RESEARCH ARTICLE
Inhibitory effect of verapamil on Candida albicans hyphal development, adhesion and gastrointestinal colonization Qilin Yu1, Xiaohui Ding1, Bing Zhang1, Ning Xu1, Chang Jia1, Jiwei Mao1, Biao Zhang2, Laijun Xing1 & Mingchun Li1 1
Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, College of Life Science, Nankai University, Tianjin, China; and Tianjin University of Chinese Traditional Medicine, Tianjin, China
2
Correspondence: Mingchun Li, Department of Microbiology, College of Life Science, Nankai University, Tianjin, 300071, China. Tel.: +86 22 2350 8506; fax: +86 22 2350 8800; e-mail: [email protected] Received 29 November 2013; revised 11 February 2014; accepted 4 March 2014. Final version published online 3 April 2014. DOI: 10.1111/1567-1364.12150 Editor: Richard Calderone Keywords verapamil; calcium channel; Candida albicans; morphogenesis; gastrointestinal colonization.
Abstract Candida albicans morphogenesis and gastrointestinal colonization are closely associated with the pathogenicity of this pathogen. This study investigated the in vitro and in vivo effect of verapamil, a calcium channel blocker, on these processes. Exposure to ≥ 10 lg mL1 verapamil led to a significant decrease of C. albicans hyphal cells. The ability to adhere to a polystyrene surface and buccal epithelial cells was inhibited by exposure to ≥ 20 lg mL1 verapamil. Detection of the Hwp1–green fluorescent protein fusion protein showed that verapamil inhibited expression and transport of Hwp1, indicating its activity against both the regulation network of morphogenesis-associated proteins and the secretory pathway in C. albicans. Moreover, treatment with verapamil at 10 mg (kg day)1 led to a remarkable decrease in gastrointestinal-colonizing fungal cells. This study revealed the inhibitory effect of verapamil on C. albicans hyphal development, adhesion and gastrointestinal colonization, which is relevant to decreased expression and abnormal transport of the proteins required for morphogenesis. Therefore, verapamil may be taken into account when choosing an antifungal therapy against C. albicans colonization and infection.
YEAST RESEARCH
Introduction Candida albicans is one of the most prevalent fungal pathogens. It can cause not only superficial mucosal candidiasis, but also life-threatening systemic infections in immunocompromised patients (Klepser, 2006; Odds et al., 2007). In particular, C. albicans colonization is frequently a risk in intensive care unit (ICU) patients, and infections caused by this pathogen in this population are of growing interest (Charles et al., 2005). An important feature of this pathogen is its ability to switch between different morphological forms, including yeast, pseudohyphae and true hyphae (Sudbery, 2011). Abundant evidence has shown that the ability to make morphogenetic switches is involved in adhesion and invasion of host tissues, and is a crucial virulence attribute of this pathogen (Gow et al., 2011). Besides being an opportunistic pathogen, C. albicans is commonly found in the gastrointestinal tract (Odds, 1987), which is thought to be a frequent source of invasive candidiasis (Cole et al., 1996; Blijlevens et al., 2002). To achieve FEMS Yeast Res 14 (2014) 633–641
efficient gastrointestinal colonization, this fungus possesses complicated adaptation capacities to sense host niches, adhere to the host mucosal surface and successfully colonize this unique environment. All of these capacities are also related to morphogenetic processes (White et al., 2007). Therefore, strategies that inhibit morphogenesis of this fungus may also have an impact on relevant physiological processes, such as adhesion, colonization and invasion of host tissues, and may be used for antifungal drugs against its infections. Candida albicans morphogenetic processes depend on its mechanisms of sensing and responding to environmental cues by sophisticated signal transduction pathways leading to expression of morphogenesis-related genes, and functions of the products encoded by these genes (Gow et al., 2011; Sudbery, 2011). Among these functional factors, Hwp1, a well-known morphopathogenic determinant, plays an important role in morphogenesis, including hyphal development, biofilm formation, adhesion and mating (Daniels et al., 2003; Nobile et al., 2006). During ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
634
Q. Yu et al.
these processes, Hwp1 is highly expressed, linked to the glycosylphosphatidylinositol anchor in the endoplasmic reticulum (ER) and transported to the cell surface by the secretory pathway (Chaffin, 2008; Plaine et al., 2008; Gaillardin et al., 2008). Hence, deficiency in Hwp1 expression or transport will influence the morphogenetic ability of this fungus. In C. albicans, calcium signalling functions not only in stress response, but also in morphogenesis (Sanglard et al., 2003; Bates et al., 2005; Wang et al., 2011), which is dependent on the calcium homeostasis system (Karababa et al., 2006). Our previous studies also revealed that several members of the calcium homeostasis system, such as the high-affinity calcium influx system (HACS, Cch1– Mid1 complex) and Spf1, play an important role in morphogenesis (Yu et al., 2012a, b). These findings indicated that agents interrupting the calcium homeostasis system have potential inhibitory effects on C. albicans morphogenesis. Verapamil, a typical calcium channel blocker of the phenylalkylamine class, is widely used in the treatment of angina pectoris and hypertension (Strigun et al., 2011). This drug, as an L-type voltage-gated calcium channel (VGCC) blocker, was shown to partially inhibit the function of the HACS, resulting in decreased calcium influx under normal growth conditions in Saccharomyces cerevisiae (Teng et al., 2008). A recent study further revealed that it also inhibits C. albicans calcium uptake when the cells are confronted with alkaline stimulus, indicating its activity against calcium homeostasis in fungal cells (our unpublished data). Most importantly, this drug has in vitro activity against C. albicans biofilm formation and maintenance (Yu et al., 2013). Because of the relationship among biofilm formation, hyphal development, adhesion and colonization, we evaluated the effect of verapamil on these processes, and investigated whether this effect is associated with abnormal expression and transport of Hwp1, the factor related to morphogenesis.
the morphogenesis-associated gene HWP1 and Hwp1 localization, a GF-URA3-FP cassette was amplified from plasmid pMG2082 (Gerami-Nejad et al., 2009) with the following primers: 50 -AGGAAGCTCTTATTCAAAAG AGATCTTATGATTACTATCAAGAACCATGTGATGATT ACCCACAACAATCTAAAGGTGAAGAATTATTC-30 , 50 -T GTAGAAATAGGAGCGACACTTGAGTAATTGGCAGAT GGTTGCATGAGTGGAACTGATTCTAATGTAGTTTTGT ACAATTCATCCATAC-30 . This cassette was then transformed into strain DAY1 (Wilson et al., 1999), to give strain NKF151 in which the incomplete copy of GFP flanking the URA3 marker was inserted at the HWP1 locus. Cells of strain NKF151 were cultured on SC medium plates (0.67% yeast nitrogen base, 0.2% amino acid mixture, 2% glucose, 2% agar) containing 0.1% 5-fluoroorotic acid, generating strain NKF152. In this strain, the URA3 sequence was deleted, and a functional GFP gene was consequently in-frame with the HWP1 gene (Gerami-Nejad et al., 2009). In addition, expression of the fusion gene HWP1–GFP is controlled by the HWP1 promoter.
Materials and methods
Adhesion to polystyrene
Strains
Strains used in this study are listed in Table 1. For construction of strain NKF152 for indicating expression of
Hyphal induction
Candida albicans hyphae were induced in liquid RPMI1640 medium. Overnight cultured cells of strain SC5314 or NKF152 were harvested, washed with phosphate-buffered saline (PBS), and diluted with RPMI-1640 medium to an optical absorbance at 600 nm (A600 nm) of 0.1. Verapamil was then added at 0, 10, 20, 40, 80, 160, 320 or 640 lg mL1. The cell suspensions were cultured at 37 ℃ with shaking for the indicated times. Cells were centrifuged, fixed with 4% formaldehyde and observed with a light microscope (Olympus). Both hyphal cells and total cells were counted, and the percentage of hyphal cells was calculated as the number of hyphal cells divided by the number of total cells. At least 10 microscopic fields were detected.
Overnight cultured cells were diluted with RPMI-1640 medium as described above, and the suspension was added into 24-well polystyrene microplates. Verapamil was supplemented into the wells as in hyphal induction.
