MOLECULAR AND CELLULAR BIOLOGY, Oct. 1990, p. 5558-5561 0270-7306/90/105558-04$02.00/0 Copyright C 1990, American Society for Microbiology

Vol. 10, No. 10

Inhibition of c-fos Transcription and Phosphorylation of the Serum Response Factor by an Inhibitor of Phospholipase C-Type Reactions GUNNAR SCHALASTA* AND CLEMENS DOPPLER

Institute for Virus Research, German Cancer Research Center, 6900 Heidelberg, Federal Republic of Germany Received 23 March 1990/Accepted 16 July 1990

Phospholipase C activity is necessary for transcriptional c-fos activation by providing diacylglycerol as an activator of protein kinase C. We found that transcriptional activation of c-fos and the phosphorylation of its major transcription factor were inhibited by tricyclodecan-9-yl xanthogenate, which blocks phospholipase C-type reactions. Transcription of the c-ras and ,-actin genes in the same cells remained unaffected.

Rapid transcriptional activation of the c-fos proto-oncobe achieved by a variety of growth factors and other extracellular stimuli such as epidermal growth factor (EGF) or 12-O-tetradecanoylphorbol-13-acetate (5, 12, 16, 21). Induction occurs even in the presence of inhibitors of protein synthesis, suggesting a posttranslational alteration of preexisting transcription factors. Inducibility depends on the presence of the serum response element (SRE) that is located in the proximity of the mRNA cap site of c-fos (10, 11, 35, 36). It does so by interacting with at least two phosphoproteins, the 67-kilodalton serum response factor (SRF) (32, 37) and the recently identified 62-kilodalton ternary complex factor (31, 34). Ternary complex formation between SRE-bound SRF and the ternary complex factor (the latter does not bind by itself to SRE [34]) is thought to be necessary for inducible expression of c-fos (33, 34). Complex formation between SRE and SRF has been observed in A431 cells after stimulation with EGF (28), and phosphorylation of SRF has been implicated in its binding activity (27). Phosphorylation of proteins is a common regulatory alteration mediated by kinases (4). To assess whether phosphorylation of SRF renders the protein biologically active, we have used an inhibitor of phospholipase C-type reactions that has been shown to preclude indirectly also the activity of a protein kinase C (PKC) (24). The compound D609 was shown to prevent formation of diacylglycerol (22), which acts as a second messenger and induces the activity of PKC (13). The specific phosphorylation of certain virus-encoded proteins that participate in transcriptional activity was inhibited by D609. In the case of vesicular stomatitis virus, phosphorylation of the viral nonstructural protein, which is part of the polymerase complex, and secondary virus transcription were inhibited upon treatment of infected cells with D609 (23). In this context, it is important to note that 12-O-tetradecanoylphorbol-13-acetate induction of latent bovine papillomavirus type 1 genomes can be precluded by treatment with D609 (1). The bovine papillomavirus type 1 transactivator E2 binds to a motif within the E2-responsive element (18) that is highly homologous to the motif in the c-fos SRE which is required for efficient SRF binding (19). The xanthate D609 has been used to investigate the functional significance of phosphorylation of SRF with respect to c-fos proto-oncogene transcription. In this report,

evidence is provided that activation of c-fos transcription depends on SRF phosphorylation. Selective inhibition of EGF-induced c-fos transcription. To examine the effect of D609 on the transcriptional activity of the c-fos, c-ras, and the ,-actin genes, serum-starved (0.5% fetal calf serum), virus-transformed mouse embryo fibroblasts (MEF-Kl) were treated with EGF (150 ng/ml) and with EGF in the presence of D609 (30 ,ug/ml). Treatment was performed in the presence of cycloheximide (20 ,ug/ml). One hour after addition of EGF, the total RNA was extracted (15) and Northern (RNA) blot analysis was carried out. For hybridization, radiolabeled v-fos (6), v-ras (9), and ,-actin (26) probes were used. The extent of c-fos transcription was diminished to basal levels (Fig. 1, lane 1) in EGF-stimulated cells that were treated with D609 (lane 3) compared with those that had been stimulated with EGF (lane 2). No effect on the transcriptional activity of either the c-ras or P-actin gene could be observed under the same conditions (lanes 4 to 9).

gene can

*

c-fos ....

actin

c-ras I

oI UD

LII

0

0

Co

Coo U

2 8 S-

u

i

.

t3

o lLs

0 0 a

L

ULLw

Li.

