow the cells to form colonies on solid media. Oliver (2010)showed that katG mutant of V. vulnificus was nonculturable on solid media even at room temperature. They found that low temperature prevents both catalase activity and its de novo synthesis, rendering cells highly sensitive to peroxide present in culture media. yeaZ, which encodes for the putative resuscitation promoting factor (rpf), has been identified in both non-spore forming gram-positive and gram-negative bacteria (Aydin et al. 2011). The yeaZ gene was found to be up-regulated (fourfolds) indicating its important role in resuscitation of V. vulnificus VBNC cells. This is the first report that shows increase in expression of yeaZ during resuscitation of V. vulnificus from VBNC state. Studies in E. coli and Salmonella enterica serovar Typhimurium have shown that the yeaZ expression is essential for bacterial survival (Nichols et al. 2006; Handford et al. 2009). The low level gene expression in resuscitated state in comparison to actively metabolizing cells may be due to extended nutrient and cold stress.
Conclusion Vibrio vulnificus YJ016 took significantly long time (70 days) to enter VBNC state and these cells survived for 190 days after two cycles of induction into and resuscitation from VBNC state. It is necessary to avoid temperature abuse during storage and marketing of seafood since an increase in temperature to 10 °C can result in resuscitation and growth of V. vulnificus. This species utilized several mechanisms including change in morphology and modulated gene expression to protect itself from starvation and cold stress. During VBNC state, the overall metabolism is very low and expression of number of genes involved in synthesis of membrane proteins (ompU, porinH), regulatory proteins (envZ, toxR, toxS), oxidative stress related protein (katG), cell division/maintanance proteins (ftsZ and mreB) and resuscitation promoting factor (yeaZ) were down-regulated; whereas, during resuscitation, all these genes are up-regulated by 2 to 10 folds, indicating their
role in resuscitation. The increased expression of yeaZ suggests that this gene plays an important role in resuscitation of V. vulnificus from VBNC state. Over expression of cytoskeletal genes mreB and ftsZ may be associated with cell division and alteration of the morphology during cold and starvation conditions. The study on gene expression is an important contribution to our understanding of the VBNC state. Acknowledgments We thank professor Lien-I Hor, Department of Microbiology and Immunology, National Cheng-Kung University, for generously providing V. vulnificus YJ016. We acknowledge ICON Analytical Equipments Pvt. Ltd., Worli, Mumbai for carrying out SEM observations of the samples.
References Abe A, Ohashi E, Ren H, Hayashi T, Endo H (2007) Isolation and characterization of a cold-induced nonculturable suppression mutant of Vibrio vulnificus. Microbiol Res 162(2):130–138 Albertini MC, Accorsi A, Teodori L, Pierfelici L, Uguccioni F, Rocchi MB, Burattini S, Citterio B (2006) Use of multiparameter analysis for Vibrio alginolyticus viable but nonculturable state determination. Cytometry A 69(4):260–265 Asakura H, Ishiwa A, Arakawa E, Makino S, Okada Y, Yamamoto S, Igimi S (2007) Gene expression profile of Vibrio cholerae in the cold stress-induced viable but non-culturable state. Environ Microbiol 9(4):869–879 Aydin I, Dimitropoulos A, Chen SH, Thomas C, Roujeinikova A (2011) Purification, crystallization and preliminary X-ray crystallographic analysis of the putative Vibrio parahaemolyticus resuscitation-promoting factor YeaZ. Acta Crystallogr, Sect F: Struct Biol Cryst Commun 67(Pt 5):604–607 Barcina I, Arana I (2009) The viable but nonculturable phenotype: a crossroads in the life-cycle of non-differentiating bacteria? Rev Environ Sci Biotechnol 8(3):245–255 Beaubrun JJ, Kothary MH, Curtis SK, Flores NC, Eribo BE, Tall BD (2008) Isolation and characterization of Vibrio tubiashii outer membrane proteins and determination of a toxR homolog. Appl Environ Microbiol 74(3):907–911 Chaiyanan S, Grim C, Maugel T, Huq A, Colwell RR (2007) Ultrastructure of coccoid viable but non-culturable Vibrio cholerae. Environ Microbiol 9(2):393–402 Chen CY, Wu KM, Chang YC, Chang CH, Tsai HC, Liao TL, Liu YM, Chen HJ, Shen AB, Li JC, Su TL, Shao CP, Lee CT, Hor LI, Tsai SF (2003) Comparative genome analysis of Vibrio vulnificus, a marine pathogen. Genome Res 13(12):2577–2587 Chen SY, Jane WN, Chen YS, Wong HC (2009) Morphological changes of Vibrio parahaemolyticus under cold and starvation stresses. Int J Food Microbiol 129(2):157–165 Colwell RR, Brayton P, Herrington D, Tall B, Huq A, Levine MM (1996) Viable but nonculturable Vibrio cholerae O1 revert to a culturable state in human intestine. World J Microb Biotechnol 12(1):28–31 Coutard F, Lozach S, Pommepuy M, Hervio-Heath D (2007) Realtime reverse transcription-PCR for transcriptional expression analysis of virulence and housekeeping genes in viable but nonculturable Vibrio parahaemolyticus after recovery of culturability. Appl Environ Microbiol 73(16):5183–5189 Crawford JA, Kaper JB, DiRita VJ (1998) Analysis of ToxRdependent transcription activation of ompU, the gene encoding a major envelope protein in Vibrio cholerae. Mol Microbiol 29(1):235–246
123