Table 1. Strains used in this study Strain
Genotype
Source
SC5314 DAY1 NKF151 NKF152
Wild-type ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG HWP1-GF-URA3-FP ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG HWP1-GFP
American type culture collection Dana Davis (Wilson et al., 1999) This study This study
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Yeast Res 14 (2014) 633–641
635
Verapamil inhibits C. albicans morphogenesis and colonization
The plates were incubated at 37 ℃ for 4 h, washed with PBS buffer, and stained using 0.1% crystal violet for 5 min. The wells were then washed again with PBS buffer, and 500 lL of 10% acetic acid was added to extract the dye. The optical absorbance at 595 nm (A595 nm) of the extract was determined using a spectrophotometer (Bio-Rad). The percentage of adhering cells were calculated as the A595 nm of each group divided by the A595 nm of the control group 9 100%. The cells adhering to the well surface were also examined by light microscopy. Adhesion to buccal epithelial cells (BECs)
Adhesion to BECs was assessed according to Bates et al. (2005). BECs were collected from healthy individuals, washed with sterilized physiological saline and suspended in the same solution at 2.5 9 105 mL1. Cells of C. albicans strain SC5314 or NKF152 were cultured overnight in modified NGY medium (0.1% peptone, 0.1% yeast extract, 0.4% glucose), harvested, washed with saline and suspended in the same solution at 2.5 9 106 yeast cells mL1. Then, 100 lL of BECs and 100 lL of yeast cells were mixed. Verapamil was added to the mixtures as described for hyphal induction. The mixture was incubated with shaking at 30 ℃ for 1 h, washed with saline, fixed with 4% formaldehyde and observed. The percentage of fungus-adhered BECs was calculated as the number of fungus-adhered BECs divided by the number of total BECs 9 100%. Quantification of green fluorescent protein (GFP) fluorescence
Fluorescence intensities of the fusion protein Hwp1–GFP expressed in strain NKF152 were detected to assess expression levels of HWP1. Hyphae of NKF152 were induced for the indicated time, collected, washed with PBS buffer and fixed with 4% formaldehyde. The fluorescence intensities (excitation wave 488 nm, emission wave 520 nm) of the hyphal suspension were determined using a fluorescent microplate reader (PerkinElmer). Fluorescence microscopy
NKF152 hyphal cells in RPMI-1640 or yeast cells adhering to BECs were fixed. The localization of Hwp1–GFP was observed by fluorescence microscopy (Olympus) with the GFP filter set. Measurement of gastrointestinal colonization
Gastrointestinal colonization of strain SC4314 was assessed by a modified method of White et al. (2007). Candida FEMS Yeast Res 14 (2014) 633–641
albicans cells were cultured overnight in liquid YPD medium, washed with sterilized saline, and adjusted with the same solution to 2.5 9 108 cells mL1. Forty female Institute of Cancer Research mice (18–20 g) were equally divided into four groups, two antibiotic-free groups and two antibiotic-treated groups. In the antibiotic-free groups, the mice were inoculated with 200 lL of yeast cells by oral gavage, and then treated without verapamil (the antibioticfree control group) or with verapamil [10 mg (kg day)1, the verapamil group] in their drinking water throughout the experiment. In the antibiotic-treated groups, the mice were treated with streptomycin (2 mg mL1), tetracycline (1 mg mL1) and gentamycin (0.1 mg mL1) in their drinking water throughout the experiment beginning 3 days prior to yeast inoculation. After being inoculated with yeast cells, the mice were treated without verapamil (the antibiotic-treated control group) or with verapamil as the antibiotic-free groups. To monitor gastrointestinal colonization, fresh fecal pellets (produced within 5 min prior to collection) were collected on the 7th and 14th days, and C. albicans concentrations in the pellets were measured by plating pellet homogenates on YPD SAK plates (1% yeast extract, 2% peptone, 2% glucose, 2% agar, 100 lg mL1 streptomycin, 100 lg mL1 ampicillin and 50 lg mL1 kanamycin). The animal experiments were approved by the Institutional Animal Care and Use Committee of Nankai University. Statistic analysis
Each experiment was performed with five replicates for each treatment. The effect of verapamil on hyphal development, adhesion and colonization was compared with the control (no verapamil treatment), and the significance of the difference (P < 0.05) was assessed using Student’s t-test using SPSS v19.0 software (IBM).
Results Verapamil inhibits C. albicans hyphal development
Our previous study revealed that disruption of the genes encoding calcium channels resulted in abnormal hyphal formation of C. albicans. As verapamil is a potential calcium channel blocker, we evaluated the inhibitory effect of this drug on hyphal development. When induced for 2 h, 95% of cells formed true hyphae in liquid drug-free RPMI-1640 medium. In contrast, only 70% of cells produced hyphae by exposure to 10 lg mL1 verapamil (Fig. 1). Increasing the concentration of verapamil resulted in drastic reduction of hyphal cells, and the percentage of hyphal cells deceased to < 15% by exposure to ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
636
Q. Yu et al.
120 0
% Hypahl cells
100 80 60
10
*
20
* ** *
*
40
*
20 0
40
*
80
*
*
2
160
*
*
*
** ** ** *
*
4 Time (h)
320 640
6
Fig. 1. Verapamil inhibits Candida albicans hyphal development. Candida albicans cells were incubated in RPMI-1640 medium containing different concentrations of verapamil (lg mL1). Both the total cells and the hyphal cells were counted for the indicated times. *Significant difference between the control group (0) and the verapamil-treated groups (P < 0.05).
320 lg mL1. Similarly, when induced for prolonged periods, treatment of verapamil with the tested concentrations led to a significant decrease of hypahl cells as compared with the control. Notably, the proportion of hyphal cells decreased from 60% to only 20% by exposure to 10 lg mL1 verapamil for 6 h (Fig. 1). Therefore, verapamil showed a remarkable inhibitory effect on C. albicans hyphal development. Verapamil inhibits C. albicans adherence
Another factor that allows C. albicans to invade host tissues is its ability to adhere to host cells. Here we further assess the effect of verapamil on C. albicans adherence to polystyrene and BECs. When incubated on the surface of polystyrene microplates, 20 lg mL1 or higher
(a) 120
concentrations of verapamil resulted in a significant decrease of cell attachment. A strong negative correlation was seen between verapamil levels and the biomass of adhering cells. The proportion of adherent cells reduced from 65% to 10% as the concentrations of verapamil increased from 20 to 640 lg mL1 (Fig. 2a). Exposure of verapamil also led to a significant decrease of C. albicans attachment to BECs when the drug concentration reached 20 lg mL1. Interestingly, the proportion of adhering BECs remained c. 30% as the verapamil concentrations increased from 80 to 640 lg mL1 (Fig. 2b). Moreover, while most of the control cells adhered to the well surface by hyphae, abundant adherent fungal cells exposed to verapamil displayed yeast-like morphology, indicating that this drug also inhibits hyphal development during adhesion. Thus, verapamil also inhibits C. albicans adherence to both polystyrene and host epithelial cells. Verapamil inhibits expression of HWP1 associated with hyphal development
Studies have suggested that the adhesin HWP1 is closely associated with hyphal development and adhesion in C. albicans, and is upregulated during these processes. Therefore, we tested if the inhibitory effects of verapamil on morphogenesis are relevant to its abnormal expression. We tagged Hwp1 with GFP, and evaluated its expression levels by GFP fluorescence assays. Cells treated with ≥ 20 lg mL1 verapamil had significantly lower fluorescence density than the control within the tested time. Notably, GFP fluorescence decreased by 50% when the concentration of verapamil increased to 160 lg mL1 (Fig. 3). This result demonstrated that verapamil indeed inhibits the expression of HWP1 under hyphal induction,
(b)
80
% Adhered BECs
% Adhered cells
70 60
100 * *
60 40
*
20
*
*
*
0
*
50
*
40 30
*
*
*
*
20 10 0
0
10
20 40 80 160 320 640 Verapamil (μg mL–1)
0
10
20 40 80 160 320 640 Verapamil (μg mL–1)
Fig. 2. Verapamil inhibits adherence of Candida albicans to polystyrene surface (a) and BECs (b). (a) Candida albicans cells were suspended in RPMI-1640 medium with different levels of verapamil, and added to polystyrene microplates. The biomass of C. albicans adhering to the polystyrene surface was quantified by crystal violet staining. The percentage of adherent cells were calculated as the A595 nm of each group divided by the A595 nm of the control group (0) 9 100%. (b) BECs and C. albicans were coincubated for 1 h, and fungus-adhered and total BECs were counted. The percentage of fungus-adhered BECs was calculated as the number of fungus-adhered BECs divided by the number of total BECs 9 100%. *Significant difference between the control group (0) and the verapamil-treated groups (P < 0.05).
