Mol Cell Biochem (2014) 395:291–298 DOI 10.1007/s11010-014-2130-3
Inhibition of Notch signaling facilitates the differentiation of human-induced pluripotent stem cells into neural stem cells Chun-Yuan Chen • Wei Liao • Yuan-Lei Lou • Qing Li • Bin Hu • Yang Wang • Zhi-Feng Deng
Received: 14 March 2014 / Accepted: 17 June 2014 / Published online: 28 June 2014 Ó Springer Science+Business Media New York 2014
Abstract Neural stem cells (NSCs) derived from induced pluripotent stem cells (iPSCs) are becoming an appealing source of cell-based therapies of brain diseases. As such, it is important to understand the molecular mechanisms that regulate the differentiation of iPSCs toward NSCs. It is well known that Notch signaling governs the retention of stem cell features and drives stem cells fate. However, further studies are required to investigate the role of Notch signaling in the NSCs differentiation of iPSCs. In this study, we successfully generated NSCs from human iPSCs using serum-free medium supplemented with retinoic acid (RA) in vitro. We then assessed changes in the expression of Notch signaling-related molecules and some miRNAs (9, 34a, 200b), which exert their regulation by targeting Notch signaling. Moreover, we used a c-secretase inhibitor (DAPT) to disturb Notch signaling. Data revealed that the levels of the Notch signaling-related molecules decreased, whereas those miRNAs increased, during this Chun-Yuan Chen and Wei Liao are contributed equally to this work. C.-Y. Chen W. Liao Graduate School of Nanchang University, Nanchang 330006, China Y.-L. Lou Institute of Urology, The First Affiliated Hospital of Nanchang University, Nanchang 330006, China Q. Li B. Hu Y. Wang (&) Institute of Orthopaedic Surgery, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Shanghai 200233, China e-mail: [email protected] Z.-F. Deng (&) Department of Neurosurgery, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Shanghai 200233, China e-mail: [email protected]
differentiation process. Inhibition of Notch signaling accelerated the formation of the neural rosette structures and the expression of NSC and mature neurocyte marker genes. This suggests that Notch signaling negatively regulated the neuralization of human iPSCs, and that this process may be regulated by some miRNAs. Keywords Induced pluripotent stem cell Neural stem cell Differentiation Notch signaling microRNA
Introduction Induced pluripotent stem cells (iPSCs) can be produced by the reprogramming of somatic cells using the delivery of defined combinations of transcription factors. Similar to embryonic stem cells (ESCs), iPSCs have the potential to generate all cell types of three germ layers, but without ethical considerations. These features, along with their availability and the lack of requirement for embryonal tissues, make iPSCs an appealing source of cell-based therapies. It was demonstrated that iPSCs-derived NSCs could improve neurologic function in conditions including Parkinson’s disease [1], middle cerebral artery occlusion [2], and stroke [3], highlighting the broad potential of iPSCs for the treatment of neurological insults. The Notch signaling pathway plays a major role in boosting self-renewal and deciding the cell fate of ESCs and other stem cells during development [4–8]. Previous studies reported that Notch signaling was involved in the maintenance of neural stem cell-like features [9, 10]. Inhibiting Notch signaling could reduce the expression of NSC markers and the proliferation potential in neuroectodermal spheres (NESs) that were derived from human ESCs [10]. Similarly, the inactivation of Notch-regulated
123
292
genes, such as Hes1, could induce premature neuronal differentiation during brain development [11, 12]. Nevertheless, further studies are required to investigate whether Notch signaling has a role in the differentiation of iPSCs toward NSCs. Emerging evidence has demonstrated that microRNAs (miRNAs), which are non-coding small RNAs, *20–25 nucleotides in length, can regulate gene expression by modulating translation or the stability of mRNAs [13]. They participate in diverse biological processes including cell proliferation, differentiation, and apoptosis [14–18]. Some miRNAs cross talk with the Notch signaling pathway. Several important miRNAs including miR-9, miR34a, and miR-200b play roles in neurogenesis, cancer pathogenesis, invasion, metastasis, and the epithelial-mesenchymal transition (EMT) by targeting the Notch signaling pathway [19–27]. However, it is unclear whether these Notch-related miRNAs are involved in the differentiation of iPSC toward NSC. In this study, we generated NSCs derived from human iPSCs in a four-stage culture system using serum-free medium supplemented with retinoic acid (RA): an effective method to obtain iPSCs-derived NSCs in vitro [2]. We then detected changes in the expression of Notch signaling markers and miRNAs that target Notch signaling. Furthermore, we used a c-secretase inhibitor to interfere with Notch signaling to investigate the role of Notch in the NSCs differentiation of iPSCs. Our results indicate that Notch signaling plays an inhibitory role in deciding cell fate during the differentiation process, and that this may be regulated by some miRNAs.
Materials and methods Human iPSCs culture Human iPSCs (iPS-S-01) were provided by the Liao J and Xiao L group at the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences [28]. The iPSCs were maintained on a mouse embryonic fibroblast (MEF) feeder layer inactivated by mitomycin in iPSC medium. The culture of human iPSCs followed the protocol described previously [2]. Human iPSCs were cultured in KnockoutTM DMEM medium containing 20 % KnockOutTM serum replacement, 1 % nonessential amino acid, 1 mM L-glutamine, 4 ng/mL bFGF, and 0.1 mM bmercaptoethanol (Gibco, Grand Island, NY, USA). Generation of iPSCs-derived NSCs The production of NSCs followed the protocol described previously [2]. Colonies of iPSC (labeled D0) were
123
Mol Cell Biochem (2014) 395:291–298
resuspended with embryoid body (EB) medium (iPSC media without bFGF) for 4 days (D4) and grown into EBs (stage 1). The EBs were cultured in EB media supplied with 5 9 10-7 M RA for 4 days (D8), and then transferred to serum-free media for 7 days (stage 2). Some cells suspended and grew (stage 3). The suspended cells were plated on poly-1-ornithine/laminin-coated dishes in the serum-free media for adhesion for 7 days (D22) (stage 4). These induced cells were dissociated at 1:3 to 1:4 ratio using Accutase (a cell-detachment solution) every 5 to 7 days. The medium was changed every day at all stages.
Notch signaling inhibition N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycinet-butyl ester (DAPT; 10 lM; Sigma), a c-secretase inhibitor by specifically binding to Presenilin-1 (PS1) to block Notch cleavage [29], was added to EB medium containing RA for 4 days (RA ? DAPT). Subsequent procedures were performed as above-described (stage 2–4). A group of cells treated with DMSO supplemented with RA was labeled ‘‘RA ? DMSO’’ or ‘‘control’’.
Quantitative real-time PCR analysis (qRT-PCR) Total RNAs were extracted using TRIzol Reagent (Invitrogen, USA). The expression of the corresponding RNAs was analyzed using the Revert Aid first-strand cDNA synthesis kit (Fermentas, Life Sciences, Burlington, Canada) following the manufacturer’s protocol. qRT-PCR analysis was performed using an ABI PRISMÒ7900HT Fast Real-Time PCR System with SYBR Premix Ex TaqTM II (Takara Biotechnology, Japan). All values were normalized using an internal reference (U6, for miRNAs; and GAPDH, for Notch1, Hes1, and neural markers). Relative expression was estimated by the comparative Ct method (2-44Ct). A 2-44Ct [ 3 or \0.3 was deemed to indicate statistical significance. All primers are shown in Table 1.
Immunocytochemistry The levels of neural lineage markers were assessed using immunocytochemistry as described previously [2]. Primary antibodies were used as follows: anti-Nestin, anti-glial fibrillary acidic protein (GFAP) (monoclonal, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-Sox2 (monoclonal, Cell Signaling, Danvers, MA, USA), and anti-betaTubulin III (monoclonal, Chemicon, Billerica, MA, USA). All secondary antibodies (Santa Cruz, USA) were labeled with Alexa Fluor 594 or FITC (Invitrogen, USA).
