This article was downloaded by: [Ondokuz Mayis Universitesine] On: 07 November 2014, At: 06:08 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Animal Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/labt20
Inhibition of Infectious Bursal Disease Virus by Vector Delivered SiRNA in Cell Culture a
a
a
a
Amol Ashok Sahare , Megha Kadam Bedekar , Sudhir Kumar Jain , Azad Singh , Sanjeev a
Singh & Bikas Chandra Sarkhel
a
a
Animal Biotechnology Center, JNKVV Campus, Adhartal , Jabalpur , Madhya Pradesh , India Published online: 25 Aug 2014.
To cite this article: Amol Ashok Sahare , Megha Kadam Bedekar , Sudhir Kumar Jain , Azad Singh , Sanjeev Singh & Bikas Chandra Sarkhel (2015) Inhibition of Infectious Bursal Disease Virus by Vector Delivered SiRNA in Cell Culture, Animal Biotechnology, 26:1, 58-64, DOI: 10.1080/10495398.2014.886584 To link to this article: http://dx.doi.org/10.1080/10495398.2014.886584
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Animal Biotechnology, 26:58–64, 2015 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495398.2014.886584
Inhibition of Infectious Bursal Disease Virus by Vector Delivered SiRNA in Cell Culture Amol Ashok Sahare, Megha Kadam Bedekar, Sudhir Kumar Jain, Azad Singh, Sanjeev Singh, and Bikas Chandra Sarkhel
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
Animal Biotechnology Center, JNKVV Campus, Adhartal, Jabalpur, Madhya Pradesh, India Infectious Bursal Disease (IBD) is major threat to poultry industry. It causes severe immunosuppression and mortality in chicken generally at 3 to 6 weeks of age. RNA intereference (RNAi) emerges as a potent gene regulatory tool in last few years. The present study was conducted to evaluate the efficiency of RNAi to inhibit the IBD virus (IDBV) replication in-vitro. VP2 gene of virus encodes protein involved in capsid formation, cell entry and induction of protective immune responses against it. Thus, VP2 gene of IBDV is the candidate target for the molecular techniques applied for IBDV detection and inhibition assay. In this study, IBDV was isolated from field cases and confirmed by RT-PCR. The virus was then adapted on chicken embryo fibroblast cells (CEF) in which it showed severe cytopathic effects (CPE). The short hairpin RNA (shRNAs) constructs homologous to the VP2 gene were designed and one, having maximum score and fulfilling maximum Reynolds criteria, was selected for evaluation of effective inhibition. Selected shRNA construct (i.e., VP2-shRNA) was observed to be the most effective for inhibiting VP2 gene expression. Real time PCR analysis was performed to measure the relative expression of VP2 gene in different experimental groups. The VP2 gene was less expressed in virus infected cells co-transfected with VP2-shRNA as compared to mock transfected cells and IBDVþ cells (control) at dose 1.6 lg. The result showed 95% efficient down regulation of VP2 gene mRNA in VP2-shRNA treated cells. These findings suggested that designed shRNA construct achieved high level of inhibition of VP2 gene expression in-vitro. Keywords Cytopathic effects; Gene knockdown; iBD virus; Interleukin response; RNAi; VP2 gene
of 21–25 nt (4). As the effect of short interfering RNAs (siRNAs) is generally transient in transfected animal cells, small RNA expression vectors have been developed that express hairpin siRNA (also called short hairpin RNA or shRNA) to induce long-lasting RNA silencing in mammalian cells (5–7). shRNA have several advantages over siRNA and the cost is relatively cheap to that of chemically synthesized siRNA. Moreover, due to in-vitro transcription, the resultant siRNA produce less toxic effects and has good stability in host system. shRNA have high transfection efficiency and require a lesser amount to produce efficient silencing (8, 9). Again, the siRNA is unsuitable for large scale synthesis and long term research. Therefore in present investigation, as part of the development of viral vector-mediated RNAi strategy against IBD, the shRNA targeting VP2 sequence was selected and their inhibitory effects on viral gene expression and replication were investigated. Delivery of RNAi-based gene silencing through live attenuated vaccines for reducing replication of pathogenic viruses is a novel approach for the control of infectious diseases (10). IBDV has been recently classified as a member of the genus Avibirna virus of the family Birnaviridae. IBDV genome consists of two segments, A and B. The larger
Infectious bursal disease (IBD), popularly known as gumboro disease is a highly contagious, acute, viral disease of young chicken. The virus destroys the immature B-lymphocytes in the bursa of Febricius. The virus grows rapidly in the Bursa of Fabricius (BF) and the disease is characterized by acute onset, short course, and cause extensive destruction of B-lymphocytes (1). Hence, there is decrease in response to vaccines. Repeated incidences of vaccination failure and disease onset forced us to find some alternative strategy for viral inhibition. RNA interference (RNAi) is a naturally occurring post transcriptional gene silencing mechanism. As this technique is a simple and effective tool, it has replaced the gene knockout approach and is widely used in the study of viral diseases, gene screening, gene function assessment, and gene therapy (2, 3). In mammalian cells, RNAi is triggered by chemically or enzymatically synthesized RNA duplexes Address correspondence to Amol Ashok Sahare, Animal Biotechnology Centre, National Dairy Research Institute (NDRI), Karnal, Haryana 132001, India. E-mail: dramolsahare@ gmail.com Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/labt.