World J Microbiol Biotechnol Darcan C, Ozkanca R, Idil O, Flint KP (2009) Viable but nonculturable state (VBNC) of Escherichia coli related to EnvZ under the effect of pH, starvation and osmotic stress in sea water. Pol J Microbiol 58(4):307–317 Du M, Chen J, Zhang X, Li A, Li Y (2007) Characterization and resuscitation of viable but nonculturable Vibrio alginolyticus VIB283. Arch Microbiol 188(3):283–288 Handford JI, Ize B, Buchanan G, Butland GP, Greenblatt J, Emili A, Palmer T (2009) Conserved network of proteins essential for bacterial viability. J Bacteriol 191(15):4732–4749 Jang KI, Kim MG, Ha SD, Kim KS, Lee KH, Chung DH, Kim CH, Kim KY (2007) Morphology and adhesion of Campylobacter jejuni to chicken skin under varying conditions. J Microbiol Biotechnol 17(2):202–206 Jiang X, Chai TJ (1996) Survival of Vibrio parahaemolyticus at low temperatures under starvation conditions and subsequent resuscitation of viable, nonculturable cells. Appl Environ Microbiol 62(4):1300–1305 Johnston MD, Brown MH (2002) An investigation into the changed physiological state of Vibrio bacteria as a survival mechanism in response to cold temperatures and studies on their sensitivity to heating and freezing. J Appl Microbiol 92(6):1066–1077 Kong IS, Bates TC, Hu¨lsmann A, Hassan H, Smith BE, Oliver JD (2004) Role of catalase and oxyR in the viable but nonculturable state of Vibrio vulnificus. FEMS Microbiol Ecol 50(3):133–142 Mishra A, Taneja N, Sharma M (2012) Viability kinetics, induction, resuscitation and quantitative real-time polymerase chain reaction analyses of viable but nonculturable Vibrio cholerae O1 in freshwater microcosm. J Appl Microbiol 112(5):945–953 Nichols CE, Johnson C, Lockyer M, Charles IG, Lamb HK, Hawkins AR, Stammers DK (2006) Structural characterization of Salmonella typhimurium YeaZ, an M22 O-sialoglycoprotein endopeptidase homolog. Proteins 64(1):111–123 Nilsson L, Oliver JD, Kjelleberg S (1991) Resuscitation of Vibrio vulnificus from the viable but nonculturable state. J Bacteriol 173(16):5054–5059 Nowakowska J, Oliver JD (2013) Resistance to environmental stresses by Vibrio vulnificus in the viable but nonculturable state. FEMS Microbiol Ecol 84(1):213–222 Oliver JD (2000) Problems in detecting dormant (VBNC) cells and the role of DNA elements in this response. In: Jansson JK, van
123
Elsas JD, Bailey MJ (eds) Tracking genetically-engineered microorganisms. Landes Biosciences, Georgetown, pp 1–15 Oliver JD (2010) Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiol Rev 34(4):415–425 Oliver JD, Bockian R (1995) In vivo resuscitation, and virulence toward mice, of viable but nonculturable cells of Vibrio vulnificus. Appl Environ Microbiol 61(7):2620–2623 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9):e45 Pinto D, Santos MA, Chambel L (2013) Thirty years of viable but nonculturable state research: unsolved molecular mechanisms. Crit Rev Microbiol. doi:10.3109/1040841X.2013.794127 Saux MFL, Hervio-Heath D, Loaec S, Colwell RR, Pommepuy M (2002) Detection of cytotoxin-hemolysin mRNA in nonculturable populations of environmental and clinical Vibrio vulnificus strains in artificial seawater. Appl Environ Microbiol 68(11):5641–5646 Smith B, Oliver JD (2006) In situ and in vitro gene expression by Vibrio vulnificus during entry into, persistence within, and resuscitation from the viable but nonculturable state. Appl Environ Microbiol 72(2):1445–1451 Vora GJ, Meador CE, Bird MM, Bopp CA, Andreadis JD, Stenger DA (2005) Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp. Proc Natl Acad Sci USA 102(52):19109–19114 Whitesides MD, Oliver JD (1997) Resuscitation of Vibrio vulnificus from the viable but nonculturable state. Appl Environ Microbiol 63(3):1002–1005 Wolf P, Oliver JD (1992) Temperature effects on the viable but nonculturable state of Vibrio vulnificus. FEMS Microbiol Ecol 101(1):33–39 Wong HC, Wang P, Chen SY, Chiu SW (2004) Resuscitation of viable but non-culturable Vibrio parahaemolyticus in a minimum salt medium. FEMS Microbiol Lett 233(2):269–275 Xu C, Ren H, Wang S, Peng X (2004) Proteomic analysis of saltsensitive outer membrane proteins of Vibrio parahaemolyticus. Res Microbiol 155(10):835–842
ORIGINAL PAPER
Induction, resuscitation and quantitative real-time polymerase chain reaction analyses of viable but nonculturable Vibrio vulnificus in artificial sea water Namrata V. Rao • Ravindranath Shashidhar Jayant R. Bandekar
•
Received: 14 November 2013 / Accepted: 16 March 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Vibrio vulnificus, an important food-borne pathogen, is known to enter viable but nonculturable (VBNC) state under low temperature and low nutrition stress conditions. Present study examined the time required for induction of VBNC state and temperature which induces resuscitation of V. vulnificus YJ016. The change in cell morphology and gene expression during VBNC state and in resuscitated cells was also examined. V. vulnificus incubated in artificial sea water at 4 °C entered VBNC state after considerably extended time (70 days). An increase in temperature by 6 °C from the VBNC induction temperature (4 °C) resulted in resuscitation of VBNC cells; however, maximum resuscitation was observed when VBNC cells were held at 23 °C for 24 h. VBNC cells changed their morphology from comma shape to coccoid shape. Two rounds of induction of VBNC and resuscitation were possible with V. vulnificus cells; however, there was progressive reduction in number of resuscitated cells and after 190 days cells failed to resuscitate. Significant up-regulation of genes related to membrane proteins [porinH (10.4-fold), ompU (2.9-fold)], regulatory proteins [envZ (5.6fold), toxR (4.5-fold), toxS (4.8-fold)], oxidative stress related protein katG (2.3-fold), cell division/maintenance proteins [ftsZ (4.3), mreB (6.5-fold)] and resuscitating promoter factor yeaZ (fourfold) was observed during resuscitation with respect to VBNC state indicating that these genes play a role during resuscitation. Gene expression data presented here would enhance our understanding of resuscitation of V. vulnificus from VBNC state. The results also highlight the importance of maintenance of low temperature during storage of seafood. N. V. Rao R. Shashidhar J. R. Bandekar (&) Food Technology Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400085, India e-mail: [email protected]