Mol Cell Biochem (2014) 395:291–298
293
Table 1 Primers used for real-time fluorescence quantitative PCR (RT-PCR) analysis Genes
Forward Primer (50 -30 )
Reverse Primer (50 -30 )
miR-9
TCGCGGTCTTTGGTTATCTAGCT
miR-34a
CCCGTTGGCAGTGTCTTAGCT
miR-200b
TGGCGGTAATACTGCCTGGTAA
Notch1
TCGGAGTGTGTATGCCAAGAGT
TAACCAACGAACAACTCATAATACTGAAC
Hes1
AAACACTGATTTTGGATGCTCTGAAG
TAGCCGGCCTGTCCAGCCTG
Nestin
GCCCTGACCACTCCAGTTTAG
CCCTCTATGGCTGTTTCTTTCTCTAC
GFAP
GAAGCTCCAGGATGAAACCA
ACCTCCTCCTCGTGGATCTT
b-tubulin I
CTGGTGGAGAACACGGATGAG
GCGGAAGCAGATGTCGTAGAG
GAPDH
TGCACCACCAACTGCTTAGC
GGCATGGACTGTGGTCATGAG
U6
CTCGCTTCGGCAGCACA
AACGCTTCACGAATTTGCGT
Western blotting Total proteins were extracted using Protein Extraction Reagent Kit (Takara Biotechnology, China). Proteins (30 lg) were separated by SDS-PAGE (5 % spacer gel and 10 % separation gel) and transferred to nitrocellulose membranes. Membranes were then incubated with TBST (10 mM Tris–HCl pH 7.5, 150 mM NaCl) containing 5 % non-fat dry milk and 0.1 % Tween-20 to block non-specific sites for 1 h, before incubation with primary antibodies (diluted by TBST) at 4 °C overnight. Membranes were then washed using TBST for 5 min, which was repeated three times. Incubations with secondary antibodies (diluted by TBST) were then performed at 37 °C for 1 h, and signals were visualized using enhanced chemiluminescence reagent (Pierce, USA). After exposure, developing, and fixing, images were analyzed using an image analysis system. All values were normalized using beta-actin. The following antibodies (Cell Signaling, Danvers, MA, USA) were used for western blotting: anti-Notch1 (Cell Signaling Technology, USA), anti-Hes1 (Santa Cruz Biotechnology, USA), and horseradish peroxidase (HRP)-labeled goat antirabbit IgG (Invitrogen, USA). Statistical analysis All analyses were performed using SPSS17.0, and data are presented as mean ± SD. Differences were analyzed using one-way analysis of variance (ANOVA). P \ 0.05 was considered to indicate statistical significance.
Results Generation of human iPSCs-derived NSCs Firstly, we induced human iPSCs into NSCs using serumfree medium combined with RA. Figure 1A shows the
features of induced cells. Structures consisting of neural tube-like rosettes appeared after the EBs were cultured in EB medium combined with RA for 4 days (Fig. 1Aa). Rosette structures were observed after the iPSCs were cultured in laminin-coated dishes for adhesion for 3 days (Fig. 1Ab). Neural net-like structures formed after the spheres had been cultured in the adherent dishes for a month (Fig. 1Ac). Immunocytochemistry analysis results of cells showed in Fig. 1Ac reveals that these induced cells were expressed high levels of NSC markers (Nestin and SOX2) (Fig. 1B). The result indicates that NSCs were generated successfully from human iPSCs using serum-free medium supplemented with RA. This was consistent with the results of our previous study [2]. The dynamic expression changes of Notch signaling markers and miRNAs (9, 34a, 200b) during the differentiation of human iPSCs into NSCs To investigate whether Notch signaling pathway was involved in NSCs differentiation of human iPSCs, we next assessed the levels of the Notch signaling-related molecules (Notch1 and Hes1) in the differentiation process. qRT-PCR analysis (Fig. 2A) showed that the mRNA levels of these markers both increased significantly in undifferentiated EBs (D4) compared with the control group (D0) (**P \ 0.01). However, the levels of Notch signals at D8 and D22 then decreased remarkably compared with D4 (*P \ 0.05). Western blotting results (Fig. 2B and 2C) further confirmed the down-regulation of these Notch signaling components in the differentiation of EBs toward NSCs, indicating that Notch signaling probably participates in the NSCs differentiation of iPSCs (*P \ 0.05). Previous studies showed that Notch signaling is a target of some miRNAs (including miR-9, miR-34a, and miR-200b), and its expression is regulated by those miRNAs [19–27]. To determine whether these miRNAs are involved in NSCs differentiation of human iPSCs, we further detected the
123
294
Mol Cell Biochem (2014) 395:291–298
Fig. 1 Generation of human iPSCs-derived NSCs. A Photographs of differentiating cell clumps at indicated times. a The neuralization program was initiated after the EBs were treated with RA for 4 days. b Neural tube-like rosette structures appeared after the iPSCs were
cultured in a laminin-coated dishes for adhesion for 3 days. c Neural net-like structures formed after the spheres were cultured in the center of adherent spheres for a month. Bar = 50 lm. B Immunofluorescent analyses of NSC markers of iPSCs-derived NSCs. Bar = 100 lm
expression of miR-9, miR-34a, and miR-200b by qRT-PCR analysis (Fig. 2D). Data demonstrated that the levels of these miRNAs at D8 and D22 were much higher than that of the cells at D0 and D4 (**P \ 0.01, *P \ 0.05), which inversely correlate with that of Notch signals. These results suggest that these miRNAs may play roles in the differentiation of human iPSCs into NSCs by inhibiting Notch signaling.
the Notch signaling pathway in the differentiation process. Surprisingly, treatment with DAPT accelerated the differentiation of human iPSCs toward NSCs. After the EBs were cultured in EB medium supplemented with RA ? DAPT for 1 day, neurofilament-like structures then appeared (Fig. 3Aa). Neural tube-like rosette structures were observed after these cells were treated with RA ? DAPT for 3 days (Fig. 3Ab). Neural net-like structures formed after the spheres were cultured in a laminin-coated dishes for adhesion for 3 days (Fig. 3Ac). We then detected the expression of neural lineage markers (Nestin, neural precursor cells; beta-Tubulin III, neurons; GFAP, astrocytes) at D22. qRT-PCR analysis showed that the mRNA level of all these markers increased significantly in the group treated with DAPT than that of the control group (*P \ 0.05) (Fig. 3B). Immunofluorescent analyses
Inhibition of Notch signaling facilitates the generation of human iPSCs-derived NSCs After demonstrating that Notch signaling is down-regulated in NSCs differentiation of human iPSCs, we then investigated the potential role of Notch signaling during this process. We used DAPT, a c-secretase inhibitor to interfere
123
Mol Cell Biochem (2014) 395:291–298
295
Fig. 2 The dynamic expression changes of Notch signaling markers and miRNAs (9, 34a, 200b) during the differentiation of human iPSCs into NSCs. A Detection of the expression of Notch1 and Hes1 at indicated time by qRT-PCR analysis. B Western blot analysis of the
protein levels of Notch1 and Hes1. C Quantitative analysis of the western blot results showed in B. D Expression levels of miRNAs (9, 34a, 200b) were both increased during the differentiation process. **P \ 0.01, *P \ 0.05
Fig. 3 Inhibition of Notch signaling facilitates the generation of human iPSCs-derived NSCs. A Notch signaling inhibition speeded up the neuralization of human iPSCs. a neurofilament-like structures appeared after the EBs were treated with RA ? DAPT for 1 day. b Neural tube-like rosette structures were observed with RA ? DAPT treatment for 3 days. c Neural net-like structures formed after these
spheres were cultured in a laminin-coated dishes for adhesion for 3 days. Bar = 50 lm. B Expression levels of neural lineage markers at D22 were increased as examined by qRT-PCR analysis. *P \ 0.05. C Immunofluorescent analyses of the indicated neural markers at D22. Bar = 100 lm. D The rates of positively stained cells. *P \ 0.05
further confirmed the up-regulation of these markers, as shown in Fig. 3C and 3D. These data indicate that inhibition of Notch signaling may promote the differentiation of human iPSCs into NSCs, and finally astrocytes and neurons.