**-2.2 ~41 .

-2.3

85-

1 2 3 4 5 6 7 8 9 FIG. 1. Kinetics of c-fos, c-ras, and P-actin induction after EGF stimulation and D609 treatment in the presence of cycloheximide. Total RNA was extracted from serum-starved (lanes 1, 4, and 7), EGF-stimulated (lanes 2, 5, and 8), and EGF-stimulated, D609treated (lanes 3, 6, and 9) MEF-Kl cells. From each sample, 10 ,ug of total RNA was separated by electrophoresis on a 1.4% denaturing agarose gel, transferred to nitrocellulose, and hybridized with 32p_ labeled v-fos-, v-ras-, and P-actin-specific probes. Positions of the 28S and 18S ribosomal bands and the transcripts of c-fos (2.2 kilobases), c-ras (2.3 kilobases), and P-actin (1.9 kilobases) are indicated.

Corresponding author. 5558

NOTES

VOL. 10, 1990

0)

A

(0

0) 0 CD

C (D

B

0

0

a

Q +

0

+

+

OLLL

LL

5559

LL LJ

MW

O Ow

000MO

W

(.

oww -97 z.

.1

_.

i. NO.

__-66

-

-45

-66

_a__45

>.

-66

m

-

=ji-36

-45

-29

-36

29

-29 1

2

3

-U

1

2

3 4

5

6

FIG. 2. SDS-PAGE of whole nuclear extracts (A) and affinitypurified SRF (B) from serum-starved, 32Pi-labeled MEF-Kl cells. (A) Equal amounts of unstimulated cells (CO; lane 1), EGFstimulated cells (lane 2), and EGF-stimulated cells after treatment with D609 (lane 3), each in the presence of cycloheximide, were assayed. (B) The same extracts were used for affinity purification of SRF on an affinity column loaded with the high affinity SRE CA ATCCCTCCCCCCTTATGATGCCCATATATGGGCATC TTC TGCAGCA(the inverted repeats of this SRE are indicated by inverted arrows). Lane 4 represents the unstimulated (CO), lane 5 represents the EGF-stimulated, and lane 6 represents the EGFstimulated, D609-treated sample after two passages over the column. The 0.8 M KCI elution step is shown. The arrow indicates SRE-bound SRF. Molecular weights (MW) are indicated in thousands.

Affinity purification of labeled SRF. The technique of specific DNA affinity chromatography was used to determine whether the observed inhibition of c-fos transcriptional activation was due to an altered SRF. MEF-Kl cells (5 x 106) were labeled overnight with 32Pi (Amersham Corp.), and nuclear salt extracts were prepared after stimulation with EGF and treatment with D609 in the presence of cycloheximide as described by Dignam et al. (7) with slight modifications (25). The DNA affinity column was prepared by the method of Kadonaga and Tjian (14) with a high-affinity SRE (37) that allows purification of SRF in a single DNA chromatography step and modified as described by Prywes et al. (27) to facilitate coupling to the column matrix. The nuclear extracts were supplemented with 30 ,ug of polyd(I-C) (Boehringer GmbH) as unspecific competitor, EDTA (to 5 mM), Nonidet P-40 (to 0.1%), dithiothreitol (to 1 mM), and phenylmethylsulfonyl fluoride (to 0.1 mM) and subsequently applied to the affinity column. The column was washed extensively with Dignam buffer C containing 0.3 M KCl to remove unspecifically bound material. The proteins were eluted with a salt gradient ranging up to 1.5 M KCl in buffer

FIG. 3. SDS-PAGE of affinity-purified SRF from serum-starved and [35S]methionine-labeled MEF-Kl cells. The oligonucleotide and the purification protocol were as described for Fig. 2. The arrowhead indicates the specific bands in the unstimulated (CO; lane 1), EGF-stimulated (lane 2), and EGF-stimulated, D609-treated (lane 3) samples. The 0.8 M KCI elution step is shown. Molecular weights (MW) are indicated in thousands.

