CED
Experimental dermatology • Original article
Clinical and Experimental Dermatology
Inhibitory effects of imatinib mesylate on human epidermal melanocytes Y. Wang, Y. Zhao, L. Liu, L. Zhang, H. Xiao, K. Wu, Y. Xu, Y. Hu, H. Fu, W. Cao, Y. Luo and H. Huang Bone Marrow Transplantation Center, The First Affiliated Hospital, Zhejiang University School of Medicine, Zhejiang, China doi:10.1111/ced.12261
Summary
Background. In recent years, increasing attention has been focused on the skin hypopigmentation that develops after the initiation of imatinib mesylate therapy in patients with chronic myeloid leukaemia (CML). Aim. To understand the underlying mechanism of this hypopigmentation effect, and to explore the possibility of using imatinib in the treatment of pigmentation disorders. Methods. We examined the effects of imatinib on the proliferation, apoptosis, melanin content and melanogenic activity of human primary epidermal melanocytes. The responsible molecular events were also investigated in a mechanism study. Results. We found that imatinib led to a dramatic decrease in total melanin content in cultured melanocytes, by affecting melanocyte number and/or melanogenesis in a dose-dependent manner. This inhibition of melanogenesis was due to suppressed expression of tyrosinase and microphthalmia-associated transcription factor (MiTF). Furthermore, stem cell factor (SCF)-stimulated c-Kit activation and melanocyte proliferation were completely abrogated by imatinib. Conclusions. Inactivation of c-Kit signalling by imatinib has inhibitory effects on melanocyte survival, proliferation and melanogenesis, which explains the clinical hypopigmentation seen in patients with CML. These results also support using imatinib as a clinical depigmentation agent when dosage being carefully determined.
Introduction Imatinib mesylate (Gleevec/Glivec, Novartis, Basel, Switzerland)) is a potent tyrosine kinase inhibitor, which targets the BCR-ABL fusion protein in chronic myeloid leukaemia (CML).1 Imatinib has significantly improved the prognosis of CML, albeit with adverse effects such as nausea and diarrhoea, although these are typically mild to moderate.2 Generalized skin hypopigmentation is also a common side effect of imatinib, which occurs in 33–85% of patients, according to a Correspondence: Dr He Huang, Bone Marrow Transplantation Center, The First Affiliated Hospital, Zhejiang University School of Medicine, No. 79 Qing Chun Road, Hangzhou, Zhejiang 310003, China E-mail: [email protected] Conflict of interest: none declared. Accepted for publication 27 September 2013
202
Clinical and Experimental Dermatology (2014) 39, pp202–208
series of clinical studies, mainly from Asia.3–7 We previously reported favourable therapeutic efficacy but a high incidence (77.6%) of generalized skin hypopigmentation during imatinib treatment in 116 Chinese patients with CML.8 The reason for this generalized hypopigmentation associated with imatinib is not well understood. There is only one in vitro study showing that imatinib significantly reduced the number of melanocytes with high tyrosinase activity, but the mechanism was not elucidated further.9 In our experience, imatinib-induced hypopigmentation does not seem to be relevant to disease status, response to imatinib or clinical outcome, indicating a mechanism different from its therapeutic effect. In addition to inhibiting BCR-ABL, imatinib also targets other tyrosine kinases such as c-Kit.10 c-Kit is specifically expressed on melanocytes, and plays a
ª 2014 British Association of Dermatologists
Imatinib induces skin hypopigmentation Y. Wang et al.
crucial role in melanocyte development, differentiation and maintenance by binding to its ligand, stem cell factor (SCF).11 Thus in the present study, we investigated the effects of imatinib on cultured normal human epidermal melanocytes, including cell proliferation, apoptosis, melanin content and melanogenic activity. We also measured SCF/c-Kit signalling and expression of tyrosinase and MiTF to elucidate the underlying mechanism of the skin hypopigmentation caused by imatinib. This study not only provides further insights into the clinical hypopigmentation caused by imatinib, but also sheds new light on the use of imatinib in the treatment of pigmentation disorders.
Methods Ethics approval
The study was approved by the ethics committee of the First Affiliated Hospital, Zhejiang University School of Medicine. Informed consent was obtained from all donors.