Keywords Vibrio vulnificus VBNC Gene expression Resuscitation
Introduction Vibrio vulnificus which is found in estuarine and coastal waters is capable of causing septicemia in compromised hosts with underlying liver disease after ingestion of raw and undercooked shellfish. Around 95 % of all seafood-associated fatalities in the United States are caused by V. vulnificus (Nowakowska and Oliver 2013). It enters viable but nonculturable (VBNC) state at low temperature in a nutrient limiting medium (Wolf and Oliver 1992) and these VBNC cells retain viability and cause infection (Smith and Oliver 2006). The VBNC cells exhibit various modifications, which include changes in cell size, proteome alterations, and changes in the membrane fatty acid composition, decreased macromolecular synthesis and respiration rates (Oliver 2000; Chen et al. 2009). Even though there are several reports on the VBNC state in bacteria, the existence of VBNC state has still been debated for many years (Coutard et al. 2007; Barcina and Arana 2009). Several arguments state that the appearance of colonies after temperature upshift is due to regrowth of a few culturable cells instead of true resuscitation. However, some studies employed extensive diluted populations of VBNC cells in which it was unlikely for any culturable cells to be present which could subsequently regrow (Whitesides and Oliver 1997). This VBNC state of pathogens raises serious questions about the interpretation of routine water and food testing when these cells are not detectable. Furthermore, knowledge of change in storage temperature that could lead to resuscitation of VBNC cells can be useful in designing of microbial quality testing of food samples.
123
World J Microbiol Biotechnol
A few studies have been reported on the molecular aspects of VBNC state using reverse transcription PCR and comparative transcriptome analysis. Transcriptome studies on V. vulnificus cells in VBNC state showed increased gene expression of fliG, flaC, DNA polymerase B, ABC transporter and fadL-3 genes and these genes were described as viability markers (Asakura et al. 2007). Significant up-regulation of DNA polymerase II, fliG, ABC transporter, relA and flaC genes using the quantitative real-time analyses was observed in VBNC V. cholerae (Mishra et al. 2012). Expression of cytotoxin-haemolysin virulence gene (vvhA), rpoS, tufA, wza and wzb and relA have been demonstrated in VBNC V. vulnificus cells (Saux et al. 2002; Smith and Oliver 2006; Nowakowska and Oliver 2013). The induction of VBNC state and resuscitation has been demonstrated previously in V. vulnificus (Jiang and Chai 1996; Whitesides and Oliver 1997; Wong et al. 2004; Mishra et al. 2012); however, the effect of incubation temperature on resuscitation has not been studied extensively. Therefore, time taken for the entry into VBNC state was determined and the effect of increase in temperature on resuscitation was studied. The effect of repeated induction and resuscitation on V. vulnificus was also examined in an attempt to determine whether cells were capable of responding to more than one cycle of temperature up- and downshift. The expression of genes involved in cell division, outer membrane porin genes, genes encoding resuscitation promoting factor and periplasmic catalase during induction into and resuscitation from VBNC state was also studied by RT-qPCR.
Materials and methods Induction of VBNC state Vibrio vulnificus YJ016, a kind gift from Lien I Hor (National Cheng-Kung University, Tainan, Taiwan), was used in this study. The genomic information and other characteristics are explained elsewhere (Chen et al. 2003). Culture was stored at -70 °C. V. vulnificus was cultured at 35 °C on tryptic soy agar (TSA) or in tryptic soy broth (TSB, Himedia, India), with a supplement of 3 % NaCl (w/v). Microcosms were prepared by filtering artificial sea water (ASW) (g l-1 distilled water containing NaCl, 24.7; KCl, 0.67; CaCl2H2O, 1.36; MgCl26H2O, 4.66; MgSO47H2O, 6.29; NaHCO3, 0.18) through 0.22 lm pore size filter and used as starvation medium. Overnight grown V. vulnificus was inoculated into TSB ? 3 % NaCl and kept on shaker incubator (150 rpm). After 2 h of incubation, exponential phase cells were harvested by centrifugation at 10,0009g for 10 min at 4 °C and washed twice with ASW to remove nutrients. Cells were re-suspended in the sterile ASW at a final density of 108 cells ml-1 and maintained at
123