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Yeast Res 14 (2014) 633–641
637
Verapamil inhibits C. albicans morphogenesis and colonization
GFP fluorescence
1000
0 10
800 600
20
* *
40
* ** *
400
*
* ** **
200
80
*
****
160 320 640
0
cell surface, which may be also linked to its effect on morphogenesis.
2
4 Time (h)
6
Fig. 3. Verapamil inhibits expression of HWP1. Strain NKF152 was incubated in RPMI-1640 medium containing different concentrations of verapamil (lg mL1), and GFP fluorescence density of the culture was determined for the indicated times. *Significant difference between the control group (0) and the verapamil-treated groups (P < 0.05).
which may contribute to its inhibitory effect on morphogenesis. Verapamil inhibits Hwp1 transport
Hwp1, as a hyphal cell-wall protein, has to be transported to the cell surface through the secretory pathway for its functions during cell-surface adhesion. Using the Hwp1– GFP system, we further investigated whether verapamil also affected the transport of Hwp1 during morphogenesis. As expected, the control cells formed regular hyphae after 2 h of hyphal induction, and Hwp1–GFP was localized not only in the cytoplasm, but also on the cell surface and the hyphal tip (Fig. 4a, its localization on the cell surface and the hyphal tip is indicated by white arrows). This observation implied normal synthesis and cytoplasm-to-surface transport of Hwp1–GFP in the control cells. In contrast, few hyphal cells were observed when exposed to 80 lg mL1 verapamil, and the fusion protein of the treated cells was localized predominately in the cytoplasm rather than the cell surface, suggesting that transport of the synthesized protein from the cytoplasm to the cell surface was inhibited by verapamil. We obtained similar results when using the BEC model to evaluate Hwp1 localization. Most of the control C. albicans cells adhered to BECs, with regular surface localization of Hwp1–GFP in abundant fungal cells, although a few cells showed both a cytoplasm and surface localization of this protein. However, the cells treated with verapamil at the same concentration displayed only cytoplasm localization of the fusion protein, and decreased adhering ability to BECs (Fig. 4b). These observations suggested that verapamil also has an impact on Hwp1 transport from the cytoplasm to the FEMS Yeast Res 14 (2014) 633–641
Verapamil inhibits C. albicans gastrointestinal colonization
We further investigated the in vivo effect of verapamil on C. albicans morphogenesis using two gastrointestinal colonization models. In the antibiotic-free model, CFU of the verapamil group [by exposure to 10 mg (kg day)1 verapamil] from the faecal pellets decreased c. twofold on the 7th day post-inoculation, and decreased more than 15-fold on the 14th day compared with the control group (Fig. 5a). Similarly, in the antibiotic-treated model, a significant decrease of CFU in the verapamil group was observed on the tested days (Fig. 5b). Thus, verapamil displayed an inhibitory effect on C. albicans gastrointestinal colonization, which may be associated with its effect on hyphal development and adhesion of this pathogen.
Discussion The cytoplasmic membrane HACS, composed of Cch1 and Mid1, was shown to play a role in morphogenesis (Brand & Gow, 2009). The system mediates calcium influx and leads to the elevation of tip Ca2+ in the hyphal apex that is required for determination of tropism (Brand et al., 2007). It also functions in hyphal maintenance rather than hyphal formation, which is associated with the transcription regulation of morphogenesis-associated genes (Yu et al., 2012b). In this study, we demonstrate that verapamil, an efficient blocker of the HACS, has an inhibitory effect on hyphal development, further confirming the role of calcium channels in C. albicans morphogenesis. Therefore, calcium channels may be a potential target against morphogenesis of C. albicans. Given the importance of Hwp1 in C. albicans morphogenesis, we investigated the effect of verapamil on expression and transport of this protein. On the one hand, GFP fluorescence detection showed that treatment with verapamil caused a significant decrease of HWP1 expression, indicating the inhibitory activity of this drug against expression of morphogenesis-associated genes. This observation is consistent with our previous findings that deletion of genes encoding calcium channels led to decreased expression of these genes (Yu et al., 2012b). On the other hand, verapamil also has a remarkable impact on Hwp1 transport towards to the cell surface and the hyphal tip. As a typical glycosylphosphatidylinositol-anchored protein, Hwp1 is synthesized and modified with the glycosylphosphatidylinositol anchor in the ER lumen, and then follows the secretory pathway to the cell surface (Richard & Plaine, 2007). In particular, during polarized hyphal ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
638
Q. Yu et al.
(a)
(b)
Fig. 4. Verapamil inhibits the transport of Hwp1 to the cell surface and the hyphal tip during hyphal induction (a) and adhering to BECs (b). (a) Candida albicans was cultured in RPMI-1640 medium containing 80 lg mL1 verapamil or without verapamil for 2 h, and the cells were observed. Arrows indicate surface and tip localization of Hwp1–GFP. (b) BECs and the fungus were coincubated as described in Fig. 2, and the cells were observed. Scale bar = 10 lm.
growth, this protein, together with other components required for hyphal extension, were packaged in secretory vesicles and transported along the actin cables towards the hyphal tip (Sudbery, 2011). In many fungi (including C. albicans), a cytoplasmic Ca2+ gradient, which is determined by extracellular calcium influx or intracellular calcium release from calcium stores, exists along the hyphae with a high concentration at the hyphal tip during hyphal extension, and the absence of this gradient leads to a ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
defect in polarized growth (Silverman-Gavrila & Lew, 2002, 2003; Brand et al., 2007). We propose that the effect of verapamil on Hwp1 transport is attributed to its inhibitory ability against calcium channels, resulting in a lack of the calcium gradient and consequent defect in Hwp1 transport. Hence, both decreased expression of morphogenesis-associated genes and abnormal transport of their products were supposed to be involved in the inhibitory activity of verapamil against morphogenesis. FEMS Yeast Res 14 (2014) 633–641
639
Verapamil inhibits C. albicans morphogenesis and colonization
(b)
240
Control Verapamil
200 160 120
*
80 40 0
* 7
Time (d)
14
CFU×105/g fecal pellets
CFU×102/g fecal pellets
(a)
320
Control Verapamil
280 240 200 *
160 120 80
*
40 0
7
Time (d)
14
Fig. 5. Verapamil inhibits gastrointestinal colonization of Candida albicans Mice with no antibiotic treatment (a) or with antibiotic treatment (b) were gavaged with the fungus, and then treated with 10 mg (kg day)1 verapamil or without verapamil in drinking water. CFU of faecal pellets were determined on the YPD + SAK plates for the indicated times. *Significant difference between the control group and the verapamil-treated groups (P < 0.05).
Due to the significant effect of verapamil on C. albicans morphogenesis, it is not difficult to understand the observation that this drug causes a decreased ability of gastrointestinal colonization. Several factors, including hyphal development, adhesion and survival in environmental stress such as host immune attack, are related to efficient gastrointestinal colonization of this pathogen (Rosenbach et al., 2010). To successfully survive under stress conditions, C. albicans evolves a dedicated signalling transduction network to sense and respond to these stresses, and the cell calcium survival (CCS) pathway is a matter of great concern in this network (LaFayette et al., 2010). In the CCS pathway, the HACS is a crucial component, mediating cell responds to abundant stress factors, such as antifungal drugs, oxidative agents and high pH (Sanglard et al., 2003; Wang et al., 2011). Therefore, verapamil was proposed to reduce gastrointestinal colonization by inhibiting both morphogenesis, adhesion and stress response. In addition, the observation that verapamil inhibits C. albicans gastrointestinal colonization indicates a possible role of Hwp1 in this process. Although Hwp1 has been demonstrated to be important for morphogenesis and adhesion, its role in gastrointestinal colonization remains to be investigated. Herein, verapamil-caused deficiency of Hwp1 expression and cytoplasmto-surface transport may contribute to the decreased ability of gastrointestinal colonization. This suggested a possible link between Hwp1 functions and gastrointestinal colonization. Increasing evidence supports the view that Candida colonization, especially its gastrointestinal colonization, is a major risk factor for invasive fungal infection in critically ill patients (Charles et al., 2005; Agvald-Ohman et al., 2008; Caggiano et al., 2011). Moreover, its colonization favours the development of pathogenic bacteria in host niches, such as Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli, promoting bacterial
FEMS Yeast Res 14 (2014) 633–641
infections (Ricard & Roux, 2012). Therefore, inhibition of its colonization will be an efficient strategy to protect individuals from invasive candidiasis and Candidarelated bacterial infections. In this study, verapamil showed strong activity against C. albicans gastrointestinal colonization, indicating that it may be used as a drug to prevent these infections in patients, especially those infected by HIV, admitted to the ICU and suffering from severe neutropenia or cancer. In conclusion, this study has revealed the inhibitory effect of verapamil on C. albicans hyphal development, adhesion and gastrointestinal colonization, and this effect is relevant to decreased expression and abnormal transport of the proteins required for morphogenesis. Further investigation into the mechanisms by which calcium channel blockers inhibit C. albicans morphogenesis and the synergy between this drug and other antifungal agents is likely to have an impact on the development of novel and effective therapies against C. albicans infections.