58
59
siRNA BASED INHIBITION OF IBD VIRUS
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
segment A (3.2 kb) encodes viral proteins VP2, VP3, VP4, and VP5. Among them, VP2 protein contains important neutralizing antigenic sites and elicits protective immune response (11). Hypervariable region of VP2 gene in which most of amino acid changes between antigenically different IBDVs are clustered is the obvious target for the molecular techniques. VP2 is the major structural protein involved in capsid formation, cell entry and induction of protective immune responses against the virus (12–14). The VP2 is also responsible for antigenic variation, tissue culture adaptation, and virulence (15). The goal of the current study was to identify the target sequence of VP2 gene for effective silencing and investigate the gene knockdown response of host cell against viral infection with relation to the silencing. MATERIALS AND METHODS Selection of Target Sites and shRNA Synthesis The sequence of VP2 gene of IBD virus (Georgia strain), retrieved from NCBI (accession no. EA267581) was used to design shRNA constructs against VP2 gene. The sequence was put in Dharmacon siDESIGN Center (www. dharmacon.com/sidesign/siRNA) to generate different siRNA target sequences. Among all siRNA, one siRNA (Table 1) was selected for experimental study (16). The siRNAs were converted to shRNA by using the Insert Design Tool for the pSilencer Vectors (http://www. ambion.com/techlib/misc/psilencer_converter.html). The same miRNA (miR-26b) derived loop sequence (TTCAAGAGA) was chosen for the shRNA (Fig. 1). This software tool generates siRNA into two linear nucleotide sequence, top and bottom strand. Few cytosine residues of the sense strand were changed to thymines, which facilitate stability of vector in bacteria along with reduced interferon response (5). For avoiding unwanted folding in antisense strand of the shRNA, the secondary structure was predicted by Vienna RNA Secondary Package (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi) (Fig. 2). Construction of shRNA Expressing Vector The shRNA template oligonucleotides (top and bottom strand) were dissolved in nuclease-free water and finally a
working solution of 1 mg=mL was prepared. These shRNA template oligonucleotides were annealed by gradual reduction in the temperature. For annealing the top and bottom strands, the annealing mixture was initially heated at 90 C for 3 minutes followed by gradual reduction in the temperature varying from 85 C to 45 C with 5 C decrement for 1 minute each. Finally, the mixture was incubated for 1 hour at 37 C. The shRNA annealed oligonucleotides were ligated into pSilencer 4.1-CMV neo vector (Ambion, USA) by T4 DNA ligase as recommended by the manufacturer (Fermentas). The ligated product was transformed into competent DH5a cells (E. coli host cell) by using heat shock method and designated as VP2shRNA. The transformed cells were grown over the LBagar plate containing ampicillin (50 mg=mL) as selectable marker. Single colonies were picked up and subcultured in fresh LB media. This was followed by the isolation of plasmid DNA. Viral Samples and Cultivation in Embryonated Chicken Eggs Bursa collected from suspected field samples were used for virus isolation. IBDV isolated from field samples and previously characterized in our lab was used as experimental virus in present study. The TCID50 of virus was 106. The 250 mL of virus suspension was inoculated in 9–11 days old embryonated chicken eggs by CAM route. The eggs were incubated for 48 hours in incubator. At 48-hour post inoculation, the embryos were chilled and the allantoic fluid was harvested, centrifuged at 5 000 rpm for 10 minutes and stored at 20 C. The allantoic fluid was collected and passaged five times. Georgia strain of IBD live vaccine (Indovax, India) was used as a reference strain for the entire study. RNA Extraction and Virus Confirmation in Field Samples RNA isolation was done by using TRIZOL (Sigma, U.S.A) reagent as per manufacturer’s instructions with some modifications. RNA was isolated from all processed field samples and one positive control i.e. Georgia strain of IBD live vaccine. Reverse transcription PCR (RT-PCR) was carried out following the standard protocol. The 20 mL
TABLE 1 siRNA sequences chosen to create shRNA sequences for targeting VP2gene (Accesion no. - EA267581) obtained from the Dharmacon siDESIGN Center (http://www.dharmacon.com/sidesign/) and their corresponding shRNA strand S. No.
siRNA sequence
1
siRNA-3
1
VP2-sh3
Region
Start position
GGTCAGGGCTAATTGTCTT ORF 158 shRNA sequence 50 -GATCC GGTTAGGGTTAATTGTCTT TTCAAGAGA AAGACAATTAGCCCTGACCCT A-30
60
A. A. SAHARE ET AL.
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
FIG. 1.
The linear representation of VP2 gene along with the shRNA targeting sites.
reaction volume comprising of 5 mL of total RNA, 1 mL random hexamer primer, 1 mL RNasin, and 1 mL MMuLV reverse transcriptase (MBI Fermentas, Germany) was finally added. The reaction mixture was incubated at 42 C for 1 hour, followed by incubation at 70 C for 10 minutes to arrest further enzyme activity. The virus was confirmed by PCR amplification of 480 bp VP2 gene fragment of IBDV. PCR amplification was conducted in 50 mL reaction volume with VP2F (ACAGGCCCAGAGTCTACACCATAA) and VP2R (ATCCTGTTGCCACTCTTTCGTAGG) primers. The initial denaturation of 95 C for 5 minutes followed by 34 cycles of denaturation, annealing and extension at 95 C=30 sec, 59 C=60 sec and 72 C=30 sec, respectively, and the final extension was carried out at 72 C=6 min. Development of Chicken Embryo Fibroblast Cell Line and Study of Cytopathic Effect The embryonated eggs were harvested and the embryo taken out. The appendages and viscera were removed after proper washing. Then remnant body was minced=cut into fine pieces by scissors and kept into 250 mL beaker with 10 mL PBS and 20 mL of 0.25% trypsin EDTA and stirred for 5 minutes at low speed (100 rpm). The supernatant was discarded and then 50 mL trypsin was added to pieces in the same beaker and stirred for 30 minutes. Trypsinized tissue was filtered with four-fold cheese cloth and 30 mL of growth media (DMEM þ 10%FBS) was added to the filtered solution. The filtrate was centrifuged and supernatant was discarded. The pellet was dissolved by adding 1 mL of growth medium. Cells were transferred in culture flask and growth media was added. Primary cell line was passaged when they attain 70%–80% confluency. Normal and confluent monolayer of CEF cells at 24 hours after subculturing was used for infection with field IBDV. The cell monolayer was washed twice with
FIG. 2. construct.
Secondary structures of complete hairpin of shRNA
prewarmed phosphate buffered saline (PBS). The CEF cells were infected by 0.5 mL of filtered IBDV. The virus suspension was overlaid uniformly over the monolayer and incubated at 37 C for 1 hour. One flask was kept as un-inoculated control. The 5 mL of maintenance medium was added to each flask after 1 hour incubation. Flasks were incubated at 37 C in 5% CO2. After 48 hours of incubation, infected monolayer was scrapped and this was used for subsequent monolayer infection. Cell monolayer was examined twice daily under inverted microscope for cytopathic effects (CPEs). Transfection and Virus Inhibition Assay For viral inhibition assay study four experimental cell groups were maintained. 1. The group containing only CEF without any treatment, 2. IBDV þ (CEF infected with IBDV) served as control, 3. Mock (CEF cells transfected with only transfecting reagent; lipofectamine and subsequently infected with IBDV), and 4. IBDV þ sh (CEF cells transfected with VP2-shRNA plasmid constructs and subsequently infected with IBDV). Twenty-four hours before transfection, approximately 3 105 CEF cells were plated in each well of a 12-well plate (Falcon, USA) and cultured in fresh DMEM without antibiotic so that there would be 70%–90% confluence on the day of transfection. Lipofectamine 2000 reagent (Invitrogen) was used as the transfection reagent. IBDV þ sh group was transfected with shRNA construct. Transfection was performed in the ratio of 1 mg of DNA: 3 mL of lipofectamine. The DNA lipofectamine complexes were then added to each well. Four hours post transfection; the cells were infected with cell culture adapted IBDV. The cultures were then incubated at 37 C, 5% CO2 in a humidified incubator for 1 hour. After 1 hour, virus containing media was replaced with fresh DMEMþ 10% FBSþ (50 mg=mL) Gentamycin. All wells were observed for CPE. After 48 hours incubation, total RNA was extracted using QuickRNA MiniPrep RNA isolation kit (ABI, USA) according to the manufacturer’s instructions and converted to cDNA for real time analysis of virus concentration in each well. Over all six transfection experiments were conducted to see the reproducibility.