then measured at 475 nm with a reference wavelength of 650 nm using the microplate reader. Tyrosinase activity was determined by incubating 100 lL of cell lysate (containing 30 lg of protein) with 100 lL of 10 mmol/L 3,4-dihydroxy-L-phenylalanine (L-Dopa) at 37 °C for 1 h. The optical densities of the supernatants were measured as described above for the melanin content assay. The cell number, melanin content and tyrosinase activity of the treated cells were all calculated relative to the control. Cell apoptosis assay
Cell apoptosis was detected using a commercial assay (Vybrant Apoptosis Assay Kit; Invitrogen Corp). Treated cells were harvested and resuspended in 100 lL of 1 9 annexin-binding buffer at a density of 1 9 106 cells/ml. Following this, 5 lL Alexa Fluor 488, annexin V and 1 lL 100 lg/ml propidium iodide (PI) working solution were added to the cell suspension, and samples were incubated for 15 min before being analysed by flow cytometry, Western blot analysis
Primary melanocyte and fibroblast cultures
Normal human epidermal melanocytes and fibroblasts were isolated from foreskins of Chinese adults obtained from circumcisions. Melanocytes were maintained in Medium 254 supplemented with Human Melanocyte Growth Supplement (Invitrogen Corp., Carlsbad, CA, USA). Fibroblasts were maintained in DMEM supplemented with 10% FBS, and routinely passaged. Cells from passage numbers between 7 and 13 were used in the experiments. Treatments
Human melanocytes and/or fibroblasts were treated with different concentrations of imatinib (Norvartis, Basel, Switzerland) or arbutin (Sigma-Aldrich, St. Louis, MO, USA), with or without SCF (PrimeGene, Shanghai, China), and maintained for 0–7 days. Untreated cells were used as control. Cell proliferation was determined by the cholecystokinin octapepeptide (CCK-8) method (Dojindo Laboratories, Kumamoto, Japan). The absorbance was measured at a wavelength of 450 nm with a reference wavelength of 650 nm, using a multimode microplate reader (Infinite M200; Tecan Group Ltd., M€ annedorf, Switzerland). Melanin content was determined by dissolving melanocytes in 1 N NaOH for 2 h at 80 °C. The optical densities of the supernatants were
ª 2014 British Association of Dermatologists
Cells were lysed, and equal amounts of cellular protein from each treatment were fractionated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were probed with the following primary antibodies: mouse anti-tyrosinase (Zymed Laboratories, San Francisco, CA, USA), mouse anti-MiTF (Santa Cruz Biotechnology, Santa Cruz, CA, USA), mouse anti-GAPDH (MultiSciences Biotech, Hangzhou, China), mouse anti-c-Kit, rabbit anti-phospho-c-Kit (Tyr719), rabbit anti-phospho-c-Kit (Tyr703), mouse anti-p44/42 MAP kinase, rabbit antiphospho-p44/42 MAP kinase, mouse anti-AKT or rabbit anti-phospho-AKT (all Cell Signaling Technology, Danvers, MA, USA). IRDye 680-conjugated goat antimouse secondary antibody and IRDye 800CWconjugated goat anti-rabbit secondary antibody (both LI-COR Biosciences, Lincoln, Nebraska, USA) were used to visualize the targets on the membrane. Quantitative real-time PCR
Total RNA of treated cells was isolated (RNeasy Mini Kit; Qiagen, Valencia, CA, USA), and cDNA was synthesized (Reverse-transcript PCR Kit; TaKaRa Bio. Otsu, Japan). Quantitative real-time PCR reactions were performed on a real-time PCR system (model
Clinical and Experimental Dermatology (2014) 39, pp202–208
203
Imatinib induces skin hypopigmentation Y. Wang et al.
7500; Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR Master Mix (Applied Biosystems). The sequences of the primers are shown in Table 1. Statistical analysis
Results are presented as mean SD. One-way ANOVA was used to compare differences between the groups, and P < 0.05 was considered significant. Each test was performed in triplicate, and confirmed by at least three independent experiments.
Results Imatinib exerts inhibitory effect on melanocytes rather than fibroblasts
At concentrations of ≥ 4 lmol/L, imatinib had no effect on melanocyte proliferation, but significantly reduced the cell number in a dose-dependent manner at concentrations > 4 lmol/L, with the IC50 value estimated to be 6 lmol/L (Fig. 1a). Treatment with 8 lmol/L imatinib showed a time-dependent inhibition in melanocyte proliferation, with a significant reduction in cell number on day 7 (Fig. 1b). High concentrations of imatinib (12 or 16 lmol/L) resulted in poorly developed dendrites and massive apoptosis in melanocytes (supplementary Figs S1–S2). By contrast, imatinib had no effect on the proliferation or morphology of fibroblasts at indicated concentrations (Fig. 1; supplementary Fig. S1), indicating that melanocytes are much more vulnerable than fibroblasts to imatinib treatment. Imatinib reduces total melanin content and melanogenic activity of melanocytes
We next examined whether imatinib affected the total melanin content or melanogenesis of melanocytes. A commercial whitening agent, arbutin, was used as a positive control. Treatment of imatinib at concentrations of 1–4 lmol/L led to similar decreases in total Table 1 Sequences of primers used in real-time PCR. Primer
Direction
Sequence 5′?3′
MiTF
Forward Reverse Forward Reverse Forward Reverse
ATGCTGGAAATGCTAGAATATAAT ATCATCCATCTGCATACAG CATTCTTCTCCTCTTGGCAGA CCGCTATCCCAGTAAGTGGA CTGGGACGACATGGAGAAAA AAGGAAGGCTGGAAGAGTGC
Tyrosinase b-actin
204
Clinical and Experimental Dermatology (2014) 39, pp202–208
melanin content as produced by arbutin treatment, whereas 8–16 lmol/L of imatinib led to a more dramatic drop in total melanin content (Fig. 2a), probably due to reduced melanocyte number. A time-dependent inhibition in total melanin content was seen after treatment with 4 lmol/L imatinib for 1–7 days (Fig. 2b). Low concentrations of imatinib reduced melanin accumulation without affecting melanocyte number, indicating that imatinib might have an inhibitory effect on melanin synthesis, which is usually represented by tyrosinase activity. As expected, we found that imatinib had a dose-dependent and time-dependent inhibitory effect on tyrosinase activity, with the highest inhibition achieved at 8 lmol/L, which was more potent than the whitening agent, arbutin (Fig. 2c,d). Imatinib downregulates the expression of tyrosinase and microphthalmia-associated transcription factor
To further determine the mechanism for the reduction in tyrosinase activity induced by imatinib, the expression of tyrosinase and MiTF in melanocytes was assessed at both the protein and transcriptional level after imatinib treatment. We found that both tyrosinase and MiTF were downregulated by imatinib, whereas only tyrosinase was downregulated by arbutin (Fig. 3). Thus imatinib, but not arbutin, inhibited tyrosinase expression by reducing MiTF expression. Imatinib inactivates the stem cell factor/c-Kit signalling pathway in melanocytes
MiTF can be regulated by SCF/c-Kit signalling, which plays a vital role in melanocyte survival and development.11 Thus, inactivation of SCF/c-Kit signalling may account for the inhibitory effect of imatinib on melanocytes. SCF elicited a significant (1.4-fold) increase in melanocyte proliferation (Fig. 4a), which was abrogated by the presence of imatinib, but not arbutin. The proliferation-stimulating effect of SCF was completely abrogated by 1–4 lmol/L imatinib, whereas a further toxic effect was seen when treated with imatinib at concentrations of > 4 lmol/L (Fig. 4b). As shown in Fig. 4c, pretreatment of melanocytes with imatinib caused a concentration-dependent inhibition of SCF-induced phosphorylation of c-Kit at Try703 and Try709, without modulating the expression of total c-Kit protein. Correspondingly, the phosphorylation of extracellular-regulated kinase (ERK)1/2 and AKT mediated by c-Kit activation was also
ª 2014 British Association of Dermatologists
Imatinib induces skin hypopigmentation Y. Wang et al.