Discussion NSCs have considerable therapeutic potential in the cellreplacing regenerative treatment of currently incurable brain diseases [10]. Human iPSCs are an excellent source
123
296
of NSCs for therapeutic uses or neural progenitor cells (NPCs) because of their unlimited proliferation. We demonstrated previously that a four-stage induction system using RA combined with serum-free medium could consistently and efficiently induce iPSCs to differentiate into NSCs [2]. The iPSCs-derived NSCs, which expressed high levels of NSC markers including Nestin and Sox-2, could be grown and passaged for more than 35 cell generations [2]. Moreover, these induced cells could survive, migrate, and differentiate into neural cells after transplantation into the developing brain, and had beneficial effects on functional recovery of the stroked rats after transplantation [2]. Notch signaling pathway is a highly conserved signaling system essential for modulating neurogenesis [30], myogenic development [31–33], angiogenesis [34, 35], neoplasm [36], and organ degeneration [37] through maintaining diverse types of stem cells features and driving their fates. Research assessing the role of Notch signaling in neural development has increased gradually. Sun F et al. [30] reported that Notch signaling can modulate neuronal progenitor activity in the subventricular zone in response to focal ischemia by promoting ischemia-induced cell proliferation. This signaling pathway also participates in maintaining neural rosette polarity that is essential for neural tube closure and maintenance of the neural stem cell population [38]. The canonical Notch signaling pathway in mammals is activated by Notch ligands including Jagged, and Delta-like proteins [39]. After ligand binding, Notch receptor (including Notch1-4) is cleaved by c-secretase, releasing the Notch intracellular domain (NICD). NICD then translocates to the nucleus to regulate the transcription of Notch target genes via DNA binding proteins [40]. Hairy enhancer of split 1 (Hes1), a downstream transcriptional target of Notch, is critical inhibitor of neuronal differentiation [11, 12]. The activation of Hes1 by Notch1 can inhibit the neuronal differentiation of neuroblastoma cells [36]. This study explored the putative role of Notch signaling in the differentiation of human iPSCs into NSCs by first measuring the levels of Notch signaling-related molecules at the gene and protein level during the process in vitro. The expression of Notch1 and Hes1, which were expressed at high levels in the EBs, decreased dramatically when the EBs were treated with RA. This suggests that Notch signaling probably has a role in the NSCs differentiation of iPSCs. Treating cells with a specific inhibitor (DAPT) of csecretase, the formation of the neural rosette structures was accelerated and the expression of neural lineage markers was up-regulated. This indicates that inhibition of Notch signaling benefits the differentiation of iPSCs into NSCs, and finally astrocytes and neurons. The capacity for self-renewal and potential to differentiate are hallmarks of stem cells. The switch between self-
123
Mol Cell Biochem (2014) 395:291–298
renewal and differentiation requires rapid widespread changes in gene expression [41]. MiRNAs, which play roles in a wide range of diverse biological processes including cell proliferation, differentiation, and apoptosis [14–18], can regulate the expression of target genes at the post-transcriptional level. During neural development, miRNAs are involved in crucial steps in neurogenesis, the specification and differentiation of NPCs, and brain patterning by inhibiting gene expression [42–46]. Jing L et al. [19] reported that miR-9 might promote the differentiation of bone marrow-derived mesenchymal stem cells (MSCs) into neurons by downregulating the Notch signaling pathway. Low-temperature environments can inhibit the proliferation of endogenous NSCs, possibly by alleviating the effects of miR-34a and upregulating Notch signaling [21]. Nevertheless, further research is needed to determine whether these Notch-related miRNAs participate in the differentiation of iPSCs toward NSCs. In this paper, we demonstrated that the levels of miR-9, miR-34a, and miR200b were up-regulated whereas, Notch signaling-related molecules (Notch1 and Hes1) were down-regulated in the differentiation of iPSCs into NSCs. This suggests that these miRNAs might have a critical role during the NSCs differentiation of human iPSCs by regulating Notch signaling.
Conclusion In summary, the present study successfully generated NSCs from human iPSCs using serum-free media combined with RA in vitro. We observed that the changes in expression of some miRNAs (9, 34a, and 200b) and Notch signaling were inversely correlated in the NSCs differentiation of human iPSCs. Moreover, we demonstrated that DATP-induced inhibition of Notch signaling could enhance the generation of NSCs and mature neurocytes. This suggests that Notch signaling could exert an inhibitory role during the differentiation of human iPSCs toward NSCs, and that this process may be regulated by some miRNAs. Our results might contribute to further research to elucidate the molecular mechanisms of the NSCs differentiation of iPSCs. Acknowledgments This work was financially supported by the National Natural Science Foundation of China (No: 81160154, 81272170, 81060324), and the innovation team construction plan of Jiangxi Province (20113BCB24018).
References 1. Wernig M, Zhao JP, Pruszak J, Hedlund E, Fu D, Soldner F, Broccoli V, Constantine-Paton M, Isacson O, Jaenisch R (2008) Neurons derived from reprogrammed fibroblasts functionally
Mol Cell Biochem (2014) 395:291–298
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
integrate into the fetal brain and improve symptoms of rats with Parkinson’s disease. Proc Natl Acad Sci USA 105:5856–5861. doi:10.1073/pnas.0801677105 Yuan T, Liao W, Feng NH, Lou YL, Niu X, Zhang AJ, Wang Y, Deng ZF (2013) Human induced pluripotent stem cell-derived neural stem cells survive, migrate, differentiate, and improve neurological function in a rat model of middle cerebral artery occlusion. Stem Cell Res Ther 4:73. doi:10.1186/scrt224 Jensen MB, Yan H, Krishnaney-Davison R, Al Sawaf A, Zhang SC (2013) Survival and differentiation of transplanted neural stem cells derived from human induced pluripotent stem cells in a rat stroke model. J Stroke Cerebrovasc Dis 22:304–308. doi:10. 1016/j.jstrokecerebrovasdis.2011.09.008 Liu J, Sato C, Cerletti M, Wagers A (2010) Notch signaling in the regulation of stem cell self-renewal and differentiation. Curr Top Dev Biol 92:367–409. doi:10.1016/s0070-2153(10)92012-7 Das D, Lanner F, Main H, Andersson ER, Bergmann O, Sahlgren C, Heldring N, Hermanson O, Hansson EM, Lendahl U (2010) Notch induces cyclin-D1-dependent proliferation during a specific temporal window of neural differentiation in ES cells. Dev Biol 348:153–166. doi:10.1016/j.ydbio.2010.09.018 Lowell S, Benchoua A, Heavey B, Smith AG (2006) Notch promotes neural lineage entry by pluripotent embryonic stem cells. PLoS Biol 4:e121. doi:10.1371/journal.pbio.0040121 Zhou X, Smith AJ, Waterhouse A, Blin G, Malaguti M, Lin CY, Osorno R, Chambers I, Lowell S (2013) Hes1 desynchronizes differentiation of pluripotent cells by modulating STAT3 activity. Stem Cells 31:1511–1522. doi:10.1002/stem.1426 Abdel Aziz MT, Khaled HM, El Hindawi A, Roshdy NK, Rashed LA, Sabry D, Hassouna AA, Taha F, Ali WI (2013) Effect of mesenchymal stem cells and a novel curcumin derivative on Notch1 signaling in hepatoma cell line. Biomed Res Int 2013:129629. doi:10.1155/2013/129629 Ables JL, Decarolis NA, Johnson MA, Rivera PD, Gao Z, Cooper DC, Radtke F, Hsieh J, Eisch AJ (2010) Notch1 is required for maintenance of the reservoir of adult hippocampal stem cells. J Neurosci 30:10484–10492. doi:10.1523/JNEUROSCI.4721-09.2010 Woo SM, Kim J, Han HW, Chae JI, Son MY, Cho S, Chung HM, Han YM, Kang YK (2009) Notch signaling is required for maintaining stem-cell features of neuroprogenitor cells derived from human embryonic stem cells. BMC Neurosci 10:97. doi:10. 1186/1471-2202-10-97 Ciarapica R, Methot L, Tang Y, Lo R, Dali R, Buscarlet M, Locatelli F, del Sal G, Rota R, Stifani S (2014) Prolyl isomerase Pin1 and protein kinase HIPK2 cooperate to promote cortical neurogenesis by suppressing Groucho/TLE:hes1-mediated inhibition of neuronal differentiation. Cell Death Differ 21:321–332. doi:10.1038/cdd.2013.160 Guo Y, Wang P, Sun H, Cai R, Xia W, Wang S (2014) Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathwaymediated neurogenesis. Int J Mol Sci 15:159–170. doi:10.3390/ ijms15010159 Kashyap V, Rezende NC, Scotland KB, Shaffer SM, Persson JL, Gudas LJ, Mongan NP (2009) Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs. Stem Cells Dev 18:1093–1108. doi:10.1089/scd.2009.0113 Popovska-Jankovic K, Noveski P, Chakalova L, Petrusevska G, Kubelka K, Plaseska-Karanfilska D (2012) MicroRNAs in breast cancer-our initial results. Balkan J Med Genet 15:87–89. doi:10. 2478/v10034-012-0026-7 Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T (2010) miRNA 34a, 100, and 137 modulate
297
16.
17.
18.
19.
20. 21.
22.
23.
24.
25.
26.
27.
28.