Acknowledgements We thank Prof. Dana Davis and Judith Berman (University of Minnesota, Minneapolis, MN) for generously providing C. albicans strain DAY1 and the plasmid pMG2082, respectively. We are grateful to Prof. Jiatong Chen for fluorescence microscopy, and to Zonglin Liu for microplate reading. This work was supported by the National Natural Science Foundation of China (81171541, 31070126) and Natural Science Foundation of Tianjin (13JCYBJC20700). The authors have declared no conflict of interest.
References Agvald-Ohman C, Klingspor L, Hjelmqvist H & Edlund C (2008) Invasive candidiasis in long-term patients at a
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
640
multidisciplinary intensive care unit: Candida colonization index, risk factors, treatment and outcome. Scand J Infect Dis 40: 145–153. Bates S, MacCallum DM, Bertram G, Munro CA, Hughes HB, Buurman ET, Brown AJP, Odds FC & Gow NAR (2005) Candida albicans Pmr1p, a secretory pathway P-type Ca2+/ Mn2+-ATPase, is required for glycosylation and virulence. J Biol Chem 280: 23408–23415. Blijlevens NM, Donnelly JP & de Pauw BE (2002) Impaired gut function as risk factor for invasive candidiasis in neutropenic patients. Br J Haematol 117: 259–264. Brand A & Gow NA (2009) Mechanisms of hypha orientation of fungi. Curr Opin Microbiol 12: 350–357. Brand A, Shanks S, Duncan VM, Yang M, Mackenzie K & Gow NA (2007) Hyphal orientation of Candida albicans is regulated by a calcium-dependent mechanism. Curr Biol 17: 347–352. Caggiano G, Puntillo F, Coretti C, Giglio M, Alicino I, Manca F, Bruno F & Montagna MT (2011) Candida colonization index in patients admitted to an ICU. Int J Mol Sci 12: 7038–7047. Chaffin WL (2008) Candida albicans cell wall proteins. Microbiol Mol Biol Rev 72: 495–544. Charles PE, Dalle F, Aube H, Doise JM, Quenot JP, Aho LS, Chavanet P & Blettery B (2005) Candida spp. colonization significance in critically ill medical patients: a prospective study. Intensive Care Med 3: 393–400. Cole GT, Halawa AA & Anaissie EJ (1996) The role of the gastrointestinal tract in hematogenous candidiasis: from the laboratory to the bedside. Clin Infect Dis 22: S73–S88. Daniels KJ, Lockhart SR, Staab JF, Sundstrom P & Soll DR (2003) The adhesin Hwp1 and the first daughter cell localize to the a/a portion of the conjugation bridge during Candida albicans mating. Mol Biol Cell 14: 4920–4930. Gaillardin C, Munro CA & Richard ML (2008) Functional analysis of Candida albicans GPI-anchored proteins: roles in cell wall integrity and caspofungin sensitivity. Fungal Genet Biol 45: 1404–1414. Gerami-Nejad M, Dulmage K & Berman J (2009) Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans. Yeast 26: 399–406. Gow NAR, van de Veerdonk FL, Brown AJ & Netea MG (2011) Candida albicans morphogenesis and host defence: discriminating invasion from colonization. Nat Rev Microbiol 10: 112–122. Karababa M, Valentino E & Pardini G (2006) CRZ1, a target of the calcineurin pathway in Candida albicans. Mol Microbiol 59: 1429–1451. Klepser ME (2006) Candida resistance and its clinical relevance. Pharmacotherapy 26: 68–75. LaFayette SL, Collins C, Zaas AK, Schell WA, BetancourtQuiroz M, Gunatilaka AA, Perfect JR & Cowen LE (2010) PKC signaling regulates drug resistance of the fungal pathogen Candida albicans via circuitry comprised of Mkc1, Calcineurin, and Hsp90. PLoS Pathog 6: e1001069.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Q. Yu et al.
Nobile CJ, Nett JE, Andes DR & Mitchell AP (2006) Function of Candida albicans adhesin Hwp1 in biofilm formation. Eukaryot Cell 5: 1604–1610. Odds FC (1987) Candida infections: an overview. Crit Rev Microbiol 15: 1–5. Odds FC, Hanson MF, Davidson AD, Jacobsen MD, Wright P, Whyte JA, Gow NA & Jones BL (2007) One year prospective survey of Candida bloodstream infections in Scotland. J Med Microbiol 56: 1066–1075. Plaine A, Walker L, Da Costa G, Mora-Montes HM, McKinnon A, Gow NA, Gaillardin C, Munro CA & Richard ML (2008) Functional analysis of Candida albicans GPIanchored proteins: roles in cell wall integrity and caspofungin sensitivity. Fungal Genet Biol 45: 1404–1414. Ricard JD & Roux D (2012) Candida colonization in ventilated ICU patients: no longer a bystander!. Intensive Care Med 38: 1243–1245. Richard ML & Plaine A (2007) Comprehensive analysis of glycosylphosphatidylinositol-anchored proteins in Candida albicans. Eukaryot Cell 6: 119–133. Rosenbach A, Dignard D, Pierce JV, Whiteway M & Kumamoto CA (2010) Adaptations of Candida albicans for Growth in the mammalian intestinal tract. Eukaryot Cell 9: 1075–1086. Sanglard D, Ischer F, Marchetti O, Ischer F, Marchetti O, Entenza J & Bille J (2003) Calcineurin A of Candida albicans: involvement in antifungal tolerance, cell morphogenesis and virulence. Mol Microbiol 48: 959– 976. Silverman-Gavrila LB & Lew RR (2002) An IP3-activated Ca2+ channel regulates fungal tip growth. J Cell Sci 115: 5013– 5025. Silverman-Gavrila LB & Lew RR (2003) Calcium gradient dependence of Neurospora crassa hyphal growth. Microbiology 149: 2475–2485. Strigun A, Noor F, Pironti A, Niklas J, Yang TH & Heinzlen E (2011) Metabolic flux analysis gives an insight on verapamil induced changes in central metabolism of HL-1 cells. J Biotechnol 155: 299–307. Sudbery PE (2011) Growth of Candida albicans hyphae. Nat Rev Microbiol 9: 737–748. Teng J, Goto R, Iida K, Kojima I & Iida H (2008) Ion-channel blocker sensitivity of voltage-gated calcium-channel homologue Cch1 in Saccharomyces cerevisiae. Microbiology 154: 3775–3781. Wang H, Liang Y, Zhang B, Zheng W, Xing L & Li M (2011) Alkaline stress triggers an immediate calcium fluctuation in Candida albicans mediated by Rim101p and Crz1p transcription factors. FEMS Yeast Res 11: 430–439. White SJ, Rosenbach A, Lephart P, Nguyen D, Benjamin A, Tzipori S, Whiteway M, Mecsas J & Kumamoto CA (2007) Self-regulation of Candida albicans population size during GI colonization. PLoS Pathog 3: e184. Wilson RB, Davis D & Mitchell AAP (1999) Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J Bacteriol 181: 1868–1874.