4 °C without shaking to induce VBNC state. The cell survival in ASW microcosm was evaluated at different time intervals by plating on TSA ? 3 % NaCl and incubating at 35 °C for 24 h. Validation of VBNC state Validation of VBNC state was carried out as described by Nilsson et al. (1991). In brief, one ml of VBNC state cell suspension (70 days of incubation in ASW at 4 °C) was plated on TSA ? 3 % NaCl and incubated for 24 h at 35 °C. When no colonies were found in 1 ml microcosm, 10 ml was filtered through a 0.22 lm pore size membrane filter, and filter was placed on TSA ? 3 % NaCl and incubated at 35 °C. The bacterial cells were considered to be in VBNC state when growth was not observed from 10 ml concentrate (\0.1 CFU ml-1). The VBNC cells were also confirmed by using Live and Dead BacLightTM detection kit according to manufactures instructions (Molecular probes, Invitrogen, USA) and observing under an epifluorescent microscope (Axiolab, Carl zeiss, Jena, Germany). Resuscitation from VBNC state Resuscitation was carried out by incubating 1 ml of VBNC state cell suspension (70 days of incubation in ASW at 4 °C) at room temperature (30 °C) for 24 h. Appropriate dilutions of resuscitated cells were plated on TSA ? 3 % NaCl agar. As control, 1 ml of VBNC state cell suspension without resuscitation was plated on TSA ? 3 % NaCl agar and also inoculated in TSB ? 3 % NaCl and incubated at 35 °C for 24 h. Resuscitation was considered only when growth was observed after resuscitation and no growth was observed in the control. Similar resuscitation experiments were also carried out to evaluate optimum resuscitation temperature by taking 1 ml aliquots from the microcosms and incubating at 8, 10, 15, 20, 23, 30 and 37 °C for 24 h. Morphological changes of V. vulnificus during entry into VBNC state The morphological changes in the size and shape of cells were monitored by SEM analysis during the incubation of cells. Specimens were mounted on stubs and bacteria were visualized by a Quanta 200 FEI scanning electron microscope in a low vacuum mode using the large field detector. Repeated induction and resuscitation of V. vulnificus cells Cells in VBNC state were kept for resuscitation at 30 °C for 24 h. These resuscitated cells were again kept at 4 °C
World J Microbiol Biotechnol
for VBNC induction. This cycle was repeated thrice. Dilutions were performed in ASW and plating was performed during each induction and resuscitation step on TSA ? 3 % NaCl at regular intervals to determine culturability. RNA isolation, cDNA preparation and primer design Total RNA was extracted from cultures using Triazol method (Tri-ReagentÒRT, Molecular Research Center Inc., Cincinnati, USA) according to manufacturer’s instructions. Thirty ml of control cells and cells in VBNC and resuscitated state were transferred to centrifuge tubes and centrifuged at 10,0009g for 5 min. Cells were lysed in TE buffer containing lysozyme and by liquid nitrogen freeze thawing. One ml Tri reagent was added to the sample and the mixture was centrifuged (10,0009g, 10 min, 4 °C). The supernatant was removed and treated with 300 ll chloroform to extract the RNA. The sample was vortexed and centrifuged again (10,0009g, 10 min, and 4 °C). The upper aqueous phase was mixed with equal volumes of isopropanol and the samples were centrifuged (12,5009g, 15 min, 4 °C). The RNA pellet was washed twice with 800 ll of chilled 70 % ethanol, air-dried and RNA resuspended in RNase free water. Samples were stored at -80 °C until use. RNA quantity and quality was measured at wavelength of 260 and 280 nm using spectrophotometer (Eppendorf, Germany). RNA quality was also tested by agarose gel electrophoresis. The RNA samples were treated with RNase free DNase I (Invitrogen, Carlsbad, CA, USA) to remove contaminating genomic DNA. DNase treated samples were tested by performing real-time PCR run to ensure removal of genomic DNA. About 1 lg DNase treated RNA was subjected to reverse transcription using DyNAmoTM cDNA synthesis kit (Finnzymes, Espoo, Finland) following the supplier’s directions. After cDNA was synthesized, cDNA was quantified by spectrophotometer and equal amount was taken in all control and test samples for analysis. The gene specific primers for genes involved in cell division and outer membrane porin genes (Table 1) were designed using integrated DNA technologies Primer Quest software (http://www.idtdna.com). The amplicon sizes ranged between 80 and 200 base pairs. The primers with melting temperatures of 60 °C (±2 °C) were designed. Primers were obtained from Metabion International (Germany).
Table 1 The primer sequences used for real-time PCR analysis of V. vulnificus cells in VBNC and resuscitated state Gene
Sequence 50 ? 30
16S rRNA/F
AGGTGTAGCGGTGAAATGCGTAGA
16S rRNA/R
AAGGCCACAACCTCCAAGTAGACA
envZ/F
CACGAATTCGCCTTGCGACTGAAA
envZ/R
TCGACCTCGGTGAAACTTTGCGTA
toxR/F
ATGCTGGCACGTCAACAAAGATGG
toxR/R
TGGTGAGCAAGACAACGCAAAGTG
toxS/F toxS/R
TTTGGCTGCATCGGCTGTGTTTAG AGTGGTCCGACGGAACCTTCATTT
ompU/F
TAGGTGGCAAGTTCGGTGAAGTGA
ompU/R
GCTAAGTGCGTCGAATTGGCCTTT
katG/F
ACCTCATCAGCATTCCAGTGACCA
katG/R
GCGCAACCCAGAATAGCCAAAGTT
yeaZ/F
ATTCTGAGCTGGGTAAGCCAAGGT
yeaZ/R
AATTGCAGAGCGATGAACAGCACC
porinH/F
GCGGTCTTGCACTGCTTGATTTGA
porinH/R
AGAAACGGAAACCTCGCTCTGGAT
ftsZ/F
TCGCGATTTCTACCGCAGACTTCA
ftsZ/R
TTTGGTTAACGAACTTCGCACCGC
mreB/F
TAACGGTCTCACTGGCAGCAGAAA
mreB/R
AAACCAAGACCCTGTCGGTCAAGA
consisting of denaturation at 95 °C for 10 s and annealing and extension at 56 °C for 10 s and at 72 °C for 20 s, respectively. Two microliters of the template was amplified in a 20 ll reaction volume containing primers at a final concentration of 0.5 lM, 10 ll of 2X DyNAmo Flash SYBR Green Master Mix and water. Relative ratios of the target gene transcript of cells that were adapted for 30 min in hyper- and hypoosmotic stress as compared with those of optimum condition were calculated according to Pfaffl method using 16S rRNA levels as the reference (Pfaffl 2001). The relative expression ratios were calculated using the REST-MCS version 2 software (http://www.genequantification.de/rest-mcs.html). RT-qPCR was performed with three biological and with three technical replicates. Only genes with a relative signal log2 ratio value above 1.0 or below -1.0 were considered significant.