(a)
(b)
Figure 1 Cell proliferation of imatinib-treated melanocytes and fibroblasts. Cells were seeded in 96-well plates (1 9 104/well) and
allowed to adhere overnight before various treatments. The relative cell number was determined by the cholecystokinin octapepeptide (CCK-8) method. Cells were treated (a) with 0–16 lmol/L imatinib for 7 days, or (b) with or without 8 lmol/L imatinib for 1–7 days. **P < 0.01 vs. control group. Ctrl, control.
(a)
(b)
(c)
(d)
Figure 2 Melanin content and tyrosinase
activity of imatinib-treated melanocytes. Melanocytes were seeded in 24-well (5 9 104/well, for melanin content assay) or 6-well (2 9 105/well, for tyrosinase activity assay) plates, and allowed to adhere overnight before various treatments. For assessment of total melanin, melanocytes were treated (a) with 0– 16 lmol/L imatinib or 50 lmol/L arbutin for 7 days, or (b) treated with or without 4 lmol/L imatinib for 1–7 days, then total melanin accumulation was determined by melanin content assay. For assessment of tyrosinase activity, melanocytes were treated (c) with 0– 8 lmol/L imatinib or 50 lmol/L arbutin for 7 days or (d) treated with or without lmol/L imatinib for 1–7 days. *P < 0.05, **P < 0.01, vs. control group. Arb, arbutin; Ctrl, control.
strongly inhibited by imatinib in a concentrationdependent manner. A significant inhibition of c-Kit and mitogen-activated protein kinase (MAPK) signalling was seen when treated with imatinib at concentrations of 2–16 lmol/L, whereas significant inhibition of AKT signalling occurred when treated with imatinib at concentrations of 8–16 lmol/L. By contrast, arbutin did not affect any part of the signal transduction activated by SCF (Fig. 4c).
Discussion Pigmentary abnormalities are seen not only in patients with CML, but also in patients with gastrointestinal stromal tumour and patients with dermatofibrosarcoma protuberans, after treatment with imatinib.12,13 Total
ª 2014 British Association of Dermatologists
or partial body hypopigmentation caused by imatinib has frequently been reported in Asian and black populations3–8,14 whereas it has been reported only occasionally in white patients,15 probably because it is less obvious with a lighter skin colour. In the current study, imatinib showed potent inhibition of total melanin content in cultured normal human melanocytes, which is in line with a previous report showing low melanin content in some of the skin biopsy specimens of these light-skinned patients treated with imatinib.5 In patients with CML who received the standard dose of 400 mg imatinib daily, a mean peak concentration of 4–5 lmol/was easily reached, and the mean plasma trough level ranged from 1.2 to 1.8 lmol/L.1,16,17 In patients treated with 600 mg daily, the mean peak and trough plasma levels of
Clinical and Experimental Dermatology (2014) 39, pp202–208
205
Imatinib induces skin hypopigmentation Y. Wang et al.
(a)
(b)
Figure 3 Expression of tyrosinase and
(c)
(a)
(d)
microphthalmia-associated transcription factor (MiTF) in imatinib-treated melanocytes. Melanocytes were seeded in sixwell plates (2 9 105/well) and allowed to adhere overnight, then treated with 50 lmol/L arbutin or the indicated concentrations of imatinib for 7 days. For (a) tyrosinase and (b) MiTF, the protein and mRNA levels of were determined by western blotting and quantitative real-time PCR, respectively. *P < 0.05, **P < 0.01, vs. control group. Arb, arbutin; Ctrl, control.
(b)
Figure 4 Inactivation of the stem cell
factor (SCF)/c-Kit signalling pathway in imatinib-treated melanocytes. Melanocytes were seeded in 24-well plates (5 9 104/well) and allowed to adhere overnight before various treatments. Melanocytes were treated for 3 days(a) with 50 ng/mL SCF, 50 lmol/L arbutin, 4 lmol/L imatinib or combinations of these, as indicated; or (b) with 50 ng/mL SCF and various concentrations of imatinib. The relative cell number was determined by the cholecystokinin octapepeptide (CCK-8) method. *P < 0.05, **P < 0.01 vs. control group; #P < 0.05, ##P < 0.01 vs. SCF group. (c) Melanocytes were seeded in six-well plates (1 9 106/well), allowed to adhere overnight, and serum-starved for 16 h. Cells were then incubated for 90 min with 50 lmol/L arbutin or indicated concentrations of imatinib before stimulation with SCF (50 ng/mL) for 10 min. Wholecell lysates were analysed by western blotting for the activation of c-Kit and downstream signalling. Arb, arbutin; Ctrl, control; SCF, stem cell factor.