61
siRNA BASED INHIBITION OF IBD VIRUS
TABLE 2 List of primer sequences used in real time PCR Primer set 1
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
2
Primer name
Length
Primer sequence (50 -30 )
Amplicon size (bp)
b-Actin-F b-Actin-R IBDVP2-RT-F1 IBDVP2-RT-R1
20 19 21 21
CCGTGCTGTGTTCCCATCTA TGGCCCATACCAACCATCA GGACACAGGGTCAGGGCTAAT GCAGTGTGTAGTGAGCACCCA
88
Quantitative Real-Time PCR Analysis for Virus Concentration and Interleukin Response Real-time PCR primers for detection of relative virus load among experimental groups were designed by using published sequence of VP2 gene of Georgia strain (accession no. EA267581), as this strain is being used as vaccine in India. b-actin gene of Gallus gallous was used as housekeeping gene in this experiment. To optimize the concentration of cDNA and primers (Table 2), real time PCR was performed with two-fold serial dilution of cDNA and different primer concentration, that is, 10 pmol, 5 pmol, and 2.5 pmol. Real-Time RT-PCR was performed by SYBR green chemistry (ABI, USA) using cDNA as template in ABI Prism 7300. Quantitative RT-PCR was performed using cDNA of all four experimental groups. The specificity of amplification during Real-Time RT-PCR was monitored by evaluating the melting curve. The Real Time PCR reaction contained SYBR master mix 6 ml, both the primers at 2.5 pmole concentration and template cDNA 100 ng, in 12 mL reaction volume. Each sample was run in triplicate. Calculation and Statistical Analysis The Pfaffl method (17) was used to calculate relative expression of all genes among four groups (48 hr post transfection), to b-Actin (a standard housekeeping gene that was chosen to normalize the Real Time RT- PCR data) and mock transfected cells to normalize the data. The fold change in relative gene expression levels was calculated. The mean Ct value for each group (N ¼ 3) was calculated. The Student’s t-test was performed to calculate the significant relative expression of genes in targeted samples. The experiments were repeated in triplicate and the standard deviations were calculated. Level of significance chosen to determine whether treatments were significantly different to control is P < 0.05. The standard error was determined using the fold change value of three replicates for each gene measured.
74
by amplification of VP2 gene specific 480 bp long fragment in RT-PCR (Fig. 3a). Cloning of shRNA Expression Vector and Screening of Transformed Colonies Bottom strand and top strand of shRNA were annealed. The shRNAs were designated as VP2-shRNA. These constructs were ligated in eukaryotic expression vector pSilencer 4.1 CMV neo vector to generate pVP2-shRNA. After transformation of JM109 competent cells with pVP2shRNA, transformed colonies could be seen after 18 hours. Confirmation of correct plasmid containing shRNA was done by amplification of 245 bp long plasmid specific product (Fig. 3b). Finally, the shRNA clone was confirmed by sequencing. No unwanted mutation was detected in generated sequence. Selection of Most Promising ant-VP2 shRNA Construct The CEF cell line was transfected with shRNA construct (pVP2-shRNA) in triplicate. A single peak in dissociation curve at 100 ng cDNA concentration and 2.5 pM primer was found optimum. When equal amounts of template cDNA (100 ng) were used for real time RT-PCR, it was found that b-Actin was uniformly expressed in all cDNA samples. Thus, it was not affected by varying the experimental conditions (treatments). This showed that b-Actin was good housekeeping gene in our experiment. The VP2-shRNA was evaluated for its knockdown
RESULTS Confirmation of IBDV by RT-PCR Amplification of VP2 Gene The IBDV already characterized in laboratory was used in present study. After five passages IBDV was confirmed
FIG. 3. (a) Agarose gel electrophoresis showing PCR amplification of VP2 gene of IBDV from field isolates. (b) Agarose gel electrophoresis showing Colony PCR amplified 245 bp shRNA along with vector sequence.
62
A. A. SAHARE ET AL.
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
efficiency and it was found that pVP2-shRNA construct was best among them. The shRNA target region in VP2 gene sequence was found to be the most effective site for gene silencing in IBDV. Hence, pVP2-shRNA was used for further experiment. Effect of the Anti-VP2 shRNA Expression Vector on IBD Virus Replication Viral Cytopathic Effects in Cell Culture Eight to ten day embryonated chicken eggs were chosen for CEF cell line development. Complete monolayer was set after 48 hours of initial cell seeding. Subculturing of these cells was done by trypsinization. CEF Cells with 90% confluency in the 3rd passage (Fig. 4a) were infected with IBD virus positive allantoic fluid. After the 2nd passage, the virus showed prominent cytopathic effects such as cellular detachment, vacuolation (Fig. 4b), and rounding of cells (Fig. 4c). CPEs in terms of cells death was observed maximum in control, that is, in IBDVþ cells (Fig. 5a), and mock transfected cells (Fig. 5b), whereas less CPEs were observed in IBDVþsh cells (Fig. 5c) 48-hours post-transfection. There was a visible difference between infected and transfected cells in terms of cells death. More death was seen in the infected cells as compared to VP2-shRNA transfected cells. Quantitative Real-Time PCR for VP2 Gene IBDVþsh group showed 95.0%, 91.5%, and 99.0% decrease in VP2 gene expression as compare to IBDVþ group in three different experiments. The ct values of
FIG. 4. Adaptation of field IBDV in CEF cells showing Cytopathic effects after 48 h of transfection. (a) Chicken embryo Fibroblast (CEF) cell line with 90% confluency; (b) Vacuolation following 2nd viral passage; and (c) Rounding of the cells following 2nd viral passage.
FIG. 5. Silencing effect of VP2 specific siRNA on IBDV VP2-shRNA expression after 48 of transfection. (a) Control: Virus infected CEF cells without VP2-shRNA transfection; (b) Mock transfection: IBDV infected CEF cells transfected with only transfecting reagent, Lipofectamine; and (c) Test: Virus infected CEF cells with VP2-shRNA transfection. b-actin in Real-Time PCR (average ct values of b-actin in IBDVþ group and IBDVþsh group were 18.81 and 18.82, respectively) showed that the decrease in VP2 mRNA was not result of poor transfection, nonspecific inhibition, or toxicity. The average ct values of b-actin in all experimental groups were consistent. All the experiments were repeated in triplicate. VP2 gene expression was significantly different in Mock, IBDVþ and IBDVþsh sh groups (P < 0.05) (Fig. 6).
FIG. 6. Quantitative analysis of silencing effect of VP2 specific siRNA on IBD-VP2shRNA expression. Expression was analyzed in IBDVþ cells, Mock and IBDVþshRNA cells. Error bars represent standard deviation. Expression of VP2 gene in IBDVþshRNA significantly different from IBDVþ cells.