FEMS Yeast Res 14 (2014) 633–641
Verapamil inhibits C. albicans morphogenesis and colonization
Yu Q, Wang H, Xu N, Cheng X, Wang Y, Zhang B, Xing L & Li M (2012a) Spf1 strongly influences calcium homeostasis, hyphal development, biofilm formation and virulence in Candida albicans. Microbiology 158: 2272–2282. Yu Q, Wang H, Cheng X, Xu N, Ding X, Xing L & Li M (2012b) Roles of Cch1 and Mid1 in morphogenesis,
FEMS Yeast Res 14 (2014) 633–641
641
oxidative stress response and virulence in Candida albicans. Mycopathologia 174: 359–369. Yu Q, Ding X, Xu N, Cheng X, Qian K, Zhang B, Xing L & Li M (2013) In vitro activity of verapamil singly and in combination with fluconazole or tunicamycin against Candida albicans biofilms. Int J Antimicrob Agents 41: 179–182.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Inhibitory effect of verapamil on Candida albicans hyphal development, adhesion and gastrointestinal colonization Qilin Yu1, Xiaohui Ding1, Bing Zhang1, Ning Xu1, Chang Jia1, Jiwei Mao1, Biao Zhang2, Laijun Xing1 & Mingchun Li1 1
Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, College of Life Science, Nankai University, Tianjin, China; and Tianjin University of Chinese Traditional Medicine, Tianjin, China
2
Correspondence: Mingchun Li, Department of Microbiology, College of Life Science, Nankai University, Tianjin, 300071, China. Tel.: +86 22 2350 8506; fax: +86 22 2350 8800; e-mail: [email protected] Received 29 November 2013; revised 11 February 2014; accepted 4 March 2014. Final version published online 3 April 2014. DOI: 10.1111/1567-1364.12150 Editor: Richard Calderone Keywords verapamil; calcium channel; Candida albicans; morphogenesis; gastrointestinal colonization.
Abstract Candida albicans morphogenesis and gastrointestinal colonization are closely associated with the pathogenicity of this pathogen. This study investigated the in vitro and in vivo effect of verapamil, a calcium channel blocker, on these processes. Exposure to ≥ 10 lg mL1 verapamil led to a significant decrease of C. albicans hyphal cells. The ability to adhere to a polystyrene surface and buccal epithelial cells was inhibited by exposure to ≥ 20 lg mL1 verapamil. Detection of the Hwp1–green fluorescent protein fusion protein showed that verapamil inhibited expression and transport of Hwp1, indicating its activity against both the regulation network of morphogenesis-associated proteins and the secretory pathway in C. albicans. Moreover, treatment with verapamil at 10 mg (kg day)1 led to a remarkable decrease in gastrointestinal-colonizing fungal cells. This study revealed the inhibitory effect of verapamil on C. albicans hyphal development, adhesion and gastrointestinal colonization, which is relevant to decreased expression and abnormal transport of the proteins required for morphogenesis. Therefore, verapamil may be taken into account when choosing an antifungal therapy against C. albicans colonization and infection.
YEAST RESEARCH
Introduction Candida albicans is one of the most prevalent fungal pathogens. It can cause not only superficial mucosal candidiasis, but also life-threatening systemic infections in immunocompromised patients (Klepser, 2006; Odds et al., 2007). In particular, C. albicans colonization is frequently a risk in intensive care unit (ICU) patients, and infections caused by this pathogen in this population are of growing interest (Charles et al., 2005). An important feature of this pathogen is its ability to switch between different morphological forms, including yeast, pseudohyphae and true hyphae (Sudbery, 2011). Abundant evidence has shown that the ability to make morphogenetic switches is involved in adhesion and invasion of host tissues, and is a crucial virulence attribute of this pathogen (Gow et al., 2011). Besides being an opportunistic pathogen, C. albicans is commonly found in the gastrointestinal tract (Odds, 1987), which is thought to be a frequent source of invasive candidiasis (Cole et al., 1996; Blijlevens et al., 2002). To achieve FEMS Yeast Res 14 (2014) 633–641
efficient gastrointestinal colonization, this fungus possesses complicated adaptation capacities to sense host niches, adhere to the host mucosal surface and successfully colonize this unique environment. All of these capacities are also related to morphogenetic processes (White et al., 2007). Therefore, strategies that inhibit morphogenesis of this fungus may also have an impact on relevant physiological processes, such as adhesion, colonization and invasion of host tissues, and may be used for antifungal drugs against its infections. Candida albicans morphogenetic processes depend on its mechanisms of sensing and responding to environmental cues by sophisticated signal transduction pathways leading to expression of morphogenesis-related genes, and functions of the products encoded by these genes (Gow et al., 2011; Sudbery, 2011). Among these functional factors, Hwp1, a well-known morphopathogenic determinant, plays an important role in morphogenesis, including hyphal development, biofilm formation, adhesion and mating (Daniels et al., 2003; Nobile et al., 2006). During ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
634
Q. Yu et al.
these processes, Hwp1 is highly expressed, linked to the glycosylphosphatidylinositol anchor in the endoplasmic reticulum (ER) and transported to the cell surface by the secretory pathway (Chaffin, 2008; Plaine et al., 2008; Gaillardin et al., 2008). Hence, deficiency in Hwp1 expression or transport will influence the morphogenetic ability of this fungus. In C. albicans, calcium signalling functions not only in stress response, but also in morphogenesis (Sanglard et al., 2003; Bates et al., 2005; Wang et al., 2011), which is dependent on the calcium homeostasis system (Karababa et al., 2006). Our previous studies also revealed that several members of the calcium homeostasis system, such as the high-affinity calcium influx system (HACS, Cch1– Mid1 complex) and Spf1, play an important role in morphogenesis (Yu et al., 2012a, b). These findings indicated that agents interrupting the calcium homeostasis system have potential inhibitory effects on C. albicans morphogenesis. Verapamil, a typical calcium channel blocker of the phenylalkylamine class, is widely used in the treatment of angina pectoris and hypertension (Strigun et al., 2011). This drug, as an L-type voltage-gated calcium channel (VGCC) blocker, was shown to partially inhibit the function of the HACS, resulting in decreased calcium influx under normal growth conditions in Saccharomyces cerevisiae (Teng et al., 2008). A recent study further revealed that it also inhibits C. albicans calcium uptake when the cells are confronted with alkaline stimulus, indicating its activity against calcium homeostasis in fungal cells (our unpublished data). Most importantly, this drug has in vitro activity against C. albicans biofilm formation and maintenance (Yu et al., 2013). Because of the relationship among biofilm formation, hyphal development, adhesion and colonization, we evaluated the effect of verapamil on these processes, and investigated whether this effect is associated with abnormal expression and transport of Hwp1, the factor related to morphogenesis.
the morphogenesis-associated gene HWP1 and Hwp1 localization, a GF-URA3-FP cassette was amplified from plasmid pMG2082 (Gerami-Nejad et al., 2009) with the following primers: 50 -AGGAAGCTCTTATTCAAAAG AGATCTTATGATTACTATCAAGAACCATGTGATGATT ACCCACAACAATCTAAAGGTGAAGAATTATTC-30 , 50 -T GTAGAAATAGGAGCGACACTTGAGTAATTGGCAGAT GGTTGCATGAGTGGAACTGATTCTAATGTAGTTTTGT ACAATTCATCCATAC-30 . This cassette was then transformed into strain DAY1 (Wilson et al., 1999), to give strain NKF151 in which the incomplete copy of GFP flanking the URA3 marker was inserted at the HWP1 locus. Cells of strain NKF151 were cultured on SC medium plates (0.67% yeast nitrogen base, 0.2% amino acid mixture, 2% glucose, 2% agar) containing 0.1% 5-fluoroorotic acid, generating strain NKF152. In this strain, the URA3 sequence was deleted, and a functional GFP gene was consequently in-frame with the HWP1 gene (Gerami-Nejad et al., 2009). In addition, expression of the fusion gene HWP1–GFP is controlled by the HWP1 promoter.
Materials and methods
Adhesion to polystyrene
Strains
Strains used in this study are listed in Table 1. For construction of strain NKF152 for indicating expression of
Hyphal induction
Candida albicans hyphae were induced in liquid RPMI1640 medium. Overnight cultured cells of strain SC5314 or NKF152 were harvested, washed with phosphate-buffered saline (PBS), and diluted with RPMI-1640 medium to an optical absorbance at 600 nm (A600 nm) of 0.1. Verapamil was then added at 0, 10, 20, 40, 80, 160, 320 or 640 lg mL1. The cell suspensions were cultured at 37 ℃ with shaking for the indicated times. Cells were centrifuged, fixed with 4% formaldehyde and observed with a light microscope (Olympus). Both hyphal cells and total cells were counted, and the percentage of hyphal cells was calculated as the number of hyphal cells divided by the number of total cells. At least 10 microscopic fields were detected.
Overnight cultured cells were diluted with RPMI-1640 medium as described above, and the suspension was added into 24-well polystyrene microplates. Verapamil was supplemented into the wells as in hyphal induction.
