Accepted Manuscript Inhibition of CDK2 promotes inducible regulatory T-cell differentiation through TGFβ-Smad3 signaling pathway Haijuan Gu, Lixia Ding, Zhengyi Wang, Guo-Huang Fan, Sidong Xiong, Xiaoming Gao, Lei Fang, Biao Zheng PII: DOI: Reference:
S0008-8749(14)00082-3 http://dx.doi.org/10.1016/j.cellimm.2014.05.004 YCIMM 3329
To appear in:
Cellular Immunology
Received Date: Accepted Date:
28 February 2014 12 May 2014
Please cite this article as: H. Gu, L. Ding, Z. Wang, G-H. Fan, S. Xiong, X. Gao, L. Fang, B. Zheng, Inhibition of CDK2 promotes inducible regulatory T-cell differentiation through TGFβ-Smad3 signaling pathway, Cellular Immunology (2014), doi: http://dx.doi.org/10.1016/j.cellimm.2014.05.004
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Inhibition of CDK2 promotes inducible regulatory T-cell differentiation through TGFβ-Smad3 signaling pathway
Haijuan Gua, 1, Lixia Dinga, 1, Zhengyi Wanga, b, Guo-Huang Fana, Sidong Xionga, Xiaoming Gaoa, *, Lei Fanga, b, *, and Biao Zhenga, b, *
a
Jiangsu Key Laboratory of Infection and Immunity, Institutes of Biology and Medical
Sciences, Soochow University, Suzhou 215123, China b
Department of Pathology and Immunology, Baylor College of Medicine, Houston, TX
77030, USA 1
These authors contributed equally to this work
*
Correspondence should be addressed to:
Biao Zheng: N903.05, One Baylor Plaza, Houston, Texas 77030 E-mail: [email protected]; Phone: 713-798-8796 ; FAX: 713-798-3033 Lei Fang: Institute of Biological and Medical Sciences, Soochow University, Suzhou 215123, China; [email protected] Xiaoming Gao : Institutes of Biology and Medical Sciences, Soochow University, Suzhou 215123, China; [email protected]
1
Abstract: Inducible regulatory T-cells (iTReg) can be generated from CD4+Foxp3- naïve conventional T-cells by a combination of TGF-β and T-cell receptor (TCR) signaling. It is of enormous clinical importance to identify agents that can promote the generation and differentiation of functional iTreg cells. We have established a phenotypic screening platform to identify new compounds that can promote the TGFβ-mediated iTreg differentiation. We have found Kenpaullone, a potent CDK1, CDK2 and CDK5 inhibitor, as new enhancer for iTreg cell differentiation. Kenpaullone promotes iTreg cell differentiation through increased and prolonged transcription of foxp3 gene by enhancing TGFβ-Smad3 signaling pathway. Thus, we have demonstrated that CDK2 is the biological target of Kenpaullone and proven that CDK2 is a novel negative regulator of iTreg cell differentiation.
2
1. Introduction Regulatory T (Treg) cells are a developmentally and functionally distinct T cell lineage that maintains the immunological self-tolerance and homeostasis [1-3]. Generally speaking, regulatory T-cells contain two subtypes: thymus-derived naturally occurring Treg cells (nTreg) and peripheral inducible Treg (iTreg) [4]. It is well acknowledged that Foxp3, a forkhead transcription factor encoded by the X chromosome, is critical for the development and function of Treg cells [2, 5, 6]. The majority of Foxp3+ Treg cells in the periphery are nTreg cells that constitutively express Foxp3 and are functional mature Tcells keeping immune response in check. Peripheral naïve conventional T-cells can gain Foxp3 expression and differentiate into iTreg cells in certain conditions (e.g. oral tolerance, tumor microenvironment and chronic inflammation during parasite infection) [7-10]. nTreg cells constitute about 10% of peripheral CD4+ T cell subset and are a limited resource for cell-based therapies [11]. Thus, there has been great interest in identifying novel targets that can be manipulated in order to differentiate conventional CD4+ T-cells, which dominate the peripheral T-cell population, into iTreg cells to treat autoimmune diseases or control transplant rejection [12-14]. Transforming growth factor-β (TGFβ) is the key cytokine in regulation of iTreg cell differentiation. Together with TCR signaling, TGFβ can induce Foxp3 gene expression in Foxp3- conventional CD4+ T-cells through activating the smad pathway [7, 15]. The phosphorylated Smad2 and Smad3 can form a complex with the Smad4, and then translocate into the nucleus and bind to the enhancer and promoter of foxp3 gene to initiate and maintain the foxp3 gene transcription [15, 16]. Recent studies have shown that multiple pathways can regulate the TGFβ-induced iTreg differentiation, including 3
mTOR signaling, AKT/PI3K pathway, and RAR singling [17, 18]. The inhibitors of these pathways, including Rapamycin, LY294002, Retinoid Acid, can promote iTreg differentiation [17, 18], suggesting that it is possible to pharmacologically modulate the iTreg cell differentiation by molecules. In this study, we have established a phenotypic screening system to identify compounds that can promote TGFβ-induced iTreg differentiation. We have identified kenpaullone (ken), a specific CDK inhibitor, can significantly promote iTreg cell differentiation. In addition, we have demonstrated CDK2 is the key target of kenpaullone in promoting iTreg cell differentiation and development. Thus, our studies have found a new pathway that can regulate TGFβ-induced iTreg cell differentiation and provided a feasible approach to increase iTreg production for therapeutic purposes.