(c)
206
Clinical and Experimental Dermatology (2014) 39, pp202–208
ª 2014 British Association of Dermatologists
Imatinib induces skin hypopigmentation Y. Wang et al.
imatininb were much higher, about 13.3 and 2.4 lmol/L, respectively.16,18 In our study, melanocytes treated with imatinib at concentrations if > 4 lmol/L underwent morphological changes and massive cellular apoptosis and death, whereas low concentrations of imatinib (1–4 lmol/L) did not affect melanocyte proliferation, but showed both time-dependent and dose-dependent inhibition of cellular melanogenic activity. These results indicate that the skin hypopigmentation in these patients resulted mainly from inhibition of melanogenesis in epidermal melanocytes by imatinib without change in melanocyte number, whereas in a small number of patients whose plasma concentration of imatinib was much higher, apoptosis of melanocytes might have occurred. It is known that melanocytes provide protection from damage by ultraviolet (UV) radiation by producing melanin. Skin pigmentation and the capacity to tan are predictors of diminished skin cancer risk.19 Therefore, patients who take imatinib should be warned about this side effect and advised to reduce their exposure to sunlight. It has been shown that c-Kit signalling contributes to melanocyte proliferation after UV exposure in vivo, and the UV-induced tanning process can be blocked with anti-c-Kit antibodies.20 Moreover, certain hypopigmentary disorders such as piebaldism and vitiligo are associated with mutations or insufficient expression of c-Kit.21 A previous study has shown that c-Kit activation can enhance skin pigmentation, and MAPK activated by the c-Kit signalling cascade can subsequently phosphorylate MiTF at Ser 73, upregulating the transactivation activity of MiTF.22 However, In B16 melanoma cells, inhibition of MAPK induces cell differentiation and pigmentation, whereas activation of this pathway impairs the melanogenic effect of cAMP-elevating agents.23 In the present study, we found that imatinib led to complete abrogation of the melanocyte proliferation stimulated by SCF, and inhibiting c-Kit and downstream MAPK signalling by imatinib led to downregulation of MiTF and tyrosinase, which reduced melanogenic activity in melanocytes. In addition, SCFinduced AKT activation was also inhibited by imatinib, which might account for the melanocyte apoptosis we observed. For treatment of hyperpigmentation, the current whitening agents such as arbutin, hydroquinone and kojic acid, which target tyrosinase activity, are not clinically satisfactory, because of their limited therapeutic effect or undesired adverse effects.24 Chemicals targeting c-Kit signalling have been screened recently for the development of new candidates of depigmentation
ª 2014 British Association of Dermatologists
agents, as c-Kit inhibition can diminish the population of melanocytes rather than produce a temporary enzymatic inhibition of melanin synthesis.25 Imatinib has shown potent hypopigmentation both in vitro and in vivo, therefore it may be a promising c-Kit inhibitor for the treatment of hyperpigmentation disorders.
What’s already known about this topic? Generalized
skin hypopigmentation is frequently reported in patients with CML treated with imatinib. The precise effects of imatinib on epidermal melanocytes and the underlying mechanisms involved are not well elucidated. The tyrosine kinase c-Kit may be a target of imatinib, causing skin depigmentation.
What does this study add? In this study, 1–4 lmol/L of imatinib produced
both time-dependent and dose-dependent inhibition of cellular melanogenic activity, whereas higher concentrations of imatinib caused massive apoptosis in melanocytes. Inactivation of c-Kit by imatinib inhibited MAPK and AKT signalling in melanocytes and reduced the expression of MiTF and tyrosinase. Imatinib may be used as a depigmentation agent for hyperpigmentation disorders.
Acknowledgements This work was supported by the National Natural Science Foundation of China (81100387, 81170501, 81070443) and the Key Project of the National Natural Science Foundation of China (81230014). We thank Norvartis for generously providing the imatinib mesylate for laboratory use.
References 1 Druker BJ, Talpaz M, Resta DJ et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 2001; 344: 1031–7. 2 Schiffer CA. BCR-ABL tyrosine kinase inhibitors for chronic myelogenous leukemia. N Engl J Med 2007; 357: 258–65.
Clinical and Experimental Dermatology (2014) 39, pp202–208
207
Imatinib induces skin hypopigmentation Y. Wang et al.
3 Leong KW, Lee TC, Goh AS. Imatinib mesylate causes hypopigmentation in the skin. Cancer 2004; 100: 2486–7; author reply 7–8. 4 Deshmukh C, Saikia T, Bakshi A et al. Imatinib mesylate in chronic myeloid leukemia: a prospective, single arm, non-randomized study. J Assoc Physicians India 2005; 53: 291–5. 5 Sharma A, Vora A, Bhutani M. Generalized hypopigmentation due to imatinib: a fairness boon? Indian J Dermatol Venereol Leprol 2005; 71: 45–6. 6 Aleem T. Hypopigmentation of the skin due to imatinib mesylate in patients with chronic myeloid leukemia. Hematol Oncol Stem Cell Ther 2009; 2: 358–61. 7 Reksodiputro AH, Syafei S, Prayogo N et al. Clinical characteristics and hematologic responses to imatinib in patients with chronic phase myeloid leukemia (CML) at Cipto Mangunkusumo Hospital. Acta Med Indones 2010; 42: 2–5. 8 Zhao Y, Liu L, Wang Y et al. Efficacy and prognosis of chronic myeloid leukemia treated with imatinib mesylate in a Chinese population. Int J Hematol 2009; 89: 445–51. 9 Cario-Andre M, Ardilouze L, Pain C et al. Imatinib mesilate inhibits melanogenesis in vitro. Br J Dermatol 2006; 155: 493–4. 10 Savage DG, Antman KH. Imatinib mesylate–a new oral targeted therapy. N Engl J Med 2002; 346: 683–93. 11 Aoki H, Motohashi T, Yoshimura N et al. Cooperative and indispensable roles of endothelin 3 and KIT signalings in melanocyte development. Dev Dyn 2005; 233: 407–17. 12 Campbell T, Felsten L, Moore J. Disappearance of lentigines in a patient receiving imatinib treatment for familial gastrointestinal stromal tumor syndrome. Arch Dermatol 2009; 145: 1313–16. 13 Balagula Y, Pulitzer MP, Maki RG, Myskowski PL. Pigmentary changes in a patient treated with imatinib. J Drugs Dermatol 2011; 10: 1062–6. 14 Tsao AS, Kantarjian H, Cortes J et al. Imatinib mesylate causes hypopigmentation in the skin. Cancer 2003; 98: 2483–7. 15 McPartlin S, Leach M. Loss of skin pigment caused by imatinib therapy. Br J Haematol 2005; 129: 448. 16 Picard S, Titier K, Etienne G et al. Trough imatinib plasma levels are associated with both cytogenetic and