Results Induction of VBNC state in V. vulnificus
Quantitative PCR conditions The RT-qPCR was performed using amplification master cyclerRep realplex (Eppendorf, Germany) and DyNAmoTM Flash SYBR GreenÒ qPCR Kit (Finnzymes, Espoo, Finland) at 94 °C for 10 min, followed by 40 cycles
After 70 days of incubation at 4 °C in ASW, no V. vulnificus YJ016 cells were culturable (Fig. 1) and were assumed to be in VBNC state. Cells from 10 ml ASW microcosm could not form any colonies which confirmed their VBNC state. The VBNC cells were also confirmed by
123
CFU/ml
World J Microbiol Biotechnol
10
9
10
8
10
7
10
6
10
5
10
4
10
3
10
2
10
1
10
0
0
10
20
30
40
50
60
70
80
Days
Fig. 1 Induction of VBNC state in V. vulnificus. VBNC state was induced by incubating V. vulnificus cells at 4 °C in ASW. Decline in culturability of V. vulnificus during incubation at 4 °C on TSA ? 3 % NaCl. Populations were classified as nonculturable when plate counts were \0.1 CFU ml-1. Experiments were performed in triplicates and the data represents average (±s.d.)
Fig. 2 Temperature dependent resuscitation of VBNC V. vulnificus cells. Resuscitation of VBNC cells at 8, 10, 15, 20, 23, 30 and 37 °C after incubating aliquots for 24 h. Colonies were counted on TSA ? 3 % NaCl. The data represent the average of three biological experiments (±s.d.)
10
Live and Dead BacLightTM detection kit, where most of the cells were stained green indicating that they were alive however, were unable to form colonies on TSA (data not shown).
10 10
Resuscitation is dependent on temperature and duration of incubation
cfu/ml
10 10 10
Resuscitation was observed even when VBNC cells were held at 10 °C in ASW (Fig. 2). Maximum resuscitation was seen at 23 °C (6 log increase) and the extent of resuscitation was same beyond this temperature (30 and 37 °C) (Fig. 2). Two log reduction in cell number was observed after resuscitation of VBNC V. vulnificus cells as compared to the initial cell number (108 CFU ml-1) (Fig. 3). When the resuscitated cells were incubated again at 4 °C in ASW, they entered VBNC state after further 70 days of incubation. During the second round of resuscitation, a five log decrease in cell number as compared to the initial cell number (108 CFU ml-1) was observed (Fig. 3). There was no increase in resuscitated cell number even after incubation of microcosm for further 4 days. Two cycles of resuscitation was possible before the cells became dead after 190 days. Morphological changes in VBNC state The morphology of V. vulnificus changed from curved rod to coccoidal shape in VBNC state (Fig. 4). The resuscitated cells also remained coccoidal (Fig. 4). Curved rods were
123
10 10 10
8
7
6
5
4
3
2
1
0
0
50
100
150
200
Days
Fig. 3 Pattern of induction and resuscitation of VBNC cells. Repeated induction and resuscitation of V. vulnificus was carried out. Cells in the VBNC state were kept for resuscitation at 30 °C for 24 h. Induction of VBNC state of these resuscitated cells was done by incubating the flasks again at 4 °C. The cycle was repeated twice. The number of culturable cells was counted on TSA ? 3 % NaCl. Experiment was performed twice and one representative graph is shown
seen only when resuscitated V. vulnificus cells were further grown in a rich medium (TSB ? 3 % NaCl). The cells from colonies formed from the resuscitated cells also showed original curved rod shape. SEM analysis also confirmed that prolonged incubation in the microcosms was associated with rounding and clumping of cells (Fig. 4).
World J Microbiol Biotechnol
Fig. 4 Scanning electron micrograph of V. vulnificus. The morphological changes observed in V. vulnificus cells during incubation under starvation and temperature stress conditions. Control cells were
seen as curved rods (a). Rounding of cells was observed for cells in the VBNC state (b). Clumping of cells was observed upon resuscitation in ASW at 30 °C (c)
Gene expression during entry into and resuscitation from VBNC state
2007); while, VBNC state was induced in 109 CFU ml-1 of exponential phase V. vulnificus NCIMB 2046 in 21 days (Johnston and Brown 2002). Exponential phase cells (106 CFU ml-1) of V. vulnificus F7472 required 35 days to enter VBNC state (Vora et al. 2005). Induction of VBNC state in 107 CFU ml-1 stationary phase V. vulnificus cells required 40 days of incubation (Wolf and Oliver 1992). Therefore, it seems that the time required to induce VBNC state in V. vulnificus varies widely and the variation in the time may be attributed to various factors like strain used, initial cell number, growth phase of cells, VBNC induction medium, cell washing, conditions of incubation. A comparative study using a number of V. vulnificus strains may be helpful in understanding the strain to strain variation in induction times. Resuscitation or ability of cells to form colonies on plate is considered as the final proof of viability (Pinto et al. 2013). The resuscitation of VBNC cells was performed by temperature upshift on 71st day of incubation. Resuscitation was previously reported at 26 °C for V. alginolyticus (Du et al. 2007), at 20 °C for V. vulnificus (Johnston and Brown 2002) and at 37 °C for V. parahaemolyticus (Coutard et al. 2007); however, these resuscitation studies did not check lower temperature at which resuscitation was possible. Our study is the first report which shows that resuscitation of few cells is possible even at 10 °C (Fig. 2). This further indicates that the storage temperature of seafood should be less than 10 °C. Excessive nutrients inhibit resuscitation of VBNC cells due to the presence of harmful radicals in the medium (Kong et al. 2004). Increase in temperature without providing nutrients might allow the synthesis of protective enzymes like catalase and super oxide dismutase and protect the recovering cells from the adverse effect of increased metabolic activity (Kong et al. 2004). The temperature upshift may trigger expression of genes that are
Expression of envZ, toxR, toxS, porinH, ompU, mreB, yeaZ and katG genes was significantly down-regulated (P \ 0.05) in VBNC cells (day 70) as compared to day zero cells (Fig. 5a). The expression of envZ (5.6-fold), toxR (4.5-fold), toxS (4.8-fold), porinH (10.4-fold), ompU (2.9fold), mreB (6.5-fold), ftsZ (4.3), yeaZ (fourfold) and katG (2.3-fold) in resuscitated cells was significantly up-regulated (P \ 0.05) as compared to the expression in VBNC cells (Fig. 5b). Expression of envZ, toxR, toxS, ompU, mreB, ftsZ, yeaZ and katG genes in resuscitated state was down-regulated (P \ 0.05) in comparison with day zero cells; however the expression of the gene encoding porin like protein H precursor showed 6.4-fold induction (Fig. 5c).