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
siRNA BASED INHIBITION OF IBD VIRUS
DISCUSSION IBD causes bursal follicular lymphoid depletion, leading to significant reduction in humoral immune responses. IBDV infection apparently affects immature or precursor B cells to a greater extent than mature B-lymphocytes. Traditional IBD vaccines have focused on stimulating the B cells. However, recent studies that have focused on the importance of T cells in IBDV pathogenesis have shown that cell-mediated immunity may be more important in IBDV infections than previously thought (18, 19). RNAi can significantly suppress gene expression by inducing degradation of the target mRNA and by down regulating the level of the corresponding proteins when exogenous dsRNA are delivered into mammalian cells. As compared to the other knockdown strategies, RNAi is an efficient approach that provides information regarding gene function rapidly, easily, and inexpensively. This approach has been used for inhibiting both the viral protein synthesis and thereby viral titer. In recent days, the technique is frequently being used for several animal viral disease research procedures (IBV, IBDV, MDV, ALV, AIV, FMD, etc.) for better prevention, control, and treatment measures (20–25). Numerous scientific works have been published on direct delivery of siRNA or miRNA against viral infection. Delivery of siRNA through shRNA vector facilitates us with an unlimited supply of siRNA through one time cloning and further maintenance of shRNA clones in the lab. Many commonly used vector systems for expressing siRNA in cells use RNA polymerase III (RNA pol III) promoter such as U6 or H1. However, it has recently been shown that RNA polymerase II (RNA pol II) promoters are capable of expressing high levels of functional siRNA in cells (26). At the same time mammalian U6 and H1 are relatively weak promoters in avian cells (27). The pSilencer 4.1-CMV neo System employs a modified Cytomegalomavirus (CMV) promoter to drive expression with RNA pol II, and includes a modified simian virus-40 (SV40) polyadenylation signal downstream of the siRNA template to terminate transcription. As the VP2 protein of IBDV is crucial for virus particle formation, we selected the VP2 gene as the target for knockdown in present study. Also in present study, 95% down regulation of VP2 gene expression in IBDV infected cell line indicated that our VP2shRNA construct was specific and effective. Furthermore, this down regulation of VP2 gene expression in IBDVþsh group confirmed the physical observations of CPE. Wang et al. (28) have showed efficient IBDV inhibition by targeting VP2 gene through miRNA expressed under chicken U6 promotor. They found 76%–82% inhibition of VP2 gene. Gao et al. (8) have reported 87.4% inhibition of IBDV using mouse U6 promotor through shRNA by targeting VP1 gene. These findings further validated the interpretation that RNAi is one of the best strategies for IBDV control.
63
In conclusion, we can say that the vector-based RNAi effectively inhibits the IBDV replication in vitro. VP2 gene is a better target than VP1 gene for viral inhibition because of its unique component of icosahedral capsid and only viral protein recognized by neutralizing antibodies. Further studies are needed to test the potential of the shRNA to silence IBDV infection in vivo.
ACKNOWLEDGMENT The authors are thankful to the Director, Animal Biotechnology Center, MPPCVV, for providing the necessary facilities.
REFERENCES 1. Reddy YK, Koteeswaren A, Dorairajan N. Pattern of infectious bursal disease in commercial white leghorn chickens. Indian Vet J 1977; 74:1019–1021. 2. Barton GM. Viral recognition by Toll-like receptors. Semin Immunol 2007; 19:33–40. 3. Lee Y, Jeon K, Lee JT, Kim S, Kim VN. MicroRNA maturation: Stepwise processing and subcellular localization. EMBO J 2002; 21:4663–4670. 4. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001; 411:494–498. 5. Miyagishi M, Sumimoto H, Miyoshi H, Kawakami Y, Taira K. Optimization of an siRNA-expression system with an improved hairpin and its significant suppressive effects in mammalian cells. J Gene Med 2004; 6:715–723. 6. Rubinson DA, Dillon CP, Kwiatkowski AV, et al. A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet 2003; 33:401–406. 7. Yu JY, DeRuiter SL, Turner DL. RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci 2002; 99:6047–6052. 8. Gao Y, Liu W, Gao H, Qi X, Lin H, Wang X, Shen R. Effective inhibition of infectious bursal disease virus replication in vitro by DNA vector-based RNA interference. Antiviral Res 2008; 79:87–94. 9. Caplen NJ, Parrish S, Imani F, Fire A, Morgan RA. Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc Natl Acad Sci 2001; 98:9742–9747. 10. Lambeth LS, Zhao Y, Smith LP, Kgosana L, Nair V. Targeting Marek’s disease virus by RNA interference delivered from a herpesvirus vaccine. Vaccine 2009; 27:298–306. 11. Heine HG, Haritou M, Failla P, Fahey K, Azad A. Sequence analysis and expression of the host protective immonogen VP2 of a variant strain of infectious bursal disease virus which can circumbent vaccination with standard type 1 strains. J Gen Virol 1991; 72:1835–1843. 12. Bottcher B, Kiselev NA, Stel’Mashchuk VY, Perevozchikova NA, Borisov AV, Crowther RA. Three-dimensional structure
64
13.
14.
15.
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
16.
17. 18.
19.
20.
A. A. SAHARE ET AL. of infectious bursal disease virus determined by electron cryomicroscopy. J Virol 1997; 71:325–330. Caston, JR, Martinez-Torrecuadrada JL, Maraver A, et al. C-terminus of infectious bursal disease virus major capsid protein VP2 is involved in definition of the T number for capsid assembly. J Virol 2001; 75:10815–10828. Becht H, Mu¨ller H, Mu¨ller HK. Antigenic structure of the two serotypes of infectious bursal disease virus. J Gen Virol 1998; 69:631–640. Yamaguchi T, Ogawa M, Inoshima Y, Miyoshi M, Fukushi H, Hirai K. Identification of sequence changes responsible for the attenuation of highly virulent infectious bursal disease virus. Virology 1996; 223:219–223. Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS, Khvorova A. Rational siRNA design for RNA interference. Nat Biotechnol 2004; 22:326–330. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucl Acid Res 2001; 29:2002–2007. Rautenschlein S, Yeh HY, Sharma JM. The role of T cells in protection by an inactivated infectious bursal disease virus vaccine. Vet Immunol Immunopathol 2002; 89:159–167. Williams AE, Davison TF. Enhanced immunopathology induced by very virulent infectious bursal disease virus. Avian Pathol 2005; 34:4–14. Chen M, Granger AJ, VanBrocklin MW, et al. Inhibition of avian leukosis virus replication by vector-based RNA interference. Virology 2007; 365:464–472.
21. Chen W, Yan W, Zheng Z. Response to Bayry and Tough: Is RNAi useful for controlling foot-and-mouth disease outbreaks? Trends Immunol 2005; 26: 239–241. 22. Huang J, Jiang P, Li Y, Xu J, Jiang W, Wang X. Inhibition of porcine reproductive and respiratory syndrome virus replication by short hairpin RNA in MARC-145 cells. Vet Microbiol 2006; 115:302–310. 23. Li YC, Kong LH, Cheng BZ, Li KS. Construction of influenza virus siRNA expression vectors and their inhibitory effects on multiplication of influenza virus. Avian Dis 2005; 49:562–573. 24. Liu HL, Lu CP, Zhu WY. RNA Interference against avian infectious bronchitis virus. Virol Sin 2005; 20:272–276. 25. Liu M, Chen W, Ni Z, et al. Cross-inhibition to heterologous foot-and mouth disease virus infection induced by RNA interference targeting the conserved regions of viral genome. Virology 2005; 336:51–59. 26. Xia H, Mao Q, Paulson HL, Davidson BL. siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol 2002; 20:1006–1010. 27. Kudo T, Sutou S. Usage of putative chicken U6 promoters for vector-based RNA interference. J Reprod Dev 2005; 51:411–417. 28. Wang Y, Sun H, Shen P, Zhang X, Xia X, Xia B. Effective inhibition of replication of infectious bursal disease virus by miRNAs delivered by vectors and targeting the VP2 gene. J Virol Meth 2010; 165:127–132.