208
Clinical and Experimental Dermatology (2014) 39, pp202–208
17
18
19 20
21
22
23
24
25
molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood 2007; 109: 3496–9. Larson RA, Druker BJ, Guilhot F et al. Imatinib pharmacokinetics and its correlation with response and safety in chronic-phase chronic myeloid leukemia: a subanalysis of the IRIS study. Blood 2008; 111: 4022–8. Gambacorti-Passerini C, Zucchetti M, Russo D et al. Alpha1 acid glycoprotein binds to imatinib (STI571) and substantially alters its pharmacokinetics in chronic myeloid leukemia patients. Clin Cancer Res 2003; 9: 625–32. Lin JY, Fisher DE. Melanocyte biology and skin pigmentation. Nature 2007; 445: 843–50. Hachiya A, Kobayashi A, Ohuchi A et al. The paracrine role of stem cell factor/c-kit signaling in the activation of human melanocytes in ultraviolet-B-induced pigmentation. J Invest Dermatol 2001; 116: 578–86. Wehrle-Haller B. The role of Kit-ligand in melanocyte development and epidermal homeostasis. Pigment Cell Res 2003; 16: 287–96. Hemesath TJ, Price ER, Takemoto C et al. MAP kinase links the transcription factor Microphthalmia to c-Kit signalling in melanocytes. Nature 1998; 391: 298–301. Englaro W, Bertolotto C, Busca R et al. Inhibition of the mitogen-activated protein kinase pathway triggers B16 melanoma cell differentiation. J Biol Chem 1998; 273: 9966–70. Briganti S, Camera E, Picardo M. Chemical and instrumental approaches to treat hyperpigmentation. Pigment Cell Res 2003; 16: 101–10. Lee SJ, Jeong D, Park WK et al. Screening of Kit inhibitors: suppression of Kit signaling and melanogenesis by emodin. Phytother Res 2010; 24: 308–12.
Supporting Information Additional Supporting Information may be found in the online version of this article: Figure S1 Cell morphology of imatinib-treated melanocytes and fibroblasts. Figure S2 Cellular apoptosis of imatinib-treated melanocytes.
ª 2014 British Association of Dermatologists
Experimental dermatology • Original article
Clinical and Experimental Dermatology
Inhibitory effects of imatinib mesylate on human epidermal melanocytes Y. Wang, Y. Zhao, L. Liu, L. Zhang, H. Xiao, K. Wu, Y. Xu, Y. Hu, H. Fu, W. Cao, Y. Luo and H. Huang Bone Marrow Transplantation Center, The First Affiliated Hospital, Zhejiang University School of Medicine, Zhejiang, China doi:10.1111/ced.12261
Summary
Background. In recent years, increasing attention has been focused on the skin hypopigmentation that develops after the initiation of imatinib mesylate therapy in patients with chronic myeloid leukaemia (CML). Aim. To understand the underlying mechanism of this hypopigmentation effect, and to explore the possibility of using imatinib in the treatment of pigmentation disorders. Methods. We examined the effects of imatinib on the proliferation, apoptosis, melanin content and melanogenic activity of human primary epidermal melanocytes. The responsible molecular events were also investigated in a mechanism study. Results. We found that imatinib led to a dramatic decrease in total melanin content in cultured melanocytes, by affecting melanocyte number and/or melanogenesis in a dose-dependent manner. This inhibition of melanogenesis was due to suppressed expression of tyrosinase and microphthalmia-associated transcription factor (MiTF). Furthermore, stem cell factor (SCF)-stimulated c-Kit activation and melanocyte proliferation were completely abrogated by imatinib. Conclusions. Inactivation of c-Kit signalling by imatinib has inhibitory effects on melanocyte survival, proliferation and melanogenesis, which explains the clinical hypopigmentation seen in patients with CML. These results also support using imatinib as a clinical depigmentation agent when dosage being carefully determined.
Introduction Imatinib mesylate (Gleevec/Glivec, Novartis, Basel, Switzerland)) is a potent tyrosine kinase inhibitor, which targets the BCR-ABL fusion protein in chronic myeloid leukaemia (CML).1 Imatinib has significantly improved the prognosis of CML, albeit with adverse effects such as nausea and diarrhoea, although these are typically mild to moderate.2 Generalized skin hypopigmentation is also a common side effect of imatinib, which occurs in 33–85% of patients, according to a Correspondence: Dr He Huang, Bone Marrow Transplantation Center, The First Affiliated Hospital, Zhejiang University School of Medicine, No. 79 Qing Chun Road, Hangzhou, Zhejiang 310003, China E-mail: [email protected] Conflict of interest: none declared. Accepted for publication 27 September 2013
202
Clinical and Experimental Dermatology (2014) 39, pp202–208
series of clinical studies, mainly from Asia.3–7 We previously reported favourable therapeutic efficacy but a high incidence (77.6%) of generalized skin hypopigmentation during imatinib treatment in 116 Chinese patients with CML.8 The reason for this generalized hypopigmentation associated with imatinib is not well understood. There is only one in vitro study showing that imatinib significantly reduced the number of melanocytes with high tyrosinase activity, but the mechanism was not elucidated further.9 In our experience, imatinib-induced hypopigmentation does not seem to be relevant to disease status, response to imatinib or clinical outcome, indicating a mechanism different from its therapeutic effect. In addition to inhibiting BCR-ABL, imatinib also targets other tyrosine kinases such as c-Kit.10 c-Kit is specifically expressed on melanocytes, and plays a
ª 2014 British Association of Dermatologists
Imatinib induces skin hypopigmentation Y. Wang et al.