Discussion The VBNC state in bacteria represents a survival strategy in stress conditions. The aim of this study was to comprehensively understand VBNC and resuscitated state of V. vulnificus by maintaining the cells in artificial sea water at 4 °C. The time for the induction of VBNC state in V. vulnificus YJ016 observed in our study was much longer (70 days) (Fig. 1) than that reported in other studies. Saux et al. (2002) demonstrated that the time required for the induction of VBNC state in 106 CFU ml-1 exponential phase V. vulnificus C7184 cells was as early as 72 h; whereas, 106 CFU ml-1 exponential phase environmental isolates of V. vulnificus IFVv10 and IFVv18, entered VBNC state after 14 and 6 days, respectively. VBNC state induction in 108 CFU ml-1 of exponential phase V. vulnificus ATCC 27562 was observed after 18 days (Abe et al.
123
World J Microbiol Biotechnol
Expression ratio (2-log scale)
A
Expression ratio (2-log scale)
B
porin H envZ
ftsZ mreB katG yeaZ
toxR ompU toxS porin H envZ
ftsZ mreB katG yeaZ
toxR ompU toxS 0 -2 -4 -6 -8 -10 -12 -14
14 12 10 8 6 4 2 0
Expressionratio (2-log scale)
C
10 8 6 4 2 0 -2 -4 -6 -8 -10 toxR ompU toxS porin envZ
ftsZ mreB katG yeaZ
H
Fig. 5 Quantitative real time PCR analysis in V. vulnificus. a expression of genes in VBNC with respect to day 0 cells; b expression of genes in resuscitated cells in comparison with VBNC cells and c expression of genes resuscitated cells in comparison to day 0 cells. Data are presented as fold changes in log2 scale ratio with standard deviation as compared to that of respective control. Relative quantification of all real-time PCR results was normalized to that of 16S rRNA. The data represent the average of three biological and three technical replicates (±s.d.). The differences in the mean were found to be statistically significant at P \ 0.05 in the one way ANOVA test
necessary for the cells to resuscitate and form culturable colonies (Kong et al. 2004). Our observation of progressive decrease in the cell numbers during two cycles of induction into and resuscitation from VBNC state (Fig. 3) was different than that reported by Nilsson et al. (1991). They reported that there was no decrease in cell number during two cycles of induction into and resuscitation from VBNC state (Nilsson
123
et al. 1991). This dissimilarity may be attributed to different strains used and experimental protocol followed. The SEM images revealed that cells in VBNC state cells were coccoid and resuscitated cells were also in coccoid clusters (Fig. 4). The possible explanation could be that the cells were resuscitated in ASW, which does not have any nutrients; therefore, the cells could not revert back to original morphology. Change into coccoidal morphology is in agreement with the results reported for Campylobacter jejuni (Jang et al. 2007), V. alginolyitcus (Albertini et al. 2006) and V. cholera (Chaiyanan et al. 2007). A change in morphology and reduction in size have been proposed to be survival strategy of bacteria under starvation condition to minimize cell maintenance requirements (Jiang and Chai 1996). Though the expression of envZ, toxR, toxS, porinH, ompU, mreB, yeaZ and katG was down-regulated in VBNC cells of V. vulnificus (Fig. 5a), there was a low level expression of these genes including the pathogenicity regulators toxR/toxS (Fig. 5a). This result indicates that, V. vulnificus cells may retain pathogenicity during VBNC state. Oliver and Bockian (1995) have also demonstrated virulence using experimental VBNC Vibrio spp. cells in animal infections. Colwell et al. (1996) reported that VBNC V. cholerae cells retained virulence when tested in rabbit ligated ileal loop assays and could cause disease when fed to human volunteers. VBNC state is characterized by cell dwarfing and decreased nucleic acid content with cells undergoing reductive division. Also, the incubation of cells in nutrient starvation medium at low temperature may explain the low level gene expression in VBNC state in comparison to actively metabolizing cells. Up-regulation of these genes in resuscitated cells compared to VBNC cells indicates that they play significant role and that their expression is necessary for resuscitation from VBNC state. EnvZ, an osmolarity sensor protein, directs OmpR to modulate transcription of many genes such as outer membrane porins OmpF and OmpC. Protein corresponding to OmpF of E. coli is OmpU in V. cholera (Xu et al. 2004). ToxR is a transmembrane transcription activator that senses changes in the environment and ToxS is a transmembrane regulatory protein. The gene toxR is a major regulator of pathogenicity in Vibrio species and it also positively regulates the expression of ompU (Crawford et al. 1998; Beaubrun et al. 2008). Expression of porinH and ompU genes were found to be up-regulated. These proteins are known to be involved in passive diffusion of small molecules into the cell under nutrient starvation conditions. Expression of porins has also been linked to changes in cell size, an important parameter related to bacterial dormancy (Darcan et al. 2009). Genes mreB and ftsZ encode for the cytoskeletal proteins MreB and FtsZ. FtsZ polymerizes to form the Z-ring that governs cell