C. For additional cycles of affinity chromatography, the eluates were diluted, supplemented with additional polyd(IC), and reapplied to the column. The eluates were submitted to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE); the gels were dried and then exposed to X-ray films. With this procedure, a phosphoprotein, comparable in size to purified SRF (29, 32, 37), eluted first at 0.8 M KCI and was still abundant at the 1.5 M KCI step. The signal observed in nuclear extracts from EGF-stimulated cells (Fig. 2B, lane 5) appeared to be about 10-fold stronger (densitometric evaluation) than the signals obtained when nuclear extracts from unstimulated or EGF-stimulated and D609-treated cells were used (lanes 4 and 6). To ensure that identical amounts of labeled nuclear extracts were applied to the columns, equal volumes from each sample of whole nuclear extract were resolved by SDS-PAGE (Fig. 2A). The technique for the isolation of SRF is based on its binding efficiency. Hence, the observed differences in the intensity of the signals could be due either to a reduced degree of phosphorylation or to a lowered binding affinity of the protein. To distinguish between these possibilities, identically treated parallel cultures were labeled with [35S]methionine, and the nuclear extracts were subjected to the same purification steps as described above. The SRE-bound proteins (eluted with 0.8 M KCI) were determined by SDSPAGE. The 35S-labeled proteins from unstimulated (Fig. 3, lane 1), EGF-stimulated (lane 2), and EGF stimulated, D609-treated (lane 3) cells were similar in intensity. This finding permits the conclusion that EGF stimulation leads to an enhanced phosphorylation of SRF which can be precluded by treatment with D609. The binding affinity of SRF to SRE therefore remains unaltered. Prywes et al. (27) found, in contrast, a lower degree of

5560

MOL. CELL. BIOL.

NOTES

0) 0 0.

Li0

a

0

V4)

m

a

I

(-'U'

ui

.

+

+

I

+r-

SRF_-

1

2 3

4 5 6

FIG. 4. Mobility shift assay of phosphatase-treated and untreated affinity-purified SRF. A 5-,ul sample of SRF containing column fractions (specific oligonucleotide column) derived from untreated (lanes 1 and 4), EGF-stimulated (lanes 2 and 5), and EGF-stimulated, D609-treated (lanes 3 and 6) cells were analyzed directly (lanes 1 to 3) or after incubation with 0.5 ,ug of potato acid phosphatase (lanes 4 to 6) in mobility shift buffer [20 mM Tris hydrochloride (pH 7.5), 5% (vol/vol) glycerol, 50 mM KCI, 0.1 Rg of bovine serum albumin per ml, 0.05% Nonidet P-40, 0.02 ,ug of polyd(I-C) per ml, 1 mM dithiothreitol) for 20 min at 30°C. Then 104 cpm (- 0.2 ng) of 32P-labeled SRE was added for additional 20 min at 30°C. The material was loaded on a 4% native polyacrylamide gel and electrophoresed for 2 h in electrophoresis buffer containing 6.7 mM Tris hydrochloride (pH 7.5), 1 mM EDTA, and 3.3 mM sodium acetate. X-ray films were exposed overnight to the dried gel. +, Phosphatase-treated samples.

phosphorylation of SRF (twofold) upon stimulation of A431 cells with EGF. Their experiments, however, were carried out in actively growing cell cultures, whereas we used serum-starved MEF-Kl cells, in which SRF phosphorylation upon stimulation with EGF may be more accentuated. Phosphatase but not D609 treatment abolishes DNA binding of affinity-purffied SRF. Prywes et al. (27) demonstrated in the same work that treatment of SRF with phosphatase abolished the DNA-binding capacity of SRF, suggesting that in this case DNA binding was dependent on phosphorylation. However, treatment with D609, which inhibits PKCmediated phosphorylations, failed to alter SRF binding to SRE, as we have shown above. This apparent discrepancy can be resolved by assuming that the phosphorylation of SRF, which is a prerequisite for DNA binding, is brought about by kinases other than PKC. In addition, the PKCmediated phosphorylation is required for the biological activation of SRF, resulting in transcriptional c-fos activation. Treatment of SRF with phosphatase may lead to an overall dephosphorylation of various domains, resulting in the complete loss of the DNA-binding capacity of SRF. The xanthate, in contrast, acts more selectively by inhibiting only PKC-mediated phosphorylation steps while leaving the preexisting basal phosphorylation pattern unchanged. In the following experiment, we used affinity-purified SRF derived from unstimulated as well as from EGF-stimulated and D609-treated MEF-Kl cells and tested its ability to bind