29.
differentiation of mouse embryonic stem cells. FASEB J 24:3255–3263. doi:10.1096/fj.09-152207 Tang J, Yoo AS, Crabtree GR (2013) Reprogramming human fibroblasts to neurons by recapitulating an essential microRNAchromatin switch. Curr Opin Genet Dev 23:591–598. doi:10. 1016/j.gde.2013.07.001 Aranha MM, Santos DM, Xavier JM, Low WC, Steer CJ, Sola S, Rodrigues CM (2010) Apoptosis-associated microRNAs are modulated in mouse, rat and human neural differentiation. BMC Genom 11:514. doi:10.1186/1471-2164-11-514 Chang SJ, Weng SL, Hsieh JY, Wang TY, Chang MD, Wang HW (2011) MicroRNA-34a modulates genes involved in cellular motility and oxidative phosphorylation in neural precursors derived from human umbilical cord mesenchymal stem cells. BMC Med Genomics 4:65. doi:10.1186/1755-8794-4-65 Jing L, Jia Y, Lu J, Han R, Li J, Wang S, Peng T, Jia Y (2011) MicroRNA-9 promotes differentiation of mouse bone mesenchymal stem cells into neurons by Notch signaling. NeuroReport 22:206–211. doi:10.1097/WNR.0b013e328344a666 Akerblom M, Jakobsson J (2013) MicroRNAs as neuronal fate determinants. Neuroscientist. doi:10.1177/1073858413497265 Wang Y, Guo F, Pan C, Lou Y, Zhang P, Guo S, Yin J, Deng Z (2012) Effects of low temperatures on proliferation-related signaling pathways in the hippocampus after traumatic brain injury. Exp Biol Med (Maywood) 237:1424–1432. doi:10.1258/ebm. 2012.012123 Liu XS, Chopp M, Zhang RL, Tao T, Wang XL, Kassis H, Hozeska-Solgot A, Zhang L, Chen C, Zhang ZG (2011) MicroRNA profiling in subventricular zone after stroke: miR-124a regulates proliferation of neural progenitor cells through Notch signaling pathway. PLoS One 6:e23461. doi:10.1371/journal.pone.0023461 Zhang C, Yao Z, Zhu M, Ma X, Shi T, Li H, Wang B, Ouyang J, Zhang X (2012) Inhibitory effects of microRNA-34a on cell migration and invasion of invasive urothelial bladder carcinoma by targeting Notch1. J Huazhong Univ Sci Technol Med Sci 32:375–382. doi:10.1007/s11596-012-0065-z Roy S, Levi E, Majumdar AP, Sarkar FH (2012) Expression of miR-34 is lost in colon cancer which can be re-expressed by a novel agent CDF. J Hematol Oncol 5:58. doi:10.1186/1756-87225-58 Du R, Sun W, Xia L, Zhao A, Yu Y, Zhao L, Wang H, Huang C, Sun S (2012) Hypoxia-induced down-regulation of microRNA34a promotes EMT by targeting the Notch signaling pathway in tubular epithelial cells. PLoS One 7:e30771. doi:10.1371/journal. pone.0030771 Engelsvold DH, Utheim TP, Olstad OK, Gonzalez P, Eidet JR, Lyberg T, Troseid AM, Dartt DA, Raeder S (2013) miRNA and mRNA expression profiling identifies members of the miR-200 family as potential regulators of epithelial-mesenchymal transition in pterygium. Exp Eye Res 115:189–198. doi:10.1016/j.exer. 2013.07.003 Yang Y, Ahn YH, Gibbons DL, Zang Y, Lin W, Thilaganathan N, Alvarez CA, Moreira DC, Creighton CJ, Gregory PA, Goodall GJ, Kurie JM (2011) The Notch ligand Jagged2 promotes lung adenocarcinoma metastasis through a miR-200-dependent pathway in mice. J Clin Invest 121:1373–1385. doi:10.1172/jci42579 Liao J, Wu Z, Wang Y, Cheng L, Cui C, Gao Y, Chen T, Rao L, Chen S, Jia N, Dai H, Xin S, Kang J, Pei G, Xiao L (2008) Enhanced efficiency of generating induced pluripotent stem (iPS) cells from human somatic cells by a combination of six transcription factors. Cell Res 18:600–603. doi:10.1038/cr.2008.51 Wang M, Ma X, Wang J, Wang L, Wang Y (2014) Pretreatment with the gamma-secretase inhibitor DAPT sensitizes drug-resistant ovarian cancer cells to cisplatin by downregulation of Notch signaling. Int J Oncol 44:1401–1409. doi:10.3892/ijo.2014.2301
123
298 30. Sun F, Mao X, Xie L, Ding M, Shao B, Jin K (2013) Notch1 signaling modulates neuronal progenitor activity in the subventricular zone in response to aging and focal ischemia. Aging Cell 12:978–987. doi:10.1111/acel.12134 31. Fouillade C, Baron-Menguy C, Domenga-Denier V, Thibault C, Takamiya K, Huganir R, Joutel A (2013) Transcriptome analysis for Notch3 target genes identifies Grip2 as a novel regulator of myogenic response in the cerebrovasculature. Arterioscler Thromb Vasc Biol 33:76–86. doi:10.1161/atvbaha.112.251736 32. Mourikis P, Gopalakrishnan S, Sambasivan R, Tajbakhsh S (2012) Cell-autonomous Notch activity maintains the temporal specification potential of skeletal muscle stem cells. Development 139:4536–4548. doi:10.1242/dev.084756 33. Pascoal S, Esteves de Lima J, Leslie JD, Hughes SM, Saude L (2013) Notch signalling is required for the formation of structurally stable muscle fibres in zebrafish. PLoS One 8:e68021. doi:10.1371/journal.pone.0068021 34. Hale AT, Tian H, Anih E, Recio FO 3rd, Shatat MA, Johnson T, Liao X, Ramirez-Bergeron DL, Proweller A, Ishikawa M, Hamik A (2014) Endothelial kruppel-like factor 4 regulates angiogenesis and the notch signaling pathway. J Biol Chem. doi:10.1074/jbc. M113.530956 35. Wang X, He Z, Xia T, Li X, Liang D, Lin X, Wen H, Lan K (2014) Latency associated nuclear antigen of kaposi’s sarcoma associated herpesvirus promotes angiogenesis through targeting notch signaling effector hey1. Cancer Res. doi:10.1158/00085472.can-13-1467 36. Grynfeld A, Pahlman S, Axelson H (2000) Induced neuroblastoma cell differentiation, associated with transient HES-1 activity and reduced HASH-1 expression, is inhibited by Notch1. Int J Cancer 88:401–410 37. Ku YC, Renaud NA, Veile RA, Helms C, Voelker CC, Warchol ME, Lovett M (2014) The transcriptome of utricle hair cell
123
Mol Cell Biochem (2014) 395:291–298
38.
39.
40.
41.
42.
43.
44.
45.
46.