crucial role in melanocyte development, differentiation and maintenance by binding to its ligand, stem cell factor (SCF).11 Thus in the present study, we investigated the effects of imatinib on cultured normal human epidermal melanocytes, including cell proliferation, apoptosis, melanin content and melanogenic activity. We also measured SCF/c-Kit signalling and expression of tyrosinase and MiTF to elucidate the underlying mechanism of the skin hypopigmentation caused by imatinib. This study not only provides further insights into the clinical hypopigmentation caused by imatinib, but also sheds new light on the use of imatinib in the treatment of pigmentation disorders.
Methods Ethics approval
The study was approved by the ethics committee of the First Affiliated Hospital, Zhejiang University School of Medicine. Informed consent was obtained from all donors.
then measured at 475 nm with a reference wavelength of 650 nm using the microplate reader. Tyrosinase activity was determined by incubating 100 lL of cell lysate (containing 30 lg of protein) with 100 lL of 10 mmol/L 3,4-dihydroxy-L-phenylalanine (L-Dopa) at 37 °C for 1 h. The optical densities of the supernatants were measured as described above for the melanin content assay. The cell number, melanin content and tyrosinase activity of the treated cells were all calculated relative to the control. Cell apoptosis assay
Cell apoptosis was detected using a commercial assay (Vybrant Apoptosis Assay Kit; Invitrogen Corp). Treated cells were harvested and resuspended in 100 lL of 1 9 annexin-binding buffer at a density of 1 9 106 cells/ml. Following this, 5 lL Alexa Fluor 488, annexin V and 1 lL 100 lg/ml propidium iodide (PI) working solution were added to the cell suspension, and samples were incubated for 15 min before being analysed by flow cytometry, Western blot analysis
Primary melanocyte and fibroblast cultures
Normal human epidermal melanocytes and fibroblasts were isolated from foreskins of Chinese adults obtained from circumcisions. Melanocytes were maintained in Medium 254 supplemented with Human Melanocyte Growth Supplement (Invitrogen Corp., Carlsbad, CA, USA). Fibroblasts were maintained in DMEM supplemented with 10% FBS, and routinely passaged. Cells from passage numbers between 7 and 13 were used in the experiments. Treatments
Human melanocytes and/or fibroblasts were treated with different concentrations of imatinib (Norvartis, Basel, Switzerland) or arbutin (Sigma-Aldrich, St. Louis, MO, USA), with or without SCF (PrimeGene, Shanghai, China), and maintained for 0–7 days. Untreated cells were used as control. Cell proliferation was determined by the cholecystokinin octapepeptide (CCK-8) method (Dojindo Laboratories, Kumamoto, Japan). The absorbance was measured at a wavelength of 450 nm with a reference wavelength of 650 nm, using a multimode microplate reader (Infinite M200; Tecan Group Ltd., M€ annedorf, Switzerland). Melanin content was determined by dissolving melanocytes in 1 N NaOH for 2 h at 80 °C. The optical densities of the supernatants were
ª 2014 British Association of Dermatologists
Cells were lysed, and equal amounts of cellular protein from each treatment were fractionated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were probed with the following primary antibodies: mouse anti-tyrosinase (Zymed Laboratories, San Francisco, CA, USA), mouse anti-MiTF (Santa Cruz Biotechnology, Santa Cruz, CA, USA), mouse anti-GAPDH (MultiSciences Biotech, Hangzhou, China), mouse anti-c-Kit, rabbit anti-phospho-c-Kit (Tyr719), rabbit anti-phospho-c-Kit (Tyr703), mouse anti-p44/42 MAP kinase, rabbit antiphospho-p44/42 MAP kinase, mouse anti-AKT or rabbit anti-phospho-AKT (all Cell Signaling Technology, Danvers, MA, USA). IRDye 680-conjugated goat antimouse secondary antibody and IRDye 800CWconjugated goat anti-rabbit secondary antibody (both LI-COR Biosciences, Lincoln, Nebraska, USA) were used to visualize the targets on the membrane. Quantitative real-time PCR
Total RNA of treated cells was isolated (RNeasy Mini Kit; Qiagen, Valencia, CA, USA), and cDNA was synthesized (Reverse-transcript PCR Kit; TaKaRa Bio. Otsu, Japan). Quantitative real-time PCR reactions were performed on a real-time PCR system (model
Clinical and Experimental Dermatology (2014) 39, pp202–208
203
Imatinib induces skin hypopigmentation Y. Wang et al.
7500; Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR Master Mix (Applied Biosystems). The sequences of the primers are shown in Table 1. Statistical analysis
Results are presented as mean SD. One-way ANOVA was used to compare differences between the groups, and P < 0.05 was considered significant. Each test was performed in triplicate, and confirmed by at least three independent experiments.