World J Microbiol Biotechnol
division during formation of septum in bacteria. Chen et al. (2009) demonstrated that MreB assembled into the helical filaments underneath the cell membrane of bacteria and is implicated in morphogenesis, cell polarity, chromosome segregation and sporulation, a reasonable amount of these cytoskeletal proteins, especially FtsZ protein, was probably required by V. parahaemolyticus under carbon starvation for the preparation of reductive cell division. Expression of these genes is necessary for change into coccoid form and reductive cell division. Periplasmic catalase encoding gene (katG) was up-regulated in cells after temperature upshift. During resuscitation after temperature upshift, the increased expression of katG might allow the cells to form colonies on solid media. Oliver (2010)showed that katG mutant of V. vulnificus was nonculturable on solid media even at room temperature. They found that low temperature prevents both catalase activity and its de novo synthesis, rendering cells highly sensitive to peroxide present in culture media. yeaZ, which encodes for the putative resuscitation promoting factor (rpf), has been identified in both non-spore forming gram-positive and gram-negative bacteria (Aydin et al. 2011). The yeaZ gene was found to be up-regulated (fourfolds) indicating its important role in resuscitation of V. vulnificus VBNC cells. This is the first report that shows increase in expression of yeaZ during resuscitation of V. vulnificus from VBNC state. Studies in E. coli and Salmonella enterica serovar Typhimurium have shown that the yeaZ expression is essential for bacterial survival (Nichols et al. 2006; Handford et al. 2009). The low level gene expression in resuscitated state in comparison to actively metabolizing cells may be due to extended nutrient and cold stress.
Conclusion Vibrio vulnificus YJ016 took significantly long time (70 days) to enter VBNC state and these cells survived for 190 days after two cycles of induction into and resuscitation from VBNC state. It is necessary to avoid temperature abuse during storage and marketing of seafood since an increase in temperature to 10 °C can result in resuscitation and growth of V. vulnificus. This species utilized several mechanisms including change in morphology and modulated gene expression to protect itself from starvation and cold stress. During VBNC state, the overall metabolism is very low and expression of number of genes involved in synthesis of membrane proteins (ompU, porinH), regulatory proteins (envZ, toxR, toxS), oxidative stress related protein (katG), cell division/maintanance proteins (ftsZ and mreB) and resuscitation promoting factor (yeaZ) were down-regulated; whereas, during resuscitation, all these genes are up-regulated by 2 to 10 folds, indicating their
role in resuscitation. The increased expression of yeaZ suggests that this gene plays an important role in resuscitation of V. vulnificus from VBNC state. Over expression of cytoskeletal genes mreB and ftsZ may be associated with cell division and alteration of the morphology during cold and starvation conditions. The study on gene expression is an important contribution to our understanding of the VBNC state. Acknowledgments We thank professor Lien-I Hor, Department of Microbiology and Immunology, National Cheng-Kung University, for generously providing V. vulnificus YJ016. We acknowledge ICON Analytical Equipments Pvt. Ltd., Worli, Mumbai for carrying out SEM observations of the samples.
References Abe A, Ohashi E, Ren H, Hayashi T, Endo H (2007) Isolation and characterization of a cold-induced nonculturable suppression mutant of Vibrio vulnificus. Microbiol Res 162(2):130–138 Albertini MC, Accorsi A, Teodori L, Pierfelici L, Uguccioni F, Rocchi MB, Burattini S, Citterio B (2006) Use of multiparameter analysis for Vibrio alginolyticus viable but nonculturable state determination. Cytometry A 69(4):260–265 Asakura H, Ishiwa A, Arakawa E, Makino S, Okada Y, Yamamoto S, Igimi S (2007) Gene expression profile of Vibrio cholerae in the cold stress-induced viable but non-culturable state. Environ Microbiol 9(4):869–879 Aydin I, Dimitropoulos A, Chen SH, Thomas C, Roujeinikova A (2011) Purification, crystallization and preliminary X-ray crystallographic analysis of the putative Vibrio parahaemolyticus resuscitation-promoting factor YeaZ. Acta Crystallogr, Sect F: Struct Biol Cryst Commun 67(Pt 5):604–607 Barcina I, Arana I (2009) The viable but nonculturable phenotype: a crossroads in the life-cycle of non-differentiating bacteria? Rev Environ Sci Biotechnol 8(3):245–255 Beaubrun JJ, Kothary MH, Curtis SK, Flores NC, Eribo BE, Tall BD (2008) Isolation and characterization of Vibrio tubiashii outer membrane proteins and determination of a toxR homolog. Appl Environ Microbiol 74(3):907–911 Chaiyanan S, Grim C, Maugel T, Huq A, Colwell RR (2007) Ultrastructure of coccoid viable but non-culturable Vibrio cholerae. Environ Microbiol 9(2):393–402 Chen CY, Wu KM, Chang YC, Chang CH, Tsai HC, Liao TL, Liu YM, Chen HJ, Shen AB, Li JC, Su TL, Shao CP, Lee