regeneration in the avian inner ear. J Neurosci 34:3523–3535. doi:10.1523/jneurosci.2606-13.2014 Main H, Radenkovic J, Jin SB, Lendahl U, Andersson ER (2013) Notch signaling maintains neural rosette polarity. PLoS One 8:e62959. doi:10.1371/journal.pone.0062959 Kanski R, van Strien ME, van Tijn P, Hol EM (2014) A star is born: new insights into the mechanism of astrogenesis. Cell Mol Life Sci 71:433–447. doi:10.1007/s00018-013-1435-9 Guruharsha KG, Kankel MW, Artavanis-Tsakonas S (2012) The Notch signalling system: recent insights into the complexity of a conserved pathway. Nat Rev Genet 13:654–666. doi:10.1038/ nrg3272 Mathieu J, Ruohola-Baker H (2013) Regulation of stem cell populations by microRNAs. Adv Exp Med Biol 786:329–351. doi:10.1007/978-94-007-6621-1_18 Cremisi F (2013) MicroRNAs and cell fate in cortical and retinal development. Front Cell Neurosci 7:141. doi:10.3389/fncel.2013. 00141 Bian S, Sun T (2011) Functions of noncoding RNAs in neural development and neurological diseases. Mol Neurobiol 44:359–373. doi:10.1007/s12035-011-8211-3 Liu XS, Chopp M, Zhang RL, Zhang ZG (2013) MicroRNAs in cerebral ischemia-induced neurogenesis. J Neuropathol Exp Neurol 72:718–722. doi:10.1097/NEN.0b013e31829e4963 Krol J, Loedige I, Filipowicz W (2010) The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet 11:597–610. doi:10.1038/nrg2843 Bonev B, Stanley P, Papalopulu N (2012) MicroRNA-9 Modulates Hes1 ultradian oscillations by forming a double-negative feedback loop. Cell Rep 2:10–18. doi:10.1016/j.celrep.2012.05. 017
Inhibition of Notch signaling facilitates the differentiation of human-induced pluripotent stem cells into neural stem cells Chun-Yuan Chen • Wei Liao • Yuan-Lei Lou • Qing Li • Bin Hu • Yang Wang • Zhi-Feng Deng
Received: 14 March 2014 / Accepted: 17 June 2014 / Published online: 28 June 2014 Ó Springer Science+Business Media New York 2014
Abstract Neural stem cells (NSCs) derived from induced pluripotent stem cells (iPSCs) are becoming an appealing source of cell-based therapies of brain diseases. As such, it is important to understand the molecular mechanisms that regulate the differentiation of iPSCs toward NSCs. It is well known that Notch signaling governs the retention of stem cell features and drives stem cells fate. However, further studies are required to investigate the role of Notch signaling in the NSCs differentiation of iPSCs. In this study, we successfully generated NSCs from human iPSCs using serum-free medium supplemented with retinoic acid (RA) in vitro. We then assessed changes in the expression of Notch signaling-related molecules and some miRNAs (9, 34a, 200b), which exert their regulation by targeting Notch signaling. Moreover, we used a c-secretase inhibitor (DAPT) to disturb Notch signaling. Data revealed that the levels of the Notch signaling-related molecules decreased, whereas those miRNAs increased, during this Chun-Yuan Chen and Wei Liao are contributed equally to this work. C.-Y. Chen W. Liao Graduate School of Nanchang University, Nanchang 330006, China Y.-L. Lou Institute of Urology, The First Affiliated Hospital of Nanchang University, Nanchang 330006, China Q. Li B. Hu Y. Wang (&) Institute of Orthopaedic Surgery, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Shanghai 200233, China e-mail: [email protected] Z.-F. Deng (&) Department of Neurosurgery, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Shanghai 200233, China e-mail: [email protected]
differentiation process. Inhibition of Notch signaling accelerated the formation of the neural rosette structures and the expression of NSC and mature neurocyte marker genes. This suggests that Notch signaling negatively regulated the neuralization of human iPSCs, and that this process may be regulated by some miRNAs. Keywords Induced pluripotent stem cell Neural stem cell Differentiation Notch signaling microRNA
Introduction Induced pluripotent stem cells (iPSCs) can be produced by the reprogramming of somatic cells using the delivery of defined combinations of transcription factors. Similar to embryonic stem cells (ESCs), iPSCs have the potential to generate all cell types of three germ layers, but without ethical considerations. These features, along with their availability and the lack of requirement for embryonal tissues, make iPSCs an appealing source of cell-based therapies. It was demonstrated that iPSCs-derived NSCs could improve neurologic function in conditions including Parkinson’s disease [1], middle cerebral artery occlusion [2], and stroke [3], highlighting the broad potential of iPSCs for the treatment of neurological insults. The Notch signaling pathway plays a major role in boosting self-renewal and deciding the cell fate of ESCs and other stem cells during development [4–8]. Previous studies reported that Notch signaling was involved in the maintenance of neural stem cell-like features [9, 10]. Inhibiting Notch signaling could reduce the expression of NSC markers and the proliferation potential in neuroectodermal spheres (NESs) that were derived from human ESCs [10]. Similarly, the inactivation of Notch-regulated
123
292
genes, such as Hes1, could induce premature neuronal differentiation during brain development [11, 12]. Nevertheless, further studies are required to investigate whether Notch signaling has a role in the differentiation of iPSCs toward NSCs. Emerging evidence has demonstrated that microRNAs (miRNAs), which are non-coding small RNAs, *20–25 nucleotides in length, can regulate gene expression by modulating translation or the stability of mRNAs [13]. They participate in diverse biological processes including cell proliferation, differentiation, and apoptosis [14–18]. Some miRNAs cross talk with the Notch signaling pathway. Several important miRNAs including miR-9, miR34a, and miR-200b play roles in neurogenesis, cancer pathogenesis, invasion, metastasis, and the epithelial-mesenchymal transition (EMT) by targeting the Notch signaling pathway [19–27]. However, it is unclear whether these Notch-related miRNAs are involved in the differentiation of iPSC toward NSC. In this study, we generated NSCs derived from human iPSCs in a four-stage culture system using serum-free medium supplemented with retinoic acid (RA): an effective method to obtain iPSCs-derived NSCs in vitro [2]. We then detected changes in the expression of Notch signaling markers and miRNAs that target Notch signaling. Furthermore, we used a c-secretase inhibitor to interfere with Notch signaling to investigate the role of Notch in the NSCs differentiation of iPSCs. Our results indicate that Notch signaling plays an inhibitory role in deciding cell fate during the differentiation process, and that this may be regulated by some miRNAs.
Materials and methods Human iPSCs culture Human iPSCs (iPS-S-01) were provided by the Liao J and Xiao L group at the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences [28]. The iPSCs were maintained on a mouse embryonic fibroblast (MEF) feeder layer inactivated by mitomycin in iPSC medium. The culture of human iPSCs followed the protocol described previously [2]. Human iPSCs were cultured in KnockoutTM DMEM medium containing 20 % KnockOutTM serum replacement, 1 % nonessential amino acid, 1 mM L-glutamine, 4 ng/mL bFGF, and 0.1 mM bmercaptoethanol (Gibco, Grand Island, NY, USA). Generation of iPSCs-derived NSCs The production of NSCs followed the protocol described previously [2]. Colonies of iPSC (labeled D0) were
123
Mol Cell Biochem (2014) 395:291–298
resuspended with embryoid body (EB) medium (iPSC media without bFGF) for 4 days (D4) and grown into EBs (stage 1). The EBs were cultured in EB media supplied with 5 9 10-7 M RA for 4 days (D8), and then transferred to serum-free media for 7 days (stage 2). Some cells suspended and grew (stage 3). The suspended cells were plated on poly-1-ornithine/laminin-coated dishes in the serum-free media for adhesion for 7 days (D22) (stage 4). These induced cells were dissociated at 1:3 to 1:4 ratio using Accutase (a cell-detachment solution) every 5 to 7 days. The medium was changed every day at all stages.
Notch signaling inhibition N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycinet-butyl ester (DAPT; 10 lM; Sigma), a c-secretase inhibitor by specifically binding to Presenilin-1 (PS1) to block Notch cleavage [29], was added to EB medium containing RA for 4 days (RA ? DAPT). Subsequent procedures were performed as above-described (stage 2–4). A group of cells treated with DMSO supplemented with RA was labeled ‘‘RA ? DMSO’’ or ‘‘control’’.
Quantitative real-time PCR analysis (qRT-PCR) Total RNAs were extracted using TRIzol Reagent (Invitrogen, USA). The expression of the corresponding RNAs was analyzed using the Revert Aid first-strand cDNA synthesis kit (Fermentas, Life Sciences, Burlington, Canada) following the manufacturer’s protocol. qRT-PCR analysis was performed using an ABI PRISMÒ7900HT Fast Real-Time PCR System with SYBR Premix Ex TaqTM II (Takara Biotechnology, Japan). All values were normalized using an internal reference (U6, for miRNAs; and GAPDH, for Notch1, Hes1, and neural markers). Relative expression was estimated by the comparative Ct method (2-44Ct). A 2-44Ct [ 3 or \0.3 was deemed to indicate statistical significance. All primers are shown in Table 1.
Immunocytochemistry The levels of neural lineage markers were assessed using immunocytochemistry as described previously [2]. Primary antibodies were used as follows: anti-Nestin, anti-glial fibrillary acidic protein (GFAP) (monoclonal, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-Sox2 (monoclonal, Cell Signaling, Danvers, MA, USA), and anti-betaTubulin III (monoclonal, Chemicon, Billerica, MA, USA). All secondary antibodies (Santa Cruz, USA) were labeled with Alexa Fluor 594 or FITC (Invitrogen, USA).