4
2. Materials and Methods
2.1. Mice C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences. Foxp3-gfp.ki mice were kindly provided by Vijay K. Kuchroo (Harvard Medical School). All experiments were performed with mice 6-10 weeks old with protocols approved by the Institutional Animal Care and Use Committee. 2.2. T cell purification CD4+ T cells were purified by a CD4 Negative Isolation Kit or CD4 Isolation Kit (Miltenyi Biotech). CD4+CD25+ or CD4+Foxp3+ cells and CD4+CD25- or CD4+Foxp3cells were further prepared by FACS sorting (the purities of FACS-sorted cells were more than 90%). 2.3. Treg cell differentiation Cells (2x105/well for 96 well plate) were cultured in RPMI1640 supplemented with 10% FBS (Gibco), 2-mercaptoethanlo, sodium pyruvate, nonessential amino acids, penicillin and streptomycin. Purified CD4+CD25- cells were stimulated with antibodies to CD3 (3 µg/ml) (BD Biosciences) and CD28 (1 µg/ml) (BD Biosciences) under iTreg cell differentiation conditions (rhTGFβ1, 1ng/ml, R&D Systems), or nTreg cell expansion conditions (mIL2, 50 ng/ml, R&D Systems). Kenpaullone (5 µM, Sigma), TGFβ neutralizing antibody (10 ug/ml, R&D Systems) or SB525334 (5 µM, Sigma) was added at the beginning of the culture. 2.4. SiRNA transfection 5
CDK2 specific siRNA (Dharmacon) was transfected into CD4+CD25- T cells by Nucleofector Kits for Mouse T Cells according to manufactures instruction (LONZA) prior to T cell differentiation. 2.5. Flow cytometry For cell surface staining, cells were stained with antibodies to CD4 (RM4-5, eBioscience). For Foxp3 intracellular staining, cells was stained with antibody to Foxp3 (eBioscience) according to the manufacturer’s instruction. For the cell proliferation assay, CD4+CD25- T cells were labeled with Cell Proliferation Dye eFluor® 670 (eBioscience). Cells were analyzed or sorted by BD LSRII (BD Biosciences). 2.6. Treg suppression assay Treg suppression assay was detailed in the previous study [19]. In short, 4 104 eFluor® 670 labeled CD4+CD25- T were co-cultured with iTreg cells as indicated in the presence of mitomycin treated APC cells and ConA stimulation. Treg suppression of Tcon was determined 4 days later. 2.7. Immunoblots Cells were lysed with RIPA buffer containing PMSF and protease inhibitor cocktail. The lysates were fractionated by SDS-PAGE and analyzed by immunoblotting with specific antibodies to Foxp3 (eBioscience), phospho-Smad3 (S423+S425) (abcam), phospho-Smad2 (Ser465/467), Smad2, Smad3, Smad4 (Cell Signaling Technology) and β-actin (Sigma-Aldrich). 2.8. RNA extraction and quantitative real-time RT-PCR 6
Total RNA was extracted from cells with an RNeasy Mini kit (Qiagen) according to the manufacturer’s instruction, then cDNA was synthesized with iScript cDNA Synthesis RT kit (BIO-RAD). Gene expression profile was analyzed by quantitative real-time PCR in an ABI 7900HT (Applied Biosystems) with customized primer sets for mouse Foxp3, Smad3, cdk1, cdk2. The sequences of the primer pairs were: actin: 5’-TCTGGCACCACACCTTCTACAA -3’ and 5’- TTTTCACGGTTGGCCTTAGG -3’ foxp3: 5’-GGACAGACCACACTTCATGCA -3’ and 5’-GCTGATCATGGCTGGGTTGT -3’; Smad3: 5’-ACAGCATGGACGCAGGTTCT -3’ and 5’-AAGGCCGGCTCACAGTAGGT -3’ cdk1: 5’- CTCGCATCCCACGTCAAGA -3’ and 5’- GGGCCATTTTGCCAGAGATT -3’ cdk2: 5’-TCCGGCTCGACACTGAGACT-3’ and 5’-TCCAGCAGCTTGACGATATTAGG-3’ 2.9. Statistical analysis Data were analyzed using a two-tailed Student t test, and p
S0008-8749(14)00082-3 http://dx.doi.org/10.1016/j.cellimm.2014.05.004 YCIMM 3329
To appear in:
Cellular Immunology
Received Date: Accepted Date:
28 February 2014 12 May 2014
Please cite this article as: H. Gu, L. Ding, Z. Wang, G-H. Fan, S. Xiong, X. Gao, L. Fang, B. Zheng, Inhibition of CDK2 promotes inducible regulatory T-cell differentiation through TGFβ-Smad3 signaling pathway, Cellular Immunology (2014), doi: http://dx.doi.org/10.1016/j.cellimm.2014.05.004
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Inhibition of CDK2 promotes inducible regulatory T-cell differentiation through TGFβ-Smad3 signaling pathway
Haijuan Gua, 1, Lixia Dinga, 1, Zhengyi Wanga, b, Guo-Huang Fana, Sidong Xionga, Xiaoming Gaoa, *, Lei Fanga, b, *, and Biao Zhenga, b, *
a
Jiangsu Key Laboratory of Infection and Immunity, Institutes of Biology and Medical