Animal Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/labt20
Inhibition of Infectious Bursal Disease Virus by Vector Delivered SiRNA in Cell Culture a
a
a
a
Amol Ashok Sahare , Megha Kadam Bedekar , Sudhir Kumar Jain , Azad Singh , Sanjeev a
Singh & Bikas Chandra Sarkhel
a
a
Animal Biotechnology Center, JNKVV Campus, Adhartal , Jabalpur , Madhya Pradesh , India Published online: 25 Aug 2014.
To cite this article: Amol Ashok Sahare , Megha Kadam Bedekar , Sudhir Kumar Jain , Azad Singh , Sanjeev Singh & Bikas Chandra Sarkhel (2015) Inhibition of Infectious Bursal Disease Virus by Vector Delivered SiRNA in Cell Culture, Animal Biotechnology, 26:1, 58-64, DOI: 10.1080/10495398.2014.886584 To link to this article: http://dx.doi.org/10.1080/10495398.2014.886584
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Animal Biotechnology, 26:58–64, 2015 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495398.2014.886584
Inhibition of Infectious Bursal Disease Virus by Vector Delivered SiRNA in Cell Culture Amol Ashok Sahare, Megha Kadam Bedekar, Sudhir Kumar Jain, Azad Singh, Sanjeev Singh, and Bikas Chandra Sarkhel
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
Animal Biotechnology Center, JNKVV Campus, Adhartal, Jabalpur, Madhya Pradesh, India Infectious Bursal Disease (IBD) is major threat to poultry industry. It causes severe immunosuppression and mortality in chicken generally at 3 to 6 weeks of age. RNA intereference (RNAi) emerges as a potent gene regulatory tool in last few years. The present study was conducted to evaluate the efficiency of RNAi to inhibit the IBD virus (IDBV) replication in-vitro. VP2 gene of virus encodes protein involved in capsid formation, cell entry and induction of protective immune responses against it. Thus, VP2 gene of IBDV is the candidate target for the molecular techniques applied for IBDV detection and inhibition assay. In this study, IBDV was isolated from field cases and confirmed by RT-PCR. The virus was then adapted on chicken embryo fibroblast cells (CEF) in which it showed severe cytopathic effects (CPE). The short hairpin RNA (shRNAs) constructs homologous to the VP2 gene were designed and one, having maximum score and fulfilling maximum Reynolds criteria, was selected for evaluation of effective inhibition. Selected shRNA construct (i.e., VP2-shRNA) was observed to be the most effective for inhibiting VP2 gene expression. Real time PCR analysis was performed to measure the relative expression of VP2 gene in different experimental groups. The VP2 gene was less expressed in virus infected cells co-transfected with VP2-shRNA as compared to mock transfected cells and IBDVþ cells (control) at dose 1.6 lg. The result showed 95% efficient down regulation of VP2 gene mRNA in VP2-shRNA treated cells. These findings suggested that designed shRNA construct achieved high level of inhibition of VP2 gene expression in-vitro. Keywords Cytopathic effects; Gene knockdown; iBD virus; Interleukin response; RNAi; VP2 gene
of 21–25 nt (4). As the effect of short interfering RNAs (siRNAs) is generally transient in transfected animal cells, small RNA expression vectors have been developed that express hairpin siRNA (also called short hairpin RNA or shRNA) to induce long-lasting RNA silencing in mammalian cells (5–7). shRNA have several advantages over siRNA and the cost is relatively cheap to that of chemically synthesized siRNA. Moreover, due to in-vitro transcription, the resultant siRNA produce less toxic effects and has good stability in host system. shRNA have high transfection efficiency and require a lesser amount to produce efficient silencing (8, 9). Again, the siRNA is unsuitable for large scale synthesis and long term research. Therefore in present investigation, as part of the development of viral vector-mediated RNAi strategy against IBD, the shRNA targeting VP2 sequence was selected and their inhibitory effects on viral gene expression and replication were investigated. Delivery of RNAi-based gene silencing through live attenuated vaccines for reducing replication of pathogenic viruses is a novel approach for the control of infectious diseases (10). IBDV has been recently classified as a member of the genus Avibirna virus of the family Birnaviridae. IBDV genome consists of two segments, A and B. The larger
Infectious bursal disease (IBD), popularly known as gumboro disease is a highly contagious, acute, viral disease of young chicken. The virus destroys the immature B-lymphocytes in the bursa of Febricius. The virus grows rapidly in the Bursa of Fabricius (BF) and the disease is characterized by acute onset, short course, and cause extensive destruction of B-lymphocytes (1). Hence, there is decrease in response to vaccines. Repeated incidences of vaccination failure and disease onset forced us to find some alternative strategy for viral inhibition. RNA interference (RNAi) is a naturally occurring post transcriptional gene silencing mechanism. As this technique is a simple and effective tool, it has replaced the gene knockout approach and is widely used in the study of viral diseases, gene screening, gene function assessment, and gene therapy (2, 3). In mammalian cells, RNAi is triggered by chemically or enzymatically synthesized RNA duplexes Address correspondence to Amol Ashok Sahare, Animal Biotechnology Centre, National Dairy Research Institute (NDRI), Karnal, Haryana 132001, India. E-mail: dramolsahare@ gmail.com Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/labt.