Mol Cell Biochem (2014) 395:291–298
293
Table 1 Primers used for real-time fluorescence quantitative PCR (RT-PCR) analysis Genes
Forward Primer (50 -30 )
Reverse Primer (50 -30 )
miR-9
TCGCGGTCTTTGGTTATCTAGCT
miR-34a
CCCGTTGGCAGTGTCTTAGCT
miR-200b
TGGCGGTAATACTGCCTGGTAA
Notch1
TCGGAGTGTGTATGCCAAGAGT
TAACCAACGAACAACTCATAATACTGAAC
Hes1
AAACACTGATTTTGGATGCTCTGAAG
TAGCCGGCCTGTCCAGCCTG
Nestin
GCCCTGACCACTCCAGTTTAG
CCCTCTATGGCTGTTTCTTTCTCTAC
GFAP
GAAGCTCCAGGATGAAACCA
ACCTCCTCCTCGTGGATCTT
b-tubulin I
CTGGTGGAGAACACGGATGAG
GCGGAAGCAGATGTCGTAGAG
GAPDH
TGCACCACCAACTGCTTAGC
GGCATGGACTGTGGTCATGAG
U6
CTCGCTTCGGCAGCACA
AACGCTTCACGAATTTGCGT
Western blotting Total proteins were extracted using Protein Extraction Reagent Kit (Takara Biotechnology, China). Proteins (30 lg) were separated by SDS-PAGE (5 % spacer gel and 10 % separation gel) and transferred to nitrocellulose membranes. Membranes were then incubated with TBST (10 mM Tris–HCl pH 7.5, 150 mM NaCl) containing 5 % non-fat dry milk and 0.1 % Tween-20 to block non-specific sites for 1 h, before incubation with primary antibodies (diluted by TBST) at 4 °C overnight. Membranes were then washed using TBST for 5 min, which was repeated three times. Incubations with secondary antibodies (diluted by TBST) were then performed at 37 °C for 1 h, and signals were visualized using enhanced chemiluminescence reagent (Pierce, USA). After exposure, developing, and fixing, images were analyzed using an image analysis system. All values were normalized using beta-actin. The following antibodies (Cell Signaling, Danvers, MA, USA) were used for western blotting: anti-Notch1 (Cell Signaling Technology, USA), anti-Hes1 (Santa Cruz Biotechnology, USA), and horseradish peroxidase (HRP)-labeled goat antirabbit IgG (Invitrogen, USA). Statistical analysis All analyses were performed using SPSS17.0, and data are presented as mean ± SD. Differences were analyzed using one-way analysis of variance (ANOVA). P \ 0.05 was considered to indicate statistical significance.
Results Generation of human iPSCs-derived NSCs Firstly, we induced human iPSCs into NSCs using serumfree medium combined with RA. Figure 1A shows the
features of induced cells. Structures consisting of neural tube-like rosettes appeared after the EBs were cultured in EB medium combined with RA for 4 days (Fig. 1Aa). Rosette structures were observed after the iPSCs were cultured in laminin-coated dishes for adhesion for 3 days (Fig. 1Ab). Neural net-like structures formed after the spheres had been cultured in the adherent dishes for a month (Fig. 1Ac). Immunocytochemistry analysis results of cells showed in Fig. 1Ac reveals that these induced cells were expressed high levels of NSC markers (Nestin and SOX2) (Fig. 1B). The result indicates that NSCs were generated successfully from human iPSCs using serum-free medium supplemented with RA. This was consistent with the results of our previous study [2]. The dynamic expression changes of Notch signaling markers and miRNAs (9, 34a, 200b) during the differentiation of human iPSCs into NSCs To investigate whether Notch signaling pathway was involved in NSCs differentiation of human iPSCs, we next assessed the levels of the Notch signaling-related molecules (Notch1 and Hes1) in the differentiation process. qRT-PCR analysis (Fig. 2A) showed that the mRNA levels of these markers both increased significantly in undifferentiated EBs (D4) compared with the control group (D0) (**P \ 0.01). However, the levels of Notch signals at D8 and D22 then decreased remarkably compared with D4 (*P \ 0.05). Western blotting results (Fig. 2B and 2C) further confirmed the down-regulation of these Notch signaling components in the differentiation of EBs toward NSCs, indicating that Notch signaling probably participates in the NSCs differentiation of iPSCs (*P \ 0.05). Previous studies showed that Notch signaling is a target of some miRNAs (including miR-9, miR-34a, and miR-200b), and its expression is regulated by those miRNAs [19–27]. To determine whether these miRNAs are involved in NSCs differentiation of human iPSCs, we further detected the
123
294
Mol Cell Biochem (2014) 395:291–298
Fig. 1 Generation of human iPSCs-derived NSCs. A Photographs of differentiating cell clumps at indicated times. a The neuralization program was initiated after the EBs were treated with RA for 4 days. b Neural tube-like rosette structures appeared after the iPSCs were
cultured in a laminin-coated dishes for adhesion for 3 days. c Neural net-like structures formed after the spheres were cultured in the center of adherent spheres for a month. Bar = 50 lm. B Immunofluorescent analyses of NSC markers of iPSCs-derived NSCs. Bar = 100 lm
expression of miR-9, miR-34a, and miR-200b by qRT-PCR analysis (Fig. 2D). Data demonstrated that the levels of these miRNAs at D8 and D22 were much higher than that of the cells at D0 and D4 (**P \ 0.01, *P \ 0.05), which inversely correlate with that of Notch signals. These results suggest that these miRNAs may play roles in the differentiation of human iPSCs into NSCs by inhibiting Notch signaling.
the Notch signaling pathway in the differentiation process. Surprisingly, treatment with DAPT accelerated the differentiation of human iPSCs toward NSCs. After the EBs were cultured in EB medium supplemented with RA ? DAPT for 1 day, neurofilament-like structures then appeared (Fig. 3Aa). Neural tube-like rosette structures were observed after these cells were treated with RA ? DAPT for 3 days (Fig. 3Ab). Neural net-like structures formed after the spheres were cultured in a laminin-coated dishes for adhesion for 3 days (Fig. 3Ac). We then detected the expression of neural lineage markers (Nestin, neural precursor cells; beta-Tubulin III, neurons; GFAP, astrocytes) at D22. qRT-PCR analysis showed that the mRNA level of all these markers increased significantly in the group treated with DAPT than that of the control group (*P \ 0.05) (Fig. 3B). Immunofluorescent analyses
Inhibition of Notch signaling facilitates the generation of human iPSCs-derived NSCs After demonstrating that Notch signaling is down-regulated in NSCs differentiation of human iPSCs, we then investigated the potential role of Notch signaling during this process. We used DAPT, a c-secretase inhibitor to interfere
123
Mol Cell Biochem (2014) 395:291–298
295
Fig. 2 The dynamic expression changes of Notch signaling markers and miRNAs (9, 34a, 200b) during the differentiation of human iPSCs into NSCs. A Detection of the expression of Notch1 and Hes1 at indicated time by qRT-PCR analysis. B Western blot analysis of the
protein levels of Notch1 and Hes1. C Quantitative analysis of the western blot results showed in B. D Expression levels of miRNAs (9, 34a, 200b) were both increased during the differentiation process. **P \ 0.01, *P \ 0.05
Fig. 3 Inhibition of Notch signaling facilitates the generation of human iPSCs-derived NSCs. A Notch signaling inhibition speeded up the neuralization of human iPSCs. a neurofilament-like structures appeared after the EBs were treated with RA ? DAPT for 1 day. b Neural tube-like rosette structures were observed with RA ? DAPT treatment for 3 days. c Neural net-like structures formed after these
spheres were cultured in a laminin-coated dishes for adhesion for 3 days. Bar = 50 lm. B Expression levels of neural lineage markers at D22 were increased as examined by qRT-PCR analysis. *P \ 0.05. C Immunofluorescent analyses of the indicated neural markers at D22. Bar = 100 lm. D The rates of positively stained cells. *P \ 0.05
further confirmed the up-regulation of these markers, as shown in Fig. 3C and 3D. These data indicate that inhibition of Notch signaling may promote the differentiation of human iPSCs into NSCs, and finally astrocytes and neurons.