Sciences, Soochow University, Suzhou 215123, China b
Department of Pathology and Immunology, Baylor College of Medicine, Houston, TX
77030, USA 1
These authors contributed equally to this work
*
Correspondence should be addressed to:
Biao Zheng: N903.05, One Baylor Plaza, Houston, Texas 77030 E-mail: [email protected]; Phone: 713-798-8796 ; FAX: 713-798-3033 Lei Fang: Institute of Biological and Medical Sciences, Soochow University, Suzhou 215123, China; [email protected] Xiaoming Gao : Institutes of Biology and Medical Sciences, Soochow University, Suzhou 215123, China; [email protected]
1
Abstract: Inducible regulatory T-cells (iTReg) can be generated from CD4+Foxp3- naïve conventional T-cells by a combination of TGF-β and T-cell receptor (TCR) signaling. It is of enormous clinical importance to identify agents that can promote the generation and differentiation of functional iTreg cells. We have established a phenotypic screening platform to identify new compounds that can promote the TGFβ-mediated iTreg differentiation. We have found Kenpaullone, a potent CDK1, CDK2 and CDK5 inhibitor, as new enhancer for iTreg cell differentiation. Kenpaullone promotes iTreg cell differentiation through increased and prolonged transcription of foxp3 gene by enhancing TGFβ-Smad3 signaling pathway. Thus, we have demonstrated that CDK2 is the biological target of Kenpaullone and proven that CDK2 is a novel negative regulator of iTreg cell differentiation.
2
1. Introduction Regulatory T (Treg) cells are a developmentally and functionally distinct T cell lineage that maintains the immunological self-tolerance and homeostasis [1-3]. Generally speaking, regulatory T-cells contain two subtypes: thymus-derived naturally occurring Treg cells (nTreg) and peripheral inducible Treg (iTreg) [4]. It is well acknowledged that Foxp3, a forkhead transcription factor encoded by the X chromosome, is critical for the development and function of Treg cells [2, 5, 6]. The majority of Foxp3+ Treg cells in the periphery are nTreg cells that constitutively express Foxp3 and are functional mature Tcells keeping immune response in check. Peripheral naïve conventional T-cells can gain Foxp3 expression and differentiate into iTreg cells in certain conditions (e.g. oral tolerance, tumor microenvironment and chronic inflammation during parasite infection) [7-10]. nTreg cells constitute about 10% of peripheral CD4+ T cell subset and are a limited resource for cell-based therapies [11]. Thus, there has been great interest in identifying novel targets that can be manipulated in order to differentiate conventional CD4+ T-cells, which dominate the peripheral T-cell population, into iTreg cells to treat autoimmune diseases or control transplant rejection [12-14]. Transforming growth factor-β (TGFβ) is the key cytokine in regulation of iTreg cell differentiation. Together with TCR signaling, TGFβ can induce Foxp3 gene expression in Foxp3- conventional CD4+ T-cells through activating the smad pathway [7, 15]. The phosphorylated Smad2 and Smad3 can form a complex with the Smad4, and then translocate into the nucleus and bind to the enhancer and promoter of foxp3 gene to initiate and maintain the foxp3 gene transcription [15, 16]. Recent studies have shown that multiple pathways can regulate the TGFβ-induced iTreg differentiation, including 3
mTOR signaling, AKT/PI3K pathway, and RAR singling [17, 18]. The inhibitors of these pathways, including Rapamycin, LY294002, Retinoid Acid, can promote iTreg differentiation [17, 18], suggesting that it is possible to pharmacologically modulate the iTreg cell differentiation by molecules. In this study, we have established a phenotypic screening system to identify compounds that can promote TGFβ-induced iTreg differentiation. We have identified kenpaullone (ken), a specific CDK inhibitor, can significantly promote iTreg cell differentiation. In addition, we have demonstrated CDK2 is the key target of kenpaullone in promoting iTreg cell differentiation and development. Thus, our studies have found a new pathway that can regulate TGFβ-induced iTreg cell differentiation and provided a feasible approach to increase iTreg production for therapeutic purposes.