CT, Hor LI, Tsai SF (2003) Comparative genome analysis of Vibrio vulnificus, a marine pathogen. Genome Res 13(12):2577–2587 Chen SY, Jane WN, Chen YS, Wong HC (2009) Morphological changes of Vibrio parahaemolyticus under cold and starvation stresses. Int J Food Microbiol 129(2):157–165 Colwell RR, Brayton P, Herrington D, Tall B, Huq A, Levine MM (1996) Viable but nonculturable Vibrio cholerae O1 revert to a culturable state in human intestine. World J Microb Biotechnol 12(1):28–31 Coutard F, Lozach S, Pommepuy M, Hervio-Heath D (2007) Realtime reverse transcription-PCR for transcriptional expression analysis of virulence and housekeeping genes in viable but nonculturable Vibrio parahaemolyticus after recovery of culturability. Appl Environ Microbiol 73(16):5183–5189 Crawford JA, Kaper JB, DiRita VJ (1998) Analysis of ToxRdependent transcription activation of ompU, the gene encoding a major envelope protein in Vibrio cholerae. Mol Microbiol 29(1):235–246
123
World J Microbiol Biotechnol Darcan C, Ozkanca R, Idil O, Flint KP (2009) Viable but nonculturable state (VBNC) of Escherichia coli related to EnvZ under the effect of pH, starvation and osmotic stress in sea water. Pol J Microbiol 58(4):307–317 Du M, Chen J, Zhang X, Li A, Li Y (2007) Characterization and resuscitation of viable but nonculturable Vibrio alginolyticus VIB283. Arch Microbiol 188(3):283–288 Handford JI, Ize B, Buchanan G, Butland GP, Greenblatt J, Emili A, Palmer T (2009) Conserved network of proteins essential for bacterial viability. J Bacteriol 191(15):4732–4749 Jang KI, Kim MG, Ha SD, Kim KS, Lee KH, Chung DH, Kim CH, Kim KY (2007) Morphology and adhesion of Campylobacter jejuni to chicken skin under varying conditions. J Microbiol Biotechnol 17(2):202–206 Jiang X, Chai TJ (1996) Survival of Vibrio parahaemolyticus at low temperatures under starvation conditions and subsequent resuscitation of viable, nonculturable cells. Appl Environ Microbiol 62(4):1300–1305 Johnston MD, Brown MH (2002) An investigation into the changed physiological state of Vibrio bacteria as a survival mechanism in response to cold temperatures and studies on their sensitivity to heating and freezing. J Appl Microbiol 92(6):1066–1077 Kong IS, Bates TC, Hu¨lsmann A, Hassan H, Smith BE, Oliver JD (2004) Role of catalase and oxyR in the viable but nonculturable state of Vibrio vulnificus. FEMS Microbiol Ecol 50(3):133–142 Mishra A, Taneja N, Sharma M (2012) Viability kinetics, induction, resuscitation and quantitative real-time polymerase chain reaction analyses of viable but nonculturable Vibrio cholerae O1 in freshwater microcosm. J Appl Microbiol 112(5):945–953 Nichols CE, Johnson C, Lockyer M, Charles IG, Lamb HK, Hawkins AR, Stammers DK (2006) Structural characterization of Salmonella typhimurium YeaZ, an M22 O-sialoglycoprotein endopeptidase homolog. Proteins 64(1):111–123 Nilsson L, Oliver JD, Kjelleberg S (1991) Resuscitation of Vibrio vulnificus from the viable but nonculturable state. J Bacteriol 173(16):5054–5059 Nowakowska J, Oliver JD (2013) Resistance to environmental stresses by Vibrio vulnificus in the viable but nonculturable state. FEMS Microbiol Ecol 84(1):213–222 Oliver JD (2000) Problems in detecting dormant (VBNC) cells and the role of DNA elements in this response. In: Jansson JK, van
123
Elsas JD, Bailey MJ (eds) Tracking genetically-engineered microorganisms. Landes Biosciences, Georgetown, pp 1–15 Oliver JD (2010) Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiol Rev 34(4):415–425 Oliver JD, Bockian R (1995) In vivo resuscitation, and virulence toward mice, of viable but nonculturable cells of Vibrio vulnificus. Appl Environ Microbiol 61(7):2620–2623 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9):e45 Pinto D, Santos MA, Chambel L (2013) Thirty years of viable but nonculturable state research: unsolved molecular mechanisms. Crit Rev Microbiol. doi:10.3109/1040841X.2013.794127 Saux MFL, Hervio-Heath D, Loaec S, Colwell RR, Pommepuy M (2002) Detection of cytotoxin-hemolysin mRNA in nonculturable populations of environmental and clinical Vibrio vulnificus strains in artificial seawater. Appl Environ Microbiol 68(11):5641–5646 Smith B, Oliver JD (2006) In situ and in vitro gene expression by Vibrio vulnificus during entry into, persistence within, and resuscitation from the viable but nonculturable state. Appl Environ Microbiol 72(2):1445–1451 Vora GJ, Meador CE, Bird MM, Bopp CA, Andreadis JD, Stenger DA (2005) Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp. Proc Natl Acad Sci USA 102(52):19109–19114 Whitesides MD, Oliver JD (1997) Resuscitation of Vibrio vulnificus from the viable but nonculturable state. Appl Environ Microbiol 63(3):1002–1005 Wolf P, Oliver JD (1992) Temperature effects on the viable but nonculturable state of Vibrio vulnificus. FEMS Microbiol Ecol 101(1):33–39 Wong HC, Wang P, Chen SY, Chiu SW (2004) Resuscitation of viable but non-culturable Vibrio parahaemolyticus in a minimum salt medium. FEMS Microbiol Lett 233(2):269–275 Xu C, Ren H, Wang S, Peng X (2004) Proteomic analysis of saltsensitive outer membrane proteins of Vibrio parahaemolyticus. Res Microbiol 155(10):835–842