58
59
siRNA BASED INHIBITION OF IBD VIRUS
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
segment A (3.2 kb) encodes viral proteins VP2, VP3, VP4, and VP5. Among them, VP2 protein contains important neutralizing antigenic sites and elicits protective immune response (11). Hypervariable region of VP2 gene in which most of amino acid changes between antigenically different IBDVs are clustered is the obvious target for the molecular techniques. VP2 is the major structural protein involved in capsid formation, cell entry and induction of protective immune responses against the virus (12–14). The VP2 is also responsible for antigenic variation, tissue culture adaptation, and virulence (15). The goal of the current study was to identify the target sequence of VP2 gene for effective silencing and investigate the gene knockdown response of host cell against viral infection with relation to the silencing. MATERIALS AND METHODS Selection of Target Sites and shRNA Synthesis The sequence of VP2 gene of IBD virus (Georgia strain), retrieved from NCBI (accession no. EA267581) was used to design shRNA constructs against VP2 gene. The sequence was put in Dharmacon siDESIGN Center (www. dharmacon.com/sidesign/siRNA) to generate different siRNA target sequences. Among all siRNA, one siRNA (Table 1) was selected for experimental study (16). The siRNAs were converted to shRNA by using the Insert Design Tool for the pSilencer Vectors (http://www. ambion.com/techlib/misc/psilencer_converter.html). The same miRNA (miR-26b) derived loop sequence (TTCAAGAGA) was chosen for the shRNA (Fig. 1). This software tool generates siRNA into two linear nucleotide sequence, top and bottom strand. Few cytosine residues of the sense strand were changed to thymines, which facilitate stability of vector in bacteria along with reduced interferon response (5). For avoiding unwanted folding in antisense strand of the shRNA, the secondary structure was predicted by Vienna RNA Secondary Package (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi) (Fig. 2). Construction of shRNA Expressing Vector The shRNA template oligonucleotides (top and bottom strand) were dissolved in nuclease-free water and finally a
working solution of 1 mg=mL was prepared. These shRNA template oligonucleotides were annealed by gradual reduction in the temperature. For annealing the top and bottom strands, the annealing mixture was initially heated at 90 C for 3 minutes followed by gradual reduction in the temperature varying from 85 C to 45 C with 5 C decrement for 1 minute each. Finally, the mixture was incubated for 1 hour at 37 C. The shRNA annealed oligonucleotides were ligated into pSilencer 4.1-CMV neo vector (Ambion, USA) by T4 DNA ligase as recommended by the manufacturer (Fermentas). The ligated product was transformed into competent DH5a cells (E. coli host cell) by using heat shock method and designated as VP2shRNA. The transformed cells were grown over the LBagar plate containing ampicillin (50 mg=mL) as selectable marker. Single colonies were picked up and subcultured in fresh LB media. This was followed by the isolation of plasmid DNA. Viral Samples and Cultivation in Embryonated Chicken Eggs Bursa collected from suspected field samples were used for virus isolation. IBDV isolated from field samples and previously characterized in our lab was used as experimental virus in present study. The TCID50 of virus was 106. The 250 mL of virus suspension was inoculated in 9–11 days old embryonated chicken eggs by CAM route. The eggs were incubated for 48 hours in incubator. At 48-hour post inoculation, the embryos were chilled and the allantoic fluid was harvested, centrifuged at 5 000 rpm for 10 minutes and stored at 20 C. The allantoic fluid was collected and passaged five times. Georgia strain of IBD live vaccine (Indovax, India) was used as a reference strain for the entire study. RNA Extraction and Virus Confirmation in Field Samples RNA isolation was done by using TRIZOL (Sigma, U.S.A) reagent as per manufacturer’s instructions with some modifications. RNA was isolated from all processed field samples and one positive control i.e. Georgia strain of IBD live vaccine. Reverse transcription PCR (RT-PCR) was carried out following the standard protocol. The 20 mL
TABLE 1 siRNA sequences chosen to create shRNA sequences for targeting VP2gene (Accesion no. - EA267581) obtained from the Dharmacon siDESIGN Center (http://www.dharmacon.com/sidesign/) and their corresponding shRNA strand S. No.
siRNA sequence
1
siRNA-3
1
VP2-sh3
Region
Start position
GGTCAGGGCTAATTGTCTT ORF 158 shRNA sequence 50 -GATCC GGTTAGGGTTAATTGTCTT TTCAAGAGA AAGACAATTAGCCCTGACCCT A-30
60
A. A. SAHARE ET AL.
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
FIG. 1.
The linear representation of VP2 gene along with the shRNA targeting sites.
reaction volume comprising of 5 mL of total RNA, 1 mL random hexamer primer, 1 mL RNasin, and 1 mL MMuLV reverse transcriptase (MBI Fermentas, Germany) was finally added. The reaction mixture was incubated at 42 C for 1 hour, followed by incubation at 70 C for 10 minutes to arrest further enzyme activity. The virus was confirmed by PCR amplification of 480 bp VP2 gene fragment of IBDV. PCR amplification was conducted in 50 mL reaction volume with VP2F (ACAGGCCCAGAGTCTACACCATAA) and VP2R (ATCCTGTTGCCACTCTTTCGTAGG) primers. The initial denaturation of 95 C for 5 minutes followed by 34 cycles of denaturation, annealing and extension at 95 C=30 sec, 59 C=60 sec and 72 C=30 sec, respectively, and the final extension was carried out at 72 C=6 min. Development of Chicken Embryo Fibroblast Cell Line and Study of Cytopathic Effect The embryonated eggs were harvested and the embryo taken out. The appendages and viscera were removed after proper washing. Then remnant body was minced=cut into fine pieces by scissors and kept into 250 mL beaker with 10 mL PBS and 20 mL of 0.25% trypsin EDTA and stirred for 5 minutes at low speed (100 rpm). The supernatant was discarded and then 50 mL trypsin was added to pieces in the same beaker and stirred for 30 minutes. Trypsinized tissue was filtered with four-fold cheese cloth and 30 mL of growth media (DMEM þ 10%FBS) was added to the filtered solution. The filtrate was centrifuged and supernatant was discarded. The pellet was dissolved by adding 1 mL of growth medium. Cells were transferred in culture flask and growth media was added. Primary cell line was passaged when they attain 70%–80% confluency. Normal and confluent monolayer of CEF cells at 24 hours after subculturing was used for infection with field IBDV. The cell monolayer was washed twice with
FIG. 2. construct.
Secondary structures of complete hairpin of shRNA
prewarmed phosphate buffered saline (PBS). The CEF cells were infected by 0.5 mL of filtered IBDV. The virus suspension was overlaid uniformly over the monolayer and incubated at 37 C for 1 hour. One flask was kept as un-inoculated control. The 5 mL of maintenance medium was added to each flask after 1 hour incubation. Flasks were incubated at 37 C in 5% CO2. After 48 hours of incubation, infected monolayer was scrapped and this was used for subsequent monolayer infection. Cell monolayer was examined twice daily under inverted microscope for cytopathic effects (CPEs). Transfection and Virus Inhibition Assay For viral inhibition assay study four experimental cell groups were maintained. 1. The group containing only CEF without any treatment, 2. IBDV þ (CEF infected with IBDV) served as control, 3. Mock (CEF cells transfected with only transfecting reagent; lipofectamine and subsequently infected with IBDV), and 4. IBDV þ sh (CEF cells transfected with VP2-shRNA plasmid constructs and subsequently infected with IBDV). Twenty-four hours before transfection, approximately 3 105 CEF cells were plated in each well of a 12-well plate (Falcon, USA) and cultured in fresh DMEM without antibiotic so that there would be 70%–90% confluence on the day of transfection. Lipofectamine 2000 reagent (Invitrogen) was used as the transfection reagent. IBDV þ sh group was transfected with shRNA construct. Transfection was performed in the ratio of 1 mg of DNA: 3 mL of lipofectamine. The DNA lipofectamine complexes were then added to each well. Four hours post transfection; the cells were infected with cell culture adapted IBDV. The cultures were then incubated at 37 C, 5% CO2 in a humidified incubator for 1 hour. After 1 hour, virus containing media was replaced with fresh DMEMþ 10% FBSþ (50 mg=mL) Gentamycin. All wells were observed for CPE. After 48 hours incubation, total RNA was extracted using QuickRNA MiniPrep RNA isolation kit (ABI, USA) according to the manufacturer’s instructions and converted to cDNA for real time analysis of virus concentration in each well. Over all six transfection experiments were conducted to see the reproducibility.