Table 1. Strains used in this study Strain
Genotype
Source
SC5314 DAY1 NKF151 NKF152
Wild-type ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG HWP1-GF-URA3-FP ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG HWP1-GFP
American type culture collection Dana Davis (Wilson et al., 1999) This study This study
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Yeast Res 14 (2014) 633–641
635
Verapamil inhibits C. albicans morphogenesis and colonization
The plates were incubated at 37 ℃ for 4 h, washed with PBS buffer, and stained using 0.1% crystal violet for 5 min. The wells were then washed again with PBS buffer, and 500 lL of 10% acetic acid was added to extract the dye. The optical absorbance at 595 nm (A595 nm) of the extract was determined using a spectrophotometer (Bio-Rad). The percentage of adhering cells were calculated as the A595 nm of each group divided by the A595 nm of the control group 9 100%. The cells adhering to the well surface were also examined by light microscopy. Adhesion to buccal epithelial cells (BECs)
Adhesion to BECs was assessed according to Bates et al. (2005). BECs were collected from healthy individuals, washed with sterilized physiological saline and suspended in the same solution at 2.5 9 105 mL1. Cells of C. albicans strain SC5314 or NKF152 were cultured overnight in modified NGY medium (0.1% peptone, 0.1% yeast extract, 0.4% glucose), harvested, washed with saline and suspended in the same solution at 2.5 9 106 yeast cells mL1. Then, 100 lL of BECs and 100 lL of yeast cells were mixed. Verapamil was added to the mixtures as described for hyphal induction. The mixture was incubated with shaking at 30 ℃ for 1 h, washed with saline, fixed with 4% formaldehyde and observed. The percentage of fungus-adhered BECs was calculated as the number of fungus-adhered BECs divided by the number of total BECs 9 100%. Quantification of green fluorescent protein (GFP) fluorescence
Fluorescence intensities of the fusion protein Hwp1–GFP expressed in strain NKF152 were detected to assess expression levels of HWP1. Hyphae of NKF152 were induced for the indicated time, collected, washed with PBS buffer and fixed with 4% formaldehyde. The fluorescence intensities (excitation wave 488 nm, emission wave 520 nm) of the hyphal suspension were determined using a fluorescent microplate reader (PerkinElmer). Fluorescence microscopy
NKF152 hyphal cells in RPMI-1640 or yeast cells adhering to BECs were fixed. The localization of Hwp1–GFP was observed by fluorescence microscopy (Olympus) with the GFP filter set. Measurement of gastrointestinal colonization
Gastrointestinal colonization of strain SC4314 was assessed by a modified method of White et al. (2007). Candida FEMS Yeast Res 14 (2014) 633–641
albicans cells were cultured overnight in liquid YPD medium, washed with sterilized saline, and adjusted with the same solution to 2.5 9 108 cells mL1. Forty female Institute of Cancer Research mice (18–20 g) were equally divided into four groups, two antibiotic-free groups and two antibiotic-treated groups. In the antibiotic-free groups, the mice were inoculated with 200 lL of yeast cells by oral gavage, and then treated without verapamil (the antibioticfree control group) or with verapamil [10 mg (kg day)1, the verapamil group] in their drinking water throughout the experiment. In the antibiotic-treated groups, the mice were treated with streptomycin (2 mg mL1), tetracycline (1 mg mL1) and gentamycin (0.1 mg mL1) in their drinking water throughout the experiment beginning 3 days prior to yeast inoculation. After being inoculated with yeast cells, the mice were treated without verapamil (the antibiotic-treated control group) or with verapamil as the antibiotic-free groups. To monitor gastrointestinal colonization, fresh fecal pellets (produced within 5 min prior to collection) were collected on the 7th and 14th days, and C. albicans concentrations in the pellets were measured by plating pellet homogenates on YPD SAK plates (1% yeast extract, 2% peptone, 2% glucose, 2% agar, 100 lg mL1 streptomycin, 100 lg mL1 ampicillin and 50 lg mL1 kanamycin). The animal experiments were approved by the Institutional Animal Care and Use Committee of Nankai University. Statistic analysis
Each experiment was performed with five replicates for each treatment. The effect of verapamil on hyphal development, adhesion and colonization was compared with the control (no verapamil treatment), and the significance of the difference (P < 0.05) was assessed using Student’s t-test using SPSS v19.0 software (IBM).
Results Verapamil inhibits C. albicans hyphal development
Our previous study revealed that disruption of the genes encoding calcium channels resulted in abnormal hyphal formation of C. albicans. As verapamil is a potential calcium channel blocker, we evaluated the inhibitory effect of this drug on hyphal development. When induced for 2 h, 95% of cells formed true hyphae in liquid drug-free RPMI-1640 medium. In contrast, only 70% of cells produced hyphae by exposure to 10 lg mL1 verapamil (Fig. 1). Increasing the concentration of verapamil resulted in drastic reduction of hyphal cells, and the percentage of hyphal cells deceased to < 15% by exposure to ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
636
Q. Yu et al.
120 0
% Hypahl cells
100 80 60
10
*
20
* ** *
*
40
*
20 0
40
*
80
*
*
2
160
*
*
*
** ** ** *
*
4 Time (h)
320 640
6
Fig. 1. Verapamil inhibits Candida albicans hyphal development. Candida albicans cells were incubated in RPMI-1640 medium containing different concentrations of verapamil (lg mL1). Both the total cells and the hyphal cells were counted for the indicated times. *Significant difference between the control group (0) and the verapamil-treated groups (P < 0.05).
320 lg mL1. Similarly, when induced for prolonged periods, treatment of verapamil with the tested concentrations led to a significant decrease of hypahl cells as compared with the control. Notably, the proportion of hyphal cells decreased from 60% to only 20% by exposure to 10 lg mL1 verapamil for 6 h (Fig. 1). Therefore, verapamil showed a remarkable inhibitory effect on C. albicans hyphal development. Verapamil inhibits C. albicans adherence
Another factor that allows C. albicans to invade host tissues is its ability to adhere to host cells. Here we further assess the effect of verapamil on C. albicans adherence to polystyrene and BECs. When incubated on the surface of polystyrene microplates, 20 lg mL1 or higher
(a) 120
concentrations of verapamil resulted in a significant decrease of cell attachment. A strong negative correlation was seen between verapamil levels and the biomass of adhering cells. The proportion of adherent cells reduced from 65% to 10% as the concentrations of verapamil increased from 20 to 640 lg mL1 (Fig. 2a). Exposure of verapamil also led to a significant decrease of C. albicans attachment to BECs when the drug concentration reached 20 lg mL1. Interestingly, the proportion of adhering BECs remained c. 30% as the verapamil concentrations increased from 80 to 640 lg mL1 (Fig. 2b). Moreover, while most of the control cells adhered to the well surface by hyphae, abundant adherent fungal cells exposed to verapamil displayed yeast-like morphology, indicating that this drug also inhibits hyphal development during adhesion. Thus, verapamil also inhibits C. albicans adherence to both polystyrene and host epithelial cells. Verapamil inhibits expression of HWP1 associated with hyphal development
Studies have suggested that the adhesin HWP1 is closely associated with hyphal development and adhesion in C. albicans, and is upregulated during these processes. Therefore, we tested if the inhibitory effects of verapamil on morphogenesis are relevant to its abnormal expression. We tagged Hwp1 with GFP, and evaluated its expression levels by GFP fluorescence assays. Cells treated with ≥ 20 lg mL1 verapamil had significantly lower fluorescence density than the control within the tested time. Notably, GFP fluorescence decreased by 50% when the concentration of verapamil increased to 160 lg mL1 (Fig. 3). This result demonstrated that verapamil indeed inhibits the expression of HWP1 under hyphal induction,
(b)
80
% Adhered BECs
% Adhered cells
70 60
100 * *
60 40
*
20
*
*
*
0
*
50
*
40 30
*
*
*
*
20 10 0
0
10
20 40 80 160 320 640 Verapamil (μg mL–1)
0
10
20 40 80 160 320 640 Verapamil (μg mL–1)
Fig. 2. Verapamil inhibits adherence of Candida albicans to polystyrene surface (a) and BECs (b). (a) Candida albicans cells were suspended in RPMI-1640 medium with different levels of verapamil, and added to polystyrene microplates. The biomass of C. albicans adhering to the polystyrene surface was quantified by crystal violet staining. The percentage of adherent cells were calculated as the A595 nm of each group divided by the A595 nm of the control group (0) 9 100%. (b) BECs and C. albicans were coincubated for 1 h, and fungus-adhered and total BECs were counted. The percentage of fungus-adhered BECs was calculated as the number of fungus-adhered BECs divided by the number of total BECs 9 100%. *Significant difference between the control group (0) and the verapamil-treated groups (P < 0.05).