Results Imatinib exerts inhibitory effect on melanocytes rather than fibroblasts
At concentrations of ≥ 4 lmol/L, imatinib had no effect on melanocyte proliferation, but significantly reduced the cell number in a dose-dependent manner at concentrations > 4 lmol/L, with the IC50 value estimated to be 6 lmol/L (Fig. 1a). Treatment with 8 lmol/L imatinib showed a time-dependent inhibition in melanocyte proliferation, with a significant reduction in cell number on day 7 (Fig. 1b). High concentrations of imatinib (12 or 16 lmol/L) resulted in poorly developed dendrites and massive apoptosis in melanocytes (supplementary Figs S1–S2). By contrast, imatinib had no effect on the proliferation or morphology of fibroblasts at indicated concentrations (Fig. 1; supplementary Fig. S1), indicating that melanocytes are much more vulnerable than fibroblasts to imatinib treatment. Imatinib reduces total melanin content and melanogenic activity of melanocytes
We next examined whether imatinib affected the total melanin content or melanogenesis of melanocytes. A commercial whitening agent, arbutin, was used as a positive control. Treatment of imatinib at concentrations of 1–4 lmol/L led to similar decreases in total Table 1 Sequences of primers used in real-time PCR. Primer
Direction
Sequence 5′?3′
MiTF
Forward Reverse Forward Reverse Forward Reverse
ATGCTGGAAATGCTAGAATATAAT ATCATCCATCTGCATACAG CATTCTTCTCCTCTTGGCAGA CCGCTATCCCAGTAAGTGGA CTGGGACGACATGGAGAAAA AAGGAAGGCTGGAAGAGTGC
Tyrosinase b-actin
204
Clinical and Experimental Dermatology (2014) 39, pp202–208
melanin content as produced by arbutin treatment, whereas 8–16 lmol/L of imatinib led to a more dramatic drop in total melanin content (Fig. 2a), probably due to reduced melanocyte number. A time-dependent inhibition in total melanin content was seen after treatment with 4 lmol/L imatinib for 1–7 days (Fig. 2b). Low concentrations of imatinib reduced melanin accumulation without affecting melanocyte number, indicating that imatinib might have an inhibitory effect on melanin synthesis, which is usually represented by tyrosinase activity. As expected, we found that imatinib had a dose-dependent and time-dependent inhibitory effect on tyrosinase activity, with the highest inhibition achieved at 8 lmol/L, which was more potent than the whitening agent, arbutin (Fig. 2c,d). Imatinib downregulates the expression of tyrosinase and microphthalmia-associated transcription factor
To further determine the mechanism for the reduction in tyrosinase activity induced by imatinib, the expression of tyrosinase and MiTF in melanocytes was assessed at both the protein and transcriptional level after imatinib treatment. We found that both tyrosinase and MiTF were downregulated by imatinib, whereas only tyrosinase was downregulated by arbutin (Fig. 3). Thus imatinib, but not arbutin, inhibited tyrosinase expression by reducing MiTF expression. Imatinib inactivates the stem cell factor/c-Kit signalling pathway in melanocytes
MiTF can be regulated by SCF/c-Kit signalling, which plays a vital role in melanocyte survival and development.11 Thus, inactivation of SCF/c-Kit signalling may account for the inhibitory effect of imatinib on melanocytes. SCF elicited a significant (1.4-fold) increase in melanocyte proliferation (Fig. 4a), which was abrogated by the presence of imatinib, but not arbutin. The proliferation-stimulating effect of SCF was completely abrogated by 1–4 lmol/L imatinib, whereas a further toxic effect was seen when treated with imatinib at concentrations of > 4 lmol/L (Fig. 4b). As shown in Fig. 4c, pretreatment of melanocytes with imatinib caused a concentration-dependent inhibition of SCF-induced phosphorylation of c-Kit at Try703 and Try709, without modulating the expression of total c-Kit protein. Correspondingly, the phosphorylation of extracellular-regulated kinase (ERK)1/2 and AKT mediated by c-Kit activation was also
ª 2014 British Association of Dermatologists
Imatinib induces skin hypopigmentation Y. Wang et al.
(a)
(b)
Figure 1 Cell proliferation of imatinib-treated melanocytes and fibroblasts. Cells were seeded in 96-well plates (1 9 104/well) and
allowed to adhere overnight before various treatments. The relative cell number was determined by the cholecystokinin octapepeptide (CCK-8) method. Cells were treated (a) with 0–16 lmol/L imatinib for 7 days, or (b) with or without 8 lmol/L imatinib for 1–7 days. **P < 0.01 vs. control group. Ctrl, control.
(a)
(b)
(c)
(d)
Figure 2 Melanin content and tyrosinase
activity of imatinib-treated melanocytes. Melanocytes were seeded in 24-well (5 9 104/well, for melanin content assay) or 6-well (2 9 105/well, for tyrosinase activity assay) plates, and allowed to adhere overnight before various treatments. For assessment of total melanin, melanocytes were treated (a) with 0– 16 lmol/L imatinib or 50 lmol/L arbutin for 7 days, or (b) treated with or without 4 lmol/L imatinib for 1–7 days, then total melanin accumulation was determined by melanin content assay. For assessment of tyrosinase activity, melanocytes were treated (c) with 0– 8 lmol/L imatinib or 50 lmol/L arbutin for 7 days or (d) treated with or without lmol/L imatinib for 1–7 days. *P < 0.05, **P < 0.01, vs. control group. Arb, arbutin; Ctrl, control.
strongly inhibited by imatinib in a concentrationdependent manner. A significant inhibition of c-Kit and mitogen-activated protein kinase (MAPK) signalling was seen when treated with imatinib at concentrations of 2–16 lmol/L, whereas significant inhibition of AKT signalling occurred when treated with imatinib at concentrations of 8–16 lmol/L. By contrast, arbutin did not affect any part of the signal transduction activated by SCF (Fig. 4c).