61
siRNA BASED INHIBITION OF IBD VIRUS
TABLE 2 List of primer sequences used in real time PCR Primer set 1
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
2
Primer name
Length
Primer sequence (50 -30 )
Amplicon size (bp)
b-Actin-F b-Actin-R IBDVP2-RT-F1 IBDVP2-RT-R1
20 19 21 21
CCGTGCTGTGTTCCCATCTA TGGCCCATACCAACCATCA GGACACAGGGTCAGGGCTAAT GCAGTGTGTAGTGAGCACCCA
88
Quantitative Real-Time PCR Analysis for Virus Concentration and Interleukin Response Real-time PCR primers for detection of relative virus load among experimental groups were designed by using published sequence of VP2 gene of Georgia strain (accession no. EA267581), as this strain is being used as vaccine in India. b-actin gene of Gallus gallous was used as housekeeping gene in this experiment. To optimize the concentration of cDNA and primers (Table 2), real time PCR was performed with two-fold serial dilution of cDNA and different primer concentration, that is, 10 pmol, 5 pmol, and 2.5 pmol. Real-Time RT-PCR was performed by SYBR green chemistry (ABI, USA) using cDNA as template in ABI Prism 7300. Quantitative RT-PCR was performed using cDNA of all four experimental groups. The specificity of amplification during Real-Time RT-PCR was monitored by evaluating the melting curve. The Real Time PCR reaction contained SYBR master mix 6 ml, both the primers at 2.5 pmole concentration and template cDNA 100 ng, in 12 mL reaction volume. Each sample was run in triplicate. Calculation and Statistical Analysis The Pfaffl method (17) was used to calculate relative expression of all genes among four groups (48 hr post transfection), to b-Actin (a standard housekeeping gene that was chosen to normalize the Real Time RT- PCR data) and mock transfected cells to normalize the data. The fold change in relative gene expression levels was calculated. The mean Ct value for each group (N ¼ 3) was calculated. The Student’s t-test was performed to calculate the significant relative expression of genes in targeted samples. The experiments were repeated in triplicate and the standard deviations were calculated. Level of significance chosen to determine whether treatments were significantly different to control is P < 0.05. The standard error was determined using the fold change value of three replicates for each gene measured.
74
by amplification of VP2 gene specific 480 bp long fragment in RT-PCR (Fig. 3a). Cloning of shRNA Expression Vector and Screening of Transformed Colonies Bottom strand and top strand of shRNA were annealed. The shRNAs were designated as VP2-shRNA. These constructs were ligated in eukaryotic expression vector pSilencer 4.1 CMV neo vector to generate pVP2-shRNA. After transformation of JM109 competent cells with pVP2shRNA, transformed colonies could be seen after 18 hours. Confirmation of correct plasmid containing shRNA was done by amplification of 245 bp long plasmid specific product (Fig. 3b). Finally, the shRNA clone was confirmed by sequencing. No unwanted mutation was detected in generated sequence. Selection of Most Promising ant-VP2 shRNA Construct The CEF cell line was transfected with shRNA construct (pVP2-shRNA) in triplicate. A single peak in dissociation curve at 100 ng cDNA concentration and 2.5 pM primer was found optimum. When equal amounts of template cDNA (100 ng) were used for real time RT-PCR, it was found that b-Actin was uniformly expressed in all cDNA samples. Thus, it was not affected by varying the experimental conditions (treatments). This showed that b-Actin was good housekeeping gene in our experiment. The VP2-shRNA was evaluated for its knockdown
RESULTS Confirmation of IBDV by RT-PCR Amplification of VP2 Gene The IBDV already characterized in laboratory was used in present study. After five passages IBDV was confirmed
FIG. 3. (a) Agarose gel electrophoresis showing PCR amplification of VP2 gene of IBDV from field isolates. (b) Agarose gel electrophoresis showing Colony PCR amplified 245 bp shRNA along with vector sequence.
62
A. A. SAHARE ET AL.
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
efficiency and it was found that pVP2-shRNA construct was best among them. The shRNA target region in VP2 gene sequence was found to be the most effective site for gene silencing in IBDV. Hence, pVP2-shRNA was used for further experiment. Effect of the Anti-VP2 shRNA Expression Vector on IBD Virus Replication Viral Cytopathic Effects in Cell Culture Eight to ten day embryonated chicken eggs were chosen for CEF cell line development. Complete monolayer was set after 48 hours of initial cell seeding. Subculturing of these cells was done by trypsinization. CEF Cells with 90% confluency in the 3rd passage (Fig. 4a) were infected with IBD virus positive allantoic fluid. After the 2nd passage, the virus showed prominent cytopathic effects such as cellular detachment, vacuolation (Fig. 4b), and rounding of cells (Fig. 4c). CPEs in terms of cells death was observed maximum in control, that is, in IBDVþ cells (Fig. 5a), and mock transfected cells (Fig. 5b), whereas less CPEs were observed in IBDVþsh cells (Fig. 5c) 48-hours post-transfection. There was a visible difference between infected and transfected cells in terms of cells death. More death was seen in the infected cells as compared to VP2-shRNA transfected cells. Quantitative Real-Time PCR for VP2 Gene IBDVþsh group showed 95.0%, 91.5%, and 99.0% decrease in VP2 gene expression as compare to IBDVþ group in three different experiments. The ct values of
FIG. 4. Adaptation of field IBDV in CEF cells showing Cytopathic effects after 48 h of transfection. (a) Chicken embryo Fibroblast (CEF) cell line with 90% confluency; (b) Vacuolation following 2nd viral passage; and (c) Rounding of the cells following 2nd viral passage.
FIG. 5. Silencing effect of VP2 specific siRNA on IBDV VP2-shRNA expression after 48 of transfection. (a) Control: Virus infected CEF cells without VP2-shRNA transfection; (b) Mock transfection: IBDV infected CEF cells transfected with only transfecting reagent, Lipofectamine; and (c) Test: Virus infected CEF cells with VP2-shRNA transfection. b-actin in Real-Time PCR (average ct values of b-actin in IBDVþ group and IBDVþsh group were 18.81 and 18.82, respectively) showed that the decrease in VP2 mRNA was not result of poor transfection, nonspecific inhibition, or toxicity. The average ct values of b-actin in all experimental groups were consistent. All the experiments were repeated in triplicate. VP2 gene expression was significantly different in Mock, IBDVþ and IBDVþsh sh groups (P < 0.05) (Fig. 6).
FIG. 6. Quantitative analysis of silencing effect of VP2 specific siRNA on IBD-VP2shRNA expression. Expression was analyzed in IBDVþ cells, Mock and IBDVþshRNA cells. Error bars represent standard deviation. Expression of VP2 gene in IBDVþshRNA significantly different from IBDVþ cells.