SRE in mobility shift assays after treatment with potato acid phosphatase (Boehringer) (Fig. 4, lanes 4 to 6) or without treatment with phosphatase (lanes 1 to 3). SRF bound equally well to SRE regardless of whether it was derived from unstimulated (Fig. 4, lane 1), EGF-stimulated (lane 2), or EGF-stimulated, D609-treated (lane 3) cells. Treatment with phosphatase abolished binding of SRF in all cases (lanes 4 to 6). Conclusion. Two cellular pathways are known to be involved in c-fos induction (for a review, see reference 38), one involving PKC (3) and the other involving adenylate cyclase (3, 17), which triggers nontransient c-fos induction in macrophages (3). The major role of transient c-fos induction in many cell types, however, is in the production of diacylglycerol, which leads to activation of PKC after phospholipase C-mediated cleavage of inositol phospholipids (3) or other glycerophospholipids (8). A direct relationship between an elevated diacylglycerol level and c-fos gene expression on one hand and an inhibition of c-fos expression by a phospholipase inhibitor on the other hand has been shown by others (3, 8). The abolishment of transcriptional c-fos gene activation by the phospholipase C inhibitor D609 is in agreement with these observations, which are extended by the results of this work. Inhibition of the activation of PKC appears to account for the lack of phosphorylation of SRF, which in turn seems to be the prerequisite for transcriptional activation of the gene. We thank G. Sauer, E. Amtmann, K. Muller-Decker, and L. Music for helpful discussions, P. Krieg for providing the plasmids containing the v-ras and ,-actin genes, and Merz & Co., Frankfurt, Federal Republic of Germany, for the xanthate compound D609. We thank also B. Bernhardt for typing the manuscript. LITERATURE CITED 1. Amtmann, E., K. Muller, A. Knapp, and G. Sauer. 1985. Reversion of bovine papillomavirus-induced transformation and immortalization by a xanthate compound. Exp. Cell Res. 161: 541-550. 2. Baeuerle, P., and D. Baltimore. 1988. IKB: a specific inhibitor of the NF-KB transcription factor. Science 242:540-546. 3. Bravo, R., M. Neuberg, J. Burckhardt, J. Almendral, R. Wallich, and R. Muller. 1987. Involvement of common and cell type-specific pathways in c-fos gene control: stable induction by cAMP in macrophages. Cell 48:251-260. 4. Cohen, P. 1982. The role of protein phosphorylation in neural and hormonal control of cellular activity. Nature (London)

296:613-620. 5. Curran, T. 1988. The fos oncogene, p. 307-325. In E. P. Reddy, A. M. Skalka, and T. Curran (ed.), Oncogene handbook. Elsevier/North-Holland Publishing Co., Amsterdam. 6. Curran, T., G. Peters, C. van Beveren, N. M. Teich, and I. M. Verma. 1982. FBJ murine osteosarcoma virus: identification and molecular cloning of biologically active proviral DNA. J. Virol. 44:674-682. 7. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489. 8. Doglio, A., C. Dani, P. Grimaldi, and G. Ailhaud. 1989. Growth hormone stimulates c-fos gene expression by means of protein kinase C without increasing inositol lipid turnover. Proc. Natl. Acad. Sci. USA 86:1148-1152. 9. Ellis, R. W., D. DeFeo, J. M. Maryak, H. A. Young, T. Y. Shih, E. H. Chang, D. R. Lowy, and E. M. Scolnick. 1980. Dual evolutionary origin for the rat genetic sequences of Harvey murine sarcoma virus. J. Virol. 36:408-420. 10. Gllman, M. Z., R. N. Wilson, and R. A. Weinberg. 1986. Multiple protein-binding sites in the 5'-flanking region regulate c-fos expression. Mol. Cell. Biol. 6:4305-4316.