4
2. Materials and Methods
2.1. Mice C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences. Foxp3-gfp.ki mice were kindly provided by Vijay K. Kuchroo (Harvard Medical School). All experiments were performed with mice 6-10 weeks old with protocols approved by the Institutional Animal Care and Use Committee. 2.2. T cell purification CD4+ T cells were purified by a CD4 Negative Isolation Kit or CD4 Isolation Kit (Miltenyi Biotech). CD4+CD25+ or CD4+Foxp3+ cells and CD4+CD25- or CD4+Foxp3cells were further prepared by FACS sorting (the purities of FACS-sorted cells were more than 90%). 2.3. Treg cell differentiation Cells (2x105/well for 96 well plate) were cultured in RPMI1640 supplemented with 10% FBS (Gibco), 2-mercaptoethanlo, sodium pyruvate, nonessential amino acids, penicillin and streptomycin. Purified CD4+CD25- cells were stimulated with antibodies to CD3 (3 µg/ml) (BD Biosciences) and CD28 (1 µg/ml) (BD Biosciences) under iTreg cell differentiation conditions (rhTGFβ1, 1ng/ml, R&D Systems), or nTreg cell expansion conditions (mIL2, 50 ng/ml, R&D Systems). Kenpaullone (5 µM, Sigma), TGFβ neutralizing antibody (10 ug/ml, R&D Systems) or SB525334 (5 µM, Sigma) was added at the beginning of the culture. 2.4. SiRNA transfection 5
CDK2 specific siRNA (Dharmacon) was transfected into CD4+CD25- T cells by Nucleofector Kits for Mouse T Cells according to manufactures instruction (LONZA) prior to T cell differentiation. 2.5. Flow cytometry For cell surface staining, cells were stained with antibodies to CD4 (RM4-5, eBioscience). For Foxp3 intracellular staining, cells was stained with antibody to Foxp3 (eBioscience) according to the manufacturer’s instruction. For the cell proliferation assay, CD4+CD25- T cells were labeled with Cell Proliferation Dye eFluor® 670 (eBioscience). Cells were analyzed or sorted by BD LSRII (BD Biosciences). 2.6. Treg suppression assay Treg suppression assay was detailed in the previous study [19]. In short, 4 104 eFluor® 670 labeled CD4+CD25- T were co-cultured with iTreg cells as indicated in the presence of mitomycin treated APC cells and ConA stimulation. Treg suppression of Tcon was determined 4 days later. 2.7. Immunoblots Cells were lysed with RIPA buffer containing PMSF and protease inhibitor cocktail. The lysates were fractionated by SDS-PAGE and analyzed by immunoblotting with specific antibodies to Foxp3 (eBioscience), phospho-Smad3 (S423+S425) (abcam), phospho-Smad2 (Ser465/467), Smad2, Smad3, Smad4 (Cell Signaling Technology) and β-actin (Sigma-Aldrich). 2.8. RNA extraction and quantitative real-time RT-PCR 6
Total RNA was extracted from cells with an RNeasy Mini kit (Qiagen) according to the manufacturer’s instruction, then cDNA was synthesized with iScript cDNA Synthesis RT kit (BIO-RAD). Gene expression profile was analyzed by quantitative real-time PCR in an ABI 7900HT (Applied Biosystems) with customized primer sets for mouse Foxp3, Smad3, cdk1, cdk2. The sequences of the primer pairs were: actin: 5’-TCTGGCACCACACCTTCTACAA -3’ and 5’- TTTTCACGGTTGGCCTTAGG -3’ foxp3: 5’-GGACAGACCACACTTCATGCA -3’ and 5’-GCTGATCATGGCTGGGTTGT -3’; Smad3: 5’-ACAGCATGGACGCAGGTTCT -3’ and 5’-AAGGCCGGCTCACAGTAGGT -3’ cdk1: 5’- CTCGCATCCCACGTCAAGA -3’ and 5’- GGGCCATTTTGCCAGAGATT -3’ cdk2: 5’-TCCGGCTCGACACTGAGACT-3’ and 5’-TCCAGCAGCTTGACGATATTAGG-3’ 2.9. Statistical analysis Data were analyzed using a two-tailed Student t test, and p