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Yeast Res 14 (2014) 633–641
637
Verapamil inhibits C. albicans morphogenesis and colonization
GFP fluorescence
1000
0 10
800 600
20
* *
40
* ** *
400
*
* ** **
200
80
*
****
160 320 640
0
cell surface, which may be also linked to its effect on morphogenesis.
2
4 Time (h)
6
Fig. 3. Verapamil inhibits expression of HWP1. Strain NKF152 was incubated in RPMI-1640 medium containing different concentrations of verapamil (lg mL1), and GFP fluorescence density of the culture was determined for the indicated times. *Significant difference between the control group (0) and the verapamil-treated groups (P < 0.05).
which may contribute to its inhibitory effect on morphogenesis. Verapamil inhibits Hwp1 transport
Hwp1, as a hyphal cell-wall protein, has to be transported to the cell surface through the secretory pathway for its functions during cell-surface adhesion. Using the Hwp1– GFP system, we further investigated whether verapamil also affected the transport of Hwp1 during morphogenesis. As expected, the control cells formed regular hyphae after 2 h of hyphal induction, and Hwp1–GFP was localized not only in the cytoplasm, but also on the cell surface and the hyphal tip (Fig. 4a, its localization on the cell surface and the hyphal tip is indicated by white arrows). This observation implied normal synthesis and cytoplasm-to-surface transport of Hwp1–GFP in the control cells. In contrast, few hyphal cells were observed when exposed to 80 lg mL1 verapamil, and the fusion protein of the treated cells was localized predominately in the cytoplasm rather than the cell surface, suggesting that transport of the synthesized protein from the cytoplasm to the cell surface was inhibited by verapamil. We obtained similar results when using the BEC model to evaluate Hwp1 localization. Most of the control C. albicans cells adhered to BECs, with regular surface localization of Hwp1–GFP in abundant fungal cells, although a few cells showed both a cytoplasm and surface localization of this protein. However, the cells treated with verapamil at the same concentration displayed only cytoplasm localization of the fusion protein, and decreased adhering ability to BECs (Fig. 4b). These observations suggested that verapamil also has an impact on Hwp1 transport from the cytoplasm to the FEMS Yeast Res 14 (2014) 633–641
Verapamil inhibits C. albicans gastrointestinal colonization
We further investigated the in vivo effect of verapamil on C. albicans morphogenesis using two gastrointestinal colonization models. In the antibiotic-free model, CFU of the verapamil group [by exposure to 10 mg (kg day)1 verapamil] from the faecal pellets decreased c. twofold on the 7th day post-inoculation, and decreased more than 15-fold on the 14th day compared with the control group (Fig. 5a). Similarly, in the antibiotic-treated model, a significant decrease of CFU in the verapamil group was observed on the tested days (Fig. 5b). Thus, verapamil displayed an inhibitory effect on C. albicans gastrointestinal colonization, which may be associated with its effect on hyphal development and adhesion of this pathogen.
Discussion The cytoplasmic membrane HACS, composed of Cch1 and Mid1, was shown to play a role in morphogenesis (Brand & Gow, 2009). The system mediates calcium influx and leads to the elevation of tip Ca2+ in the hyphal apex that is required for determination of tropism (Brand et al., 2007). It also functions in hyphal maintenance rather than hyphal formation, which is associated with the transcription regulation of morphogenesis-associated genes (Yu et al., 2012b). In this study, we demonstrate that verapamil, an efficient blocker of the HACS, has an inhibitory effect on hyphal development, further confirming the role of calcium channels in C. albicans morphogenesis. Therefore, calcium channels may be a potential target against morphogenesis of C. albicans. Given the importance of Hwp1 in C. albicans morphogenesis, we investigated the effect of verapamil on expression and transport of this protein. On the one hand, GFP fluorescence detection showed that treatment with verapamil caused a significant decrease of HWP1 expression, indicating the inhibitory activity of this drug against expression of morphogenesis-associated genes. This observation is consistent with our previous findings that deletion of genes encoding calcium channels led to decreased expression of these genes (Yu et al., 2012b). On the other hand, verapamil also has a remarkable impact on Hwp1 transport towards to the cell surface and the hyphal tip. As a typical glycosylphosphatidylinositol-anchored protein, Hwp1 is synthesized and modified with the glycosylphosphatidylinositol anchor in the ER lumen, and then follows the secretory pathway to the cell surface (Richard & Plaine, 2007). In particular, during polarized hyphal ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
638
Q. Yu et al.
(a)
(b)
Fig. 4. Verapamil inhibits the transport of Hwp1 to the cell surface and the hyphal tip during hyphal induction (a) and adhering to BECs (b). (a) Candida albicans was cultured in RPMI-1640 medium containing 80 lg mL1 verapamil or without verapamil for 2 h, and the cells were observed. Arrows indicate surface and tip localization of Hwp1–GFP. (b) BECs and the fungus were coincubated as described in Fig. 2, and the cells were observed. Scale bar = 10 lm.
growth, this protein, together with other components required for hyphal extension, were packaged in secretory vesicles and transported along the actin cables towards the hyphal tip (Sudbery, 2011). In many fungi (including C. albicans), a cytoplasmic Ca2+ gradient, which is determined by extracellular calcium influx or intracellular calcium release from calcium stores, exists along the hyphae with a high concentration at the hyphal tip during hyphal extension, and the absence of this gradient leads to a ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
defect in polarized growth (Silverman-Gavrila & Lew, 2002, 2003; Brand et al., 2007). We propose that the effect of verapamil on Hwp1 transport is attributed to its inhibitory ability against calcium channels, resulting in a lack of the calcium gradient and consequent defect in Hwp1 transport. Hence, both decreased expression of morphogenesis-associated genes and abnormal transport of their products were supposed to be involved in the inhibitory activity of verapamil against morphogenesis. FEMS Yeast Res 14 (2014) 633–641
639
Verapamil inhibits C. albicans morphogenesis and colonization
(b)
240
Control Verapamil
200 160 120
*
80 40 0
* 7
Time (d)
14
CFU×105/g fecal pellets
CFU×102/g fecal pellets
(a)
320
Control Verapamil
280 240 200 *
160 120 80
*
40 0
7
Time (d)
14
Fig. 5. Verapamil inhibits gastrointestinal colonization of Candida albicans Mice with no antibiotic treatment (a) or with antibiotic treatment (b) were gavaged with the fungus, and then treated with 10 mg (kg day)1 verapamil or without verapamil in drinking water. CFU of faecal pellets were determined on the YPD + SAK plates for the indicated times. *Significant difference between the control group and the verapamil-treated groups (P < 0.05).
Due to the significant effect of verapamil on C. albicans morphogenesis, it is not difficult to understand the observation that this drug causes a decreased ability of gastrointestinal colonization. Several factors, including hyphal development, adhesion and survival in environmental stress such as host immune attack, are related to efficient gastrointestinal colonization of this pathogen (Rosenbach et al., 2010). To successfully survive under stress conditions, C. albicans evolves a dedicated signalling transduction network to sense and respond to these stresses, and the cell calcium survival (CCS) pathway is a matter of great concern in this network (LaFayette et al., 2010). In the CCS pathway, the HACS is a crucial component, mediating cell responds to abundant stress factors, such as antifungal drugs, oxidative agents and high pH (Sanglard et al., 2003; Wang et al., 2011). Therefore, verapamil was proposed to reduce gastrointestinal colonization by inhibiting both morphogenesis, adhesion and stress response. In addition, the observation that verapamil inhibits C. albicans gastrointestinal colonization indicates a possible role of Hwp1 in this process. Although Hwp1 has been demonstrated to be important for morphogenesis and adhesion, its role in gastrointestinal colonization remains to be investigated. Herein, verapamil-caused deficiency of Hwp1 expression and cytoplasmto-surface transport may contribute to the decreased ability of gastrointestinal colonization. This suggested a possible link between Hwp1 functions and gastrointestinal colonization. Increasing evidence supports the view that Candida colonization, especially its gastrointestinal colonization, is a major risk factor for invasive fungal infection in critically ill patients (Charles et al., 2005; Agvald-Ohman et al., 2008; Caggiano et al., 2011). Moreover, its colonization favours the development of pathogenic bacteria in host niches, such as Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli, promoting bacterial
FEMS Yeast Res 14 (2014) 633–641
infections (Ricard & Roux, 2012). Therefore, inhibition of its colonization will be an efficient strategy to protect individuals from invasive candidiasis and Candidarelated bacterial infections. In this study, verapamil showed strong activity against C. albicans gastrointestinal colonization, indicating that it may be used as a drug to prevent these infections in patients, especially those infected by HIV, admitted to the ICU and suffering from severe neutropenia or cancer. In conclusion, this study has revealed the inhibitory effect of verapamil on C. albicans hyphal development, adhesion and gastrointestinal colonization, and this effect is relevant to decreased expression and abnormal transport of the proteins required for morphogenesis. Further investigation into the mechanisms by which calcium channel blockers inhibit C. albicans morphogenesis and the synergy between this drug and other antifungal agents is likely to have an impact on the development of novel and effective therapies against C. albicans infections.