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
siRNA BASED INHIBITION OF IBD VIRUS
DISCUSSION IBD causes bursal follicular lymphoid depletion, leading to significant reduction in humoral immune responses. IBDV infection apparently affects immature or precursor B cells to a greater extent than mature B-lymphocytes. Traditional IBD vaccines have focused on stimulating the B cells. However, recent studies that have focused on the importance of T cells in IBDV pathogenesis have shown that cell-mediated immunity may be more important in IBDV infections than previously thought (18, 19). RNAi can significantly suppress gene expression by inducing degradation of the target mRNA and by down regulating the level of the corresponding proteins when exogenous dsRNA are delivered into mammalian cells. As compared to the other knockdown strategies, RNAi is an efficient approach that provides information regarding gene function rapidly, easily, and inexpensively. This approach has been used for inhibiting both the viral protein synthesis and thereby viral titer. In recent days, the technique is frequently being used for several animal viral disease research procedures (IBV, IBDV, MDV, ALV, AIV, FMD, etc.) for better prevention, control, and treatment measures (20–25). Numerous scientific works have been published on direct delivery of siRNA or miRNA against viral infection. Delivery of siRNA through shRNA vector facilitates us with an unlimited supply of siRNA through one time cloning and further maintenance of shRNA clones in the lab. Many commonly used vector systems for expressing siRNA in cells use RNA polymerase III (RNA pol III) promoter such as U6 or H1. However, it has recently been shown that RNA polymerase II (RNA pol II) promoters are capable of expressing high levels of functional siRNA in cells (26). At the same time mammalian U6 and H1 are relatively weak promoters in avian cells (27). The pSilencer 4.1-CMV neo System employs a modified Cytomegalomavirus (CMV) promoter to drive expression with RNA pol II, and includes a modified simian virus-40 (SV40) polyadenylation signal downstream of the siRNA template to terminate transcription. As the VP2 protein of IBDV is crucial for virus particle formation, we selected the VP2 gene as the target for knockdown in present study. Also in present study, 95% down regulation of VP2 gene expression in IBDV infected cell line indicated that our VP2shRNA construct was specific and effective. Furthermore, this down regulation of VP2 gene expression in IBDVþsh group confirmed the physical observations of CPE. Wang et al. (28) have showed efficient IBDV inhibition by targeting VP2 gene through miRNA expressed under chicken U6 promotor. They found 76%–82% inhibition of VP2 gene. Gao et al. (8) have reported 87.4% inhibition of IBDV using mouse U6 promotor through shRNA by targeting VP1 gene. These findings further validated the interpretation that RNAi is one of the best strategies for IBDV control.
63
In conclusion, we can say that the vector-based RNAi effectively inhibits the IBDV replication in vitro. VP2 gene is a better target than VP1 gene for viral inhibition because of its unique component of icosahedral capsid and only viral protein recognized by neutralizing antibodies. Further studies are needed to test the potential of the shRNA to silence IBDV infection in vivo.
ACKNOWLEDGMENT The authors are thankful to the Director, Animal Biotechnology Center, MPPCVV, for providing the necessary facilities.
REFERENCES 1. Reddy YK, Koteeswaren A, Dorairajan N. Pattern of infectious bursal disease in commercial white leghorn chickens. Indian Vet J 1977; 74:1019–1021. 2. Barton GM. Viral recognition by Toll-like receptors. Semin Immunol 2007; 19:33–40. 3. Lee Y, Jeon K, Lee JT, Kim S, Kim VN. MicroRNA maturation: Stepwise processing and subcellular localization. EMBO J 2002; 21:4663–4670. 4. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001; 411:494–498. 5. Miyagishi M, Sumimoto H, Miyoshi H, Kawakami Y, Taira K. Optimization of an siRNA-expression system with an improved hairpin and its significant suppressive effects in mammalian cells. J Gene Med 2004; 6:715–723. 6. Rubinson DA, Dillon CP, Kwiatkowski AV, et al. A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet 2003; 33:401–406. 7. Yu JY, DeRuiter SL, Turner DL. RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci 2002; 99:6047–6052. 8. Gao Y, Liu W, Gao H, Qi X, Lin H, Wang X, Shen R. Effective inhibition of infectious bursal disease virus replication in vitro by DNA vector-based RNA interference. Antiviral Res 2008; 79:87–94. 9. Caplen NJ, Parrish S, Imani F, Fire A, Morgan RA. Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc Natl Acad Sci 2001; 98:9742–9747. 10. Lambeth LS, Zhao Y, Smith LP, Kgosana L, Nair V. Targeting Marek’s disease virus by RNA interference delivered from a herpesvirus vaccine. Vaccine 2009; 27:298–306. 11. Heine HG, Haritou M, Failla P, Fahey K, Azad A. Sequence analysis and expression of the host protective immonogen VP2 of a variant strain of infectious bursal disease virus which can circumbent vaccination with standard type 1 strains. J Gen Virol 1991; 72:1835–1843. 12. Bottcher B, Kiselev NA, Stel’Mashchuk VY, Perevozchikova NA, Borisov AV, Crowther RA. Three-dimensional structure
64
13.
14.
15.
Downloaded by [Ondokuz Mayis Universitesine] at 06:08 07 November 2014
16.
17. 18.
19.
20.
A. A. SAHARE ET AL. of infectious bursal disease virus determined by electron cryomicroscopy. J Virol 1997; 71:325–330. Caston, JR, Martinez-Torrecuadrada JL, Maraver A, et al. C-terminus of infectious bursal disease virus major capsid protein VP2 is involved in definition of the T number for capsid assembly. J Virol 2001; 75:10815–10828. Becht H, Mu¨ller H, Mu¨ller HK. Antigenic structure of the two serotypes of infectious bursal disease virus. J Gen Virol 1998; 69:631–640. Yamaguchi T, Ogawa M, Inoshima Y, Miyoshi M, Fukushi H, Hirai K. Identification of sequence changes responsible for the attenuation of highly virulent infectious bursal disease virus. Virology 1996; 223:219–223. Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS, Khvorova A. Rational siRNA design for RNA interference. Nat Biotechnol 2004; 22:326–330. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucl Acid Res 2001; 29:2002–2007. Rautenschlein S, Yeh HY, Sharma JM. The role of T cells in protection by an inactivated infectious bursal disease virus vaccine. Vet Immunol Immunopathol 2002; 89:159–167. Williams AE, Davison TF. Enhanced immunopathology induced by very virulent infectious bursal disease virus. Avian Pathol 2005; 34:4–14. Chen M, Granger AJ, VanBrocklin MW, et al. Inhibition of avian leukosis virus replication by vector-based RNA interference. Virology 2007; 365:464–472.
21. Chen W, Yan W, Zheng Z. Response to Bayry and Tough: Is RNAi useful for controlling foot-and-mouth disease outbreaks? Trends Immunol 2005; 26: 239–241. 22. Huang J, Jiang P, Li Y, Xu J, Jiang W, Wang X. Inhibition of porcine reproductive and respiratory syndrome virus replication by short hairpin RNA in MARC-145 cells. Vet Microbiol 2006; 115:302–310. 23. Li YC, Kong LH, Cheng BZ, Li KS. Construction of influenza virus siRNA expression vectors and their inhibitory effects on multiplication of influenza virus. Avian Dis 2005; 49:562–573. 24. Liu HL, Lu CP, Zhu WY. RNA Interference against avian infectious bronchitis virus. Virol Sin 2005; 20:272–276. 25. Liu M, Chen W, Ni Z, et al. Cross-inhibition to heterologous foot-and mouth disease virus infection induced by RNA interference targeting the conserved regions of viral genome. Virology 2005; 336:51–59. 26. Xia H, Mao Q, Paulson HL, Davidson BL. siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol 2002; 20:1006–1010. 27. Kudo T, Sutou S. Usage of putative chicken U6 promoters for vector-based RNA interference. J Reprod Dev 2005; 51:411–417. 28. Wang Y, Sun H, Shen P, Zhang X, Xia X, Xia B. Effective inhibition of replication of infectious bursal disease virus by miRNAs delivered by vectors and targeting the VP2 gene. J Virol Meth 2010; 165:127–132.