Discussion NSCs have considerable therapeutic potential in the cellreplacing regenerative treatment of currently incurable brain diseases [10]. Human iPSCs are an excellent source
123
296
of NSCs for therapeutic uses or neural progenitor cells (NPCs) because of their unlimited proliferation. We demonstrated previously that a four-stage induction system using RA combined with serum-free medium could consistently and efficiently induce iPSCs to differentiate into NSCs [2]. The iPSCs-derived NSCs, which expressed high levels of NSC markers including Nestin and Sox-2, could be grown and passaged for more than 35 cell generations [2]. Moreover, these induced cells could survive, migrate, and differentiate into neural cells after transplantation into the developing brain, and had beneficial effects on functional recovery of the stroked rats after transplantation [2]. Notch signaling pathway is a highly conserved signaling system essential for modulating neurogenesis [30], myogenic development [31–33], angiogenesis [34, 35], neoplasm [36], and organ degeneration [37] through maintaining diverse types of stem cells features and driving their fates. Research assessing the role of Notch signaling in neural development has increased gradually. Sun F et al. [30] reported that Notch signaling can modulate neuronal progenitor activity in the subventricular zone in response to focal ischemia by promoting ischemia-induced cell proliferation. This signaling pathway also participates in maintaining neural rosette polarity that is essential for neural tube closure and maintenance of the neural stem cell population [38]. The canonical Notch signaling pathway in mammals is activated by Notch ligands including Jagged, and Delta-like proteins [39]. After ligand binding, Notch receptor (including Notch1-4) is cleaved by c-secretase, releasing the Notch intracellular domain (NICD). NICD then translocates to the nucleus to regulate the transcription of Notch target genes via DNA binding proteins [40]. Hairy enhancer of split 1 (Hes1), a downstream transcriptional target of Notch, is critical inhibitor of neuronal differentiation [11, 12]. The activation of Hes1 by Notch1 can inhibit the neuronal differentiation of neuroblastoma cells [36]. This study explored the putative role of Notch signaling in the differentiation of human iPSCs into NSCs by first measuring the levels of Notch signaling-related molecules at the gene and protein level during the process in vitro. The expression of Notch1 and Hes1, which were expressed at high levels in the EBs, decreased dramatically when the EBs were treated with RA. This suggests that Notch signaling probably has a role in the NSCs differentiation of iPSCs. Treating cells with a specific inhibitor (DAPT) of csecretase, the formation of the neural rosette structures was accelerated and the expression of neural lineage markers was up-regulated. This indicates that inhibition of Notch signaling benefits the differentiation of iPSCs into NSCs, and finally astrocytes and neurons. The capacity for self-renewal and potential to differentiate are hallmarks of stem cells. The switch between self-
123
Mol Cell Biochem (2014) 395:291–298
renewal and differentiation requires rapid widespread changes in gene expression [41]. MiRNAs, which play roles in a wide range of diverse biological processes including cell proliferation, differentiation, and apoptosis [14–18], can regulate the expression of target genes at the post-transcriptional level. During neural development, miRNAs are involved in crucial steps in neurogenesis, the specification and differentiation of NPCs, and brain patterning by inhibiting gene expression [42–46]. Jing L et al. [19] reported that miR-9 might promote the differentiation of bone marrow-derived mesenchymal stem cells (MSCs) into neurons by downregulating the Notch signaling pathway. Low-temperature environments can inhibit the proliferation of endogenous NSCs, possibly by alleviating the effects of miR-34a and upregulating Notch signaling [21]. Nevertheless, further research is needed to determine whether these Notch-related miRNAs participate in the differentiation of iPSCs toward NSCs. In this paper, we demonstrated that the levels of miR-9, miR-34a, and miR200b were up-regulated whereas, Notch signaling-related molecules (Notch1 and Hes1) were down-regulated in the differentiation of iPSCs into NSCs. This suggests that these miRNAs might have a critical role during the NSCs differentiation of human iPSCs by regulating Notch signaling.
Conclusion In summary, the present study successfully generated NSCs from human iPSCs using serum-free media combined with RA in vitro. We observed that the changes in expression of some miRNAs (9, 34a, and 200b) and Notch signaling were inversely correlated in the NSCs differentiation of human iPSCs. Moreover, we demonstrated that DATP-induced inhibition of Notch signaling could enhance the generation of NSCs and mature neurocytes. This suggests that Notch signaling could exert an inhibitory role during the differentiation of human iPSCs toward NSCs, and that this process may be regulated by some miRNAs. Our results might contribute to further research to elucidate the molecular mechanisms of the NSCs differentiation of iPSCs. Acknowledgments This work was financially supported by the National Natural Science Foundation of China (No: 81160154, 81272170, 81060324), and the innovation team construction plan of Jiangxi Province (20113BCB24018).
References 1. Wernig M, Zhao JP, Pruszak J, Hedlund E, Fu D, Soldner F, Broccoli V, Constantine-Paton M, Isacson O, Jaenisch R (2008) Neurons derived from reprogrammed fibroblasts functionally
Mol Cell Biochem (2014) 395:291–298
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
integrate into the fetal brain and improve symptoms of rats with Parkinson’s disease. Proc Natl Acad Sci USA 105:5856–5861. doi:10.1073/pnas.0801677105 Yuan T, Liao W, Feng NH, Lou YL, Niu X, Zhang AJ, Wang Y, Deng ZF (2013) Human induced pluripotent stem cell-derived neural stem cells survive, migrate, differentiate, and improve neurological function in a rat model of middle cerebral artery occlusion. Stem Cell Res Ther 4:73. doi:10.1186/scrt224 Jensen MB, Yan H, Krishnaney-Davison R, Al Sawaf A, Zhang SC (2013) Survival and differentiation of transplanted neural stem cells derived from human induced pluripotent stem cells in a rat stroke model. J Stroke Cerebrovasc Dis 22:304–308. doi:10. 1016/j.jstrokecerebrovasdis.2011.09.008 Liu J, Sato C, Cerletti M, Wagers A (2010) Notch signaling in the regulation of stem cell self-renewal and differentiation. Curr Top Dev Biol 92:367–409. doi:10.1016/s0070-2153(10)92012-7 Das D, Lanner F, Main H, Andersson ER, Bergmann O, Sahlgren C, Heldring N, Hermanson O, Hansson EM, Lendahl U (2010) Notch induces cyclin-D1-dependent proliferation during a specific temporal window of neural differentiation in ES cells. Dev Biol 348:153–166. doi:10.1016/j.ydbio.2010.09.018 Lowell S, Benchoua A, Heavey B, Smith AG (2006) Notch promotes neural lineage entry by pluripotent embryonic stem cells. PLoS Biol 4:e121. doi:10.1371/journal.pbio.0040121 Zhou X, Smith AJ, Waterhouse A, Blin G, Malaguti M, Lin CY, Osorno R, Chambers I, Lowell S (2013) Hes1 desynchronizes differentiation of pluripotent cells by modulating STAT3 activity. Stem Cells 31:1511–1522. doi:10.1002/stem.1426 Abdel Aziz MT, Khaled HM, El Hindawi A, Roshdy NK, Rashed LA, Sabry D, Hassouna AA, Taha F, Ali WI (2013) Effect of mesenchymal stem cells and a novel curcumin derivative on Notch1 signaling in hepatoma cell line. Biomed Res Int 2013:129629. doi:10.1155/2013/129629 Ables JL, Decarolis NA, Johnson MA, Rivera PD, Gao Z, Cooper DC, Radtke F, Hsieh J, Eisch AJ (2010) Notch1 is required for maintenance of the reservoir of adult hippocampal stem cells. J Neurosci 30:10484–10492. doi:10.1523/JNEUROSCI.4721-09.2010 Woo SM, Kim J, Han HW, Chae JI, Son MY, Cho S, Chung HM, Han YM, Kang YK (2009) Notch signaling is required for maintaining stem-cell features of neuroprogenitor cells derived from human embryonic stem cells. BMC Neurosci 10:97. doi:10. 1186/1471-2202-10-97 Ciarapica R, Methot L, Tang Y, Lo R, Dali R, Buscarlet M, Locatelli F, del Sal G, Rota R, Stifani S (2014) Prolyl isomerase Pin1 and protein kinase HIPK2 cooperate to promote cortical neurogenesis by suppressing Groucho/TLE:hes1-mediated inhibition of neuronal differentiation. Cell Death Differ 21:321–332. doi:10.1038/cdd.2013.160 Guo Y, Wang P, Sun H, Cai R, Xia W, Wang S (2014) Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathwaymediated neurogenesis. Int J Mol Sci 15:159–170. doi:10.3390/ ijms15010159 Kashyap V, Rezende NC, Scotland KB, Shaffer SM, Persson JL, Gudas LJ, Mongan NP (2009) Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs. Stem Cells Dev 18:1093–1108. doi:10.1089/scd.2009.0113 Popovska-Jankovic K, Noveski P, Chakalova L, Petrusevska G, Kubelka K, Plaseska-Karanfilska D (2012) MicroRNAs in breast cancer-our initial results. Balkan J Med Genet 15:87–89. doi:10. 2478/v10034-012-0026-7 Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T (2010) miRNA 34a, 100, and 137 modulate
297
16.
17.
18.
19.
20. 21.
22.
23.
24.
25.
26.
27.
28.