Acknowledgements We thank Prof. Dana Davis and Judith Berman (University of Minnesota, Minneapolis, MN) for generously providing C. albicans strain DAY1 and the plasmid pMG2082, respectively. We are grateful to Prof. Jiatong Chen for fluorescence microscopy, and to Zonglin Liu for microplate reading. This work was supported by the National Natural Science Foundation of China (81171541, 31070126) and Natural Science Foundation of Tianjin (13JCYBJC20700). The authors have declared no conflict of interest.
References Agvald-Ohman C, Klingspor L, Hjelmqvist H & Edlund C (2008) Invasive candidiasis in long-term patients at a
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
640
multidisciplinary intensive care unit: Candida colonization index, risk factors, treatment and outcome. Scand J Infect Dis 40: 145–153. Bates S, MacCallum DM, Bertram G, Munro CA, Hughes HB, Buurman ET, Brown AJP, Odds FC & Gow NAR (2005) Candida albicans Pmr1p, a secretory pathway P-type Ca2+/ Mn2+-ATPase, is required for glycosylation and virulence. J Biol Chem 280: 23408–23415. Blijlevens NM, Donnelly JP & de Pauw BE (2002) Impaired gut function as risk factor for invasive candidiasis in neutropenic patients. Br J Haematol 117: 259–264. Brand A & Gow NA (2009) Mechanisms of hypha orientation of fungi. Curr Opin Microbiol 12: 350–357. Brand A, Shanks S, Duncan VM, Yang M, Mackenzie K & Gow NA (2007) Hyphal orientation of Candida albicans is regulated by a calcium-dependent mechanism. Curr Biol 17: 347–352. Caggiano G, Puntillo F, Coretti C, Giglio M, Alicino I, Manca F, Bruno F & Montagna MT (2011) Candida colonization index in patients admitted to an ICU. Int J Mol Sci 12: 7038–7047. Chaffin WL (2008) Candida albicans cell wall proteins. Microbiol Mol Biol Rev 72: 495–544. Charles PE, Dalle F, Aube H, Doise JM, Quenot JP, Aho LS, Chavanet P & Blettery B (2005) Candida spp. colonization significance in critically ill medical patients: a prospective study. Intensive Care Med 3: 393–400. Cole GT, Halawa AA & Anaissie EJ (1996) The role of the gastrointestinal tract in hematogenous candidiasis: from the laboratory to the bedside. Clin Infect Dis 22: S73–S88. Daniels KJ, Lockhart SR, Staab JF, Sundstrom P & Soll DR (2003) The adhesin Hwp1 and the first daughter cell localize to the a/a portion of the conjugation bridge during Candida albicans mating. Mol Biol Cell 14: 4920–4930. Gaillardin C, Munro CA & Richard ML (2008) Functional analysis of Candida albicans GPI-anchored proteins: roles in cell wall integrity and caspofungin sensitivity. Fungal Genet Biol 45: 1404–1414. Gerami-Nejad M, Dulmage K & Berman J (2009) Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans. Yeast 26: 399–406. Gow NAR, van de Veerdonk FL, Brown AJ & Netea MG (2011) Candida albicans morphogenesis and host defence: discriminating invasion from colonization. Nat Rev Microbiol 10: 112–122. Karababa M, Valentino E & Pardini G (2006) CRZ1, a target of the calcineurin pathway in Candida albicans. Mol Microbiol 59: 1429–1451. Klepser ME (2006) Candida resistance and its clinical relevance. Pharmacotherapy 26: 68–75. LaFayette SL, Collins C, Zaas AK, Schell WA, BetancourtQuiroz M, Gunatilaka AA, Perfect JR & Cowen LE (2010) PKC signaling regulates drug resistance of the fungal pathogen Candida albicans via circuitry comprised of Mkc1, Calcineurin, and Hsp90. PLoS Pathog 6: e1001069.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Q. Yu et al.
Nobile CJ, Nett JE, Andes DR & Mitchell AP (2006) Function of Candida albicans adhesin Hwp1 in biofilm formation. Eukaryot Cell 5: 1604–1610. Odds FC (1987) Candida infections: an overview. Crit Rev Microbiol 15: 1–5. Odds FC, Hanson MF, Davidson AD, Jacobsen MD, Wright P, Whyte JA, Gow NA & Jones BL (2007) One year prospective survey of Candida bloodstream infections in Scotland. J Med Microbiol 56: 1066–1075. Plaine A, Walker L, Da Costa G, Mora-Montes HM, McKinnon A, Gow NA, Gaillardin C, Munro CA & Richard ML (2008) Functional analysis of Candida albicans GPIanchored proteins: roles in cell wall integrity and caspofungin sensitivity. Fungal Genet Biol 45: 1404–1414. Ricard JD & Roux D (2012) Candida colonization in ventilated ICU patients: no longer a bystander!. Intensive Care Med 38: 1243–1245. Richard ML & Plaine A (2007) Comprehensive analysis of glycosylphosphatidylinositol-anchored proteins in Candida albicans. Eukaryot Cell 6: 119–133. Rosenbach A, Dignard D, Pierce JV, Whiteway M & Kumamoto CA (2010) Adaptations of Candida albicans for Growth in the mammalian intestinal tract. Eukaryot Cell 9: 1075–1086. Sanglard D, Ischer F, Marchetti O, Ischer F, Marchetti O, Entenza J & Bille J (2003) Calcineurin A of Candida albicans: involvement in antifungal tolerance, cell morphogenesis and virulence. Mol Microbiol 48: 959– 976. Silverman-Gavrila LB & Lew RR (2002) An IP3-activated Ca2+ channel regulates fungal tip growth. J Cell Sci 115: 5013– 5025. Silverman-Gavrila LB & Lew RR (2003) Calcium gradient dependence of Neurospora crassa hyphal growth. Microbiology 149: 2475–2485. Strigun A, Noor F, Pironti A, Niklas J, Yang TH & Heinzlen E (2011) Metabolic flux analysis gives an insight on verapamil induced changes in central metabolism of HL-1 cells. J Biotechnol 155: 299–307. Sudbery PE (2011) Growth of Candida albicans hyphae. Nat Rev Microbiol 9: 737–748. Teng J, Goto R, Iida K, Kojima I & Iida H (2008) Ion-channel blocker sensitivity of voltage-gated calcium-channel homologue Cch1 in Saccharomyces cerevisiae. Microbiology 154: 3775–3781. Wang H, Liang Y, Zhang B, Zheng W, Xing L & Li M (2011) Alkaline stress triggers an immediate calcium fluctuation in Candida albicans mediated by Rim101p and Crz1p transcription factors. FEMS Yeast Res 11: 430–439. White SJ, Rosenbach A, Lephart P, Nguyen D, Benjamin A, Tzipori S, Whiteway M, Mecsas J & Kumamoto CA (2007) Self-regulation of Candida albicans population size during GI colonization. PLoS Pathog 3: e184. Wilson RB, Davis D & Mitchell AAP (1999) Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J Bacteriol 181: 1868–1874.
FEMS Yeast Res 14 (2014) 633–641
Verapamil inhibits C. albicans morphogenesis and colonization
Yu Q, Wang H, Xu N, Cheng X, Wang Y, Zhang B, Xing L & Li M (2012a) Spf1 strongly influences calcium homeostasis, hyphal development, biofilm formation and virulence in Candida albicans. Microbiology 158: 2272–2282. Yu Q, Wang H, Cheng X, Xu N, Ding X, Xing L & Li M (2012b) Roles of Cch1 and Mid1 in morphogenesis,
FEMS Yeast Res 14 (2014) 633–641
641
oxidative stress response and virulence in Candida albicans. Mycopathologia 174: 359–369. Yu Q, Ding X, Xu N, Cheng X, Qian K, Zhang B, Xing L & Li M (2013) In vitro activity of verapamil singly and in combination with fluconazole or tunicamycin against Candida albicans biofilms. Int J Antimicrob Agents 41: 179–182.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