NOTES

VOL. 10, 1990

11. Greenberg, M. E., L. A. Greene, and E. B. Ziff. 1985. Nerve growth factor and epidermal growth factor induce rapid transient changes in proto-oncogene transcription in PC-12 cells. J. Biol. Chem. 260:14101-14110. 12. Greenberg, M. E., and E. B. Ziff. 1984. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature (London) 311:433-438. 13. Habenicht, A. J. R., J. A. Glomset, W. C. King, C. Nist, C. D. Mitchell, and R. Ross. 1981. Early changes in phosphatidylinositol and arachidonic acid metabolism in quiescent Swiss 3T3 cells stimulated to divide by platelet-derived growth factor. J. Biol. Chem. 256:12329-12335. 14. Kadonaga, J. T., and R. Tjian. 1986. Affinity purification of sequence-specific DNA binding proteins. Proc. Natl. Acad. Sci. USA 83:5889-5893. 15. Krieg, P., E. Amtmann, and G. Sauer. 1983. The simultaneous extraction of high-molecular-weight DNA and of RNA from solid tumors. Anal. Biochem. 134:288-294. 16. Krujer, W., J. A. Cooper, T. Hunter, and I. M. Verma. 1984. Platelet-derived growth factor induces rapid but transient expression of the c-fos gene and protein. Nature (London) 312:711-716. 17. Krujer, W., D. Schubert, and I. M. Verma. 1983. Induction of the proto-oncogene fos by nerve growth factor. Proc. Natl. Acad. Sci. USA 82:7330-7334. 18. Lambert, P. F., C. C. Baker, and P. M. Howley. 1988. The genetics of bovine papillomavirus type 1. Annu. Rev. Genet. 22:235-258. 19. Leung, S., and N. G. Miyamoto. 1989. Point mutational analysis of the human c-fos serum response factor binding site. Nucleic Acids Res. 17:1177-1195. 20. Moller, A., and H. Ottel. 1967. p. 718-728. In W. Foerst (ed.), Ullmanns Enzyklopadien der Technischen Chemie, vol. 98. Urban and Schwarzenberg, Munich. 21. Muller, R., R. Bravo, J. Burckhardt, and T. Curran. 1984. Induction of c-fos gene and protein by growth factors precedes activation of c-myc. Nature (London) 312:716-720. 22. Muller-Decker, K. 1989. Interruption of TPA-induced signals by an antiviral and antitumoral xanthate compound: inhibition of a phospholipase C-type reaction. Biochem. Biophys. Res. Commun. 162:198-205. 23. Muller-Decker, K., E. Amtmann, and G. Sauer. 1987. Inhibition of the phosphorylation of the regulatory non-structural protein of vesicular stomatitis virus by an antiviral xanthate compound. J. Gen. Virol. 68:3045-3056. 24. Muller-Decker, K., C. Doppler, E. Amtmann, and G. Sauer. 1988. Interruption of growth signal transduction by an antiviral

25.

26. 27.

28.

29. 30. 31.

32.

33. 34.

35. 36. 37.

38.

5561

and antitumoral xanthate compound. Exp. Cell Res. 177:295302. Osborn, L., S. Kunkel, and G. J. Nabel. 1989. Tumor necrosis factor a and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor KB. Proc. Natl. Acad. Sci. USA 86:2336-2340. Ostrowski, L. E., P. Krieg, J. Finch, A. E. Cress, R. B. Nagle, and G. T. Bowden. 1989. Expression of 13-actin during progression of mouse skin tumors. Carcinogenesis 10:1439-1444. Prywes, R., A. Dutta, J. A. Cromlish, and R. G. Roeder. 1988. Phosphorylation of serum response factor, a factor that binds to the serum response element of the c-fos enhancer. Proc. Natl. Acad. Sci. USA 85:7206-7210. Prywes, R., and R. G. Roeder. 1986. Inducible binding of a factor to the c-fos enhancer. Cell 47:777-784. Prywes, R., and R. G. Roeder. 1987. Purification of the c-fos enhancer binding protein. Mol. Cell. Biol. 7:3482-3489. Ryan, W. A., Jr., B. R. Franza, Jr., and M. Z. Gilman. 1989. Two distinct cellular phosphoproteins bind to the c-fos serum response element. EMBO J. 8:1785-1792. Schroter, H., C. G. F. Mueller, K. Meese, and A. Nordheim. 1990. Synergism in ternary complex formation between the dimeric glycoprotein p67sRF, polypeptide p62TCF and the c-fos serum response element. EMBO J. 9:1123-1130. Schroter, H., P. E. Shaw, and A. Nordheim. 1987. Purification of intercalator-released p67, a polypeptide that interacts specifically with the c-fos serum response element. Nucleic Acids Res. 15:10145-10158. Shaw, P. E., S. Frasch, and A. Nordheim. 1989. Repression of c-fos transcription is mediated through p67SRF bound to the SRE. EMBO J. 8:2567-2574. Shaw, P. E., H. Schr6ter, and A. Nordheim. 1989. The ability of a ternary complex to form over the serum response element correlates with serum inducibility of the human c-fos promoter. Cell 56:563-572. Treisman, R. 1985. Transient accumulation of c-fos RNA following serum stimulation requires a conserved 5' element and c-fos 3' sequences. Cell 42:889-902. Treisman, R. 1986. Identification of a protein-binding site that mediates transcriptional response of the c-fos gene to serum factors. Cell 46:567-574. Treisman, R. 1987. Identification and purification of a polypeptide that binds to the c-fos serum response element. EMBO J. 6:2711-2717. Verma, I. M., and P. Sassone-Corsi. 1987. Proto-oncogene fos: complex but versatile regulation. Cell 51:513-514.