29.
differentiation of mouse embryonic stem cells. FASEB J 24:3255–3263. doi:10.1096/fj.09-152207 Tang J, Yoo AS, Crabtree GR (2013) Reprogramming human fibroblasts to neurons by recapitulating an essential microRNAchromatin switch. Curr Opin Genet Dev 23:591–598. doi:10. 1016/j.gde.2013.07.001 Aranha MM, Santos DM, Xavier JM, Low WC, Steer CJ, Sola S, Rodrigues CM (2010) Apoptosis-associated microRNAs are modulated in mouse, rat and human neural differentiation. BMC Genom 11:514. doi:10.1186/1471-2164-11-514 Chang SJ, Weng SL, Hsieh JY, Wang TY, Chang MD, Wang HW (2011) MicroRNA-34a modulates genes involved in cellular motility and oxidative phosphorylation in neural precursors derived from human umbilical cord mesenchymal stem cells. BMC Med Genomics 4:65. doi:10.1186/1755-8794-4-65 Jing L, Jia Y, Lu J, Han R, Li J, Wang S, Peng T, Jia Y (2011) MicroRNA-9 promotes differentiation of mouse bone mesenchymal stem cells into neurons by Notch signaling. NeuroReport 22:206–211. doi:10.1097/WNR.0b013e328344a666 Akerblom M, Jakobsson J (2013) MicroRNAs as neuronal fate determinants. Neuroscientist. doi:10.1177/1073858413497265 Wang Y, Guo F, Pan C, Lou Y, Zhang P, Guo S, Yin J, Deng Z (2012) Effects of low temperatures on proliferation-related signaling pathways in the hippocampus after traumatic brain injury. Exp Biol Med (Maywood) 237:1424–1432. doi:10.1258/ebm. 2012.012123 Liu XS, Chopp M, Zhang RL, Tao T, Wang XL, Kassis H, Hozeska-Solgot A, Zhang L, Chen C, Zhang ZG (2011) MicroRNA profiling in subventricular zone after stroke: miR-124a regulates proliferation of neural progenitor cells through Notch signaling pathway. PLoS One 6:e23461. doi:10.1371/journal.pone.0023461 Zhang C, Yao Z, Zhu M, Ma X, Shi T, Li H, Wang B, Ouyang J, Zhang X (2012) Inhibitory effects of microRNA-34a on cell migration and invasion of invasive urothelial bladder carcinoma by targeting Notch1. J Huazhong Univ Sci Technol Med Sci 32:375–382. doi:10.1007/s11596-012-0065-z Roy S, Levi E, Majumdar AP, Sarkar FH (2012) Expression of miR-34 is lost in colon cancer which can be re-expressed by a novel agent CDF. J Hematol Oncol 5:58. doi:10.1186/1756-87225-58 Du R, Sun W, Xia L, Zhao A, Yu Y, Zhao L, Wang H, Huang C, Sun S (2012) Hypoxia-induced down-regulation of microRNA34a promotes EMT by targeting the Notch signaling pathway in tubular epithelial cells. PLoS One 7:e30771. doi:10.1371/journal. pone.0030771 Engelsvold DH, Utheim TP, Olstad OK, Gonzalez P, Eidet JR, Lyberg T, Troseid AM, Dartt DA, Raeder S (2013) miRNA and mRNA expression profiling identifies members of the miR-200 family as potential regulators of epithelial-mesenchymal transition in pterygium. Exp Eye Res 115:189–198. doi:10.1016/j.exer. 2013.07.003 Yang Y, Ahn YH, Gibbons DL, Zang Y, Lin W, Thilaganathan N, Alvarez CA, Moreira DC, Creighton CJ, Gregory PA, Goodall GJ, Kurie JM (2011) The Notch ligand Jagged2 promotes lung adenocarcinoma metastasis through a miR-200-dependent pathway in mice. J Clin Invest 121:1373–1385. doi:10.1172/jci42579 Liao J, Wu Z, Wang Y, Cheng L, Cui C, Gao Y, Chen T, Rao L, Chen S, Jia N, Dai H, Xin S, Kang J, Pei G, Xiao L (2008) Enhanced efficiency of generating induced pluripotent stem (iPS) cells from human somatic cells by a combination of six transcription factors. Cell Res 18:600–603. doi:10.1038/cr.2008.51 Wang M, Ma X, Wang J, Wang L, Wang Y (2014) Pretreatment with the gamma-secretase inhibitor DAPT sensitizes drug-resistant ovarian cancer cells to cisplatin by downregulation of Notch signaling. Int J Oncol 44:1401–1409. doi:10.3892/ijo.2014.2301
123
298 30. Sun F, Mao X, Xie L, Ding M, Shao B, Jin K (2013) Notch1 signaling modulates neuronal progenitor activity in the subventricular zone in response to aging and focal ischemia. Aging Cell 12:978–987. doi:10.1111/acel.12134 31. Fouillade C, Baron-Menguy C, Domenga-Denier V, Thibault C, Takamiya K, Huganir R, Joutel A (2013) Transcriptome analysis for Notch3 target genes identifies Grip2 as a novel regulator of myogenic response in the cerebrovasculature. Arterioscler Thromb Vasc Biol 33:76–86. doi:10.1161/atvbaha.112.251736 32. Mourikis P, Gopalakrishnan S, Sambasivan R, Tajbakhsh S (2012) Cell-autonomous Notch activity maintains the temporal specification potential of skeletal muscle stem cells. Development 139:4536–4548. doi:10.1242/dev.084756 33. Pascoal S, Esteves de Lima J, Leslie JD, Hughes SM, Saude L (2013) Notch signalling is required for the formation of structurally stable muscle fibres in zebrafish. PLoS One 8:e68021. doi:10.1371/journal.pone.0068021 34. Hale AT, Tian H, Anih E, Recio FO 3rd, Shatat MA, Johnson T, Liao X, Ramirez-Bergeron DL, Proweller A, Ishikawa M, Hamik A (2014) Endothelial kruppel-like factor 4 regulates angiogenesis and the notch signaling pathway. J Biol Chem. doi:10.1074/jbc. M113.530956 35. Wang X, He Z, Xia T, Li X, Liang D, Lin X, Wen H, Lan K (2014) Latency associated nuclear antigen of kaposi’s sarcoma associated herpesvirus promotes angiogenesis through targeting notch signaling effector hey1. Cancer Res. doi:10.1158/00085472.can-13-1467 36. Grynfeld A, Pahlman S, Axelson H (2000) Induced neuroblastoma cell differentiation, associated with transient HES-1 activity and reduced HASH-1 expression, is inhibited by Notch1. Int J Cancer 88:401–410 37. Ku YC, Renaud NA, Veile RA, Helms C, Voelker CC, Warchol ME, Lovett M (2014) The transcriptome of utricle hair cell
123
Mol Cell Biochem (2014) 395:291–298
38.
39.
40.
41.
42.
43.
44.
45.
46.
regeneration in the avian inner ear. J Neurosci 34:3523–3535. doi:10.1523/jneurosci.2606-13.2014 Main H, Radenkovic J, Jin SB, Lendahl U, Andersson ER (2013) Notch signaling maintains neural rosette polarity. PLoS One 8:e62959. doi:10.1371/journal.pone.0062959 Kanski R, van Strien ME, van Tijn P, Hol EM (2014) A star is born: new insights into the mechanism of astrogenesis. Cell Mol Life Sci 71:433–447. doi:10.1007/s00018-013-1435-9 Guruharsha KG, Kankel MW, Artavanis-Tsakonas S (2012) The Notch signalling system: recent insights into the complexity of a conserved pathway. Nat Rev Genet 13:654–666. doi:10.1038/ nrg3272 Mathieu J, Ruohola-Baker H (2013) Regulation of stem cell populations by microRNAs. Adv Exp Med Biol 786:329–351. doi:10.1007/978-94-007-6621-1_18 Cremisi F (2013) MicroRNAs and cell fate in cortical and retinal development. Front Cell Neurosci 7:141. doi:10.3389/fncel.2013. 00141 Bian S, Sun T (2011) Functions of noncoding RNAs in neural development and neurological diseases. Mol Neurobiol 44:359–373. doi:10.1007/s12035-011-8211-3 Liu XS, Chopp M, Zhang RL, Zhang ZG (2013) MicroRNAs in cerebral ischemia-induced neurogenesis. J Neuropathol Exp Neurol 72:718–722. doi:10.1097/NEN.0b013e31829e4963 Krol J, Loedige I, Filipowicz W (2010) The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet 11:597–610. doi:10.1038/nrg2843 Bonev B, Stanley P, Papalopulu N (2012) MicroRNA-9 Modulates Hes1 ultradian oscillations by forming a double-negative feedback loop. Cell Rep 2:10–18. doi:10.1016/j.celrep.2012.05. 017