Discussion Pigmentary abnormalities are seen not only in patients with CML, but also in patients with gastrointestinal stromal tumour and patients with dermatofibrosarcoma protuberans, after treatment with imatinib.12,13 Total
ª 2014 British Association of Dermatologists
or partial body hypopigmentation caused by imatinib has frequently been reported in Asian and black populations3–8,14 whereas it has been reported only occasionally in white patients,15 probably because it is less obvious with a lighter skin colour. In the current study, imatinib showed potent inhibition of total melanin content in cultured normal human melanocytes, which is in line with a previous report showing low melanin content in some of the skin biopsy specimens of these light-skinned patients treated with imatinib.5 In patients with CML who received the standard dose of 400 mg imatinib daily, a mean peak concentration of 4–5 lmol/was easily reached, and the mean plasma trough level ranged from 1.2 to 1.8 lmol/L.1,16,17 In patients treated with 600 mg daily, the mean peak and trough plasma levels of
Clinical and Experimental Dermatology (2014) 39, pp202–208
205
Imatinib induces skin hypopigmentation Y. Wang et al.
(a)
(b)
Figure 3 Expression of tyrosinase and
(c)
(a)
(d)
microphthalmia-associated transcription factor (MiTF) in imatinib-treated melanocytes. Melanocytes were seeded in sixwell plates (2 9 105/well) and allowed to adhere overnight, then treated with 50 lmol/L arbutin or the indicated concentrations of imatinib for 7 days. For (a) tyrosinase and (b) MiTF, the protein and mRNA levels of were determined by western blotting and quantitative real-time PCR, respectively. *P < 0.05, **P < 0.01, vs. control group. Arb, arbutin; Ctrl, control.
(b)
Figure 4 Inactivation of the stem cell
factor (SCF)/c-Kit signalling pathway in imatinib-treated melanocytes. Melanocytes were seeded in 24-well plates (5 9 104/well) and allowed to adhere overnight before various treatments. Melanocytes were treated for 3 days(a) with 50 ng/mL SCF, 50 lmol/L arbutin, 4 lmol/L imatinib or combinations of these, as indicated; or (b) with 50 ng/mL SCF and various concentrations of imatinib. The relative cell number was determined by the cholecystokinin octapepeptide (CCK-8) method. *P < 0.05, **P < 0.01 vs. control group; #P < 0.05, ##P < 0.01 vs. SCF group. (c) Melanocytes were seeded in six-well plates (1 9 106/well), allowed to adhere overnight, and serum-starved for 16 h. Cells were then incubated for 90 min with 50 lmol/L arbutin or indicated concentrations of imatinib before stimulation with SCF (50 ng/mL) for 10 min. Wholecell lysates were analysed by western blotting for the activation of c-Kit and downstream signalling. Arb, arbutin; Ctrl, control; SCF, stem cell factor.
(c)
206
Clinical and Experimental Dermatology (2014) 39, pp202–208
ª 2014 British Association of Dermatologists
Imatinib induces skin hypopigmentation Y. Wang et al.
imatininb were much higher, about 13.3 and 2.4 lmol/L, respectively.16,18 In our study, melanocytes treated with imatinib at concentrations if > 4 lmol/L underwent morphological changes and massive cellular apoptosis and death, whereas low concentrations of imatinib (1–4 lmol/L) did not affect melanocyte proliferation, but showed both time-dependent and dose-dependent inhibition of cellular melanogenic activity. These results indicate that the skin hypopigmentation in these patients resulted mainly from inhibition of melanogenesis in epidermal melanocytes by imatinib without change in melanocyte number, whereas in a small number of patients whose plasma concentration of imatinib was much higher, apoptosis of melanocytes might have occurred. It is known that melanocytes provide protection from damage by ultraviolet (UV) radiation by producing melanin. Skin pigmentation and the capacity to tan are predictors of diminished skin cancer risk.19 Therefore, patients who take imatinib should be warned about this side effect and advised to reduce their exposure to sunlight. It has been shown that c-Kit signalling contributes to melanocyte proliferation after UV exposure in vivo, and the UV-induced tanning process can be blocked with anti-c-Kit antibodies.20 Moreover, certain hypopigmentary disorders such as piebaldism and vitiligo are associated with mutations or insufficient expression of c-Kit.21 A previous study has shown that c-Kit activation can enhance skin pigmentation, and MAPK activated by the c-Kit signalling cascade can subsequently phosphorylate MiTF at Ser 73, upregulating the transactivation activity of MiTF.22 However, In B16 melanoma cells, inhibition of MAPK induces cell differentiation and pigmentation, whereas activation of this pathway impairs the melanogenic effect of cAMP-elevating agents.23 In the present study, we found that imatinib led to complete abrogation of the melanocyte proliferation stimulated by SCF, and inhibiting c-Kit and downstream MAPK signalling by imatinib led to downregulation of MiTF and tyrosinase, which reduced melanogenic activity in melanocytes. In addition, SCFinduced AKT activation was also inhibited by imatinib, which might account for the melanocyte apoptosis we observed. For treatment of hyperpigmentation, the current whitening agents such as arbutin, hydroquinone and kojic acid, which target tyrosinase activity, are not clinically satisfactory, because of their limited therapeutic effect or undesired adverse effects.24 Chemicals targeting c-Kit signalling have been screened recently for the development of new candidates of depigmentation
ª 2014 British Association of Dermatologists
agents, as c-Kit inhibition can diminish the population of melanocytes rather than produce a temporary enzymatic inhibition of melanin synthesis.25 Imatinib has shown potent hypopigmentation both in vitro and in vivo, therefore it may be a promising c-Kit inhibitor for the treatment of hyperpigmentation disorders.
What’s already known about this topic? Generalized
skin hypopigmentation is frequently reported in patients with CML treated with imatinib. The precise effects of imatinib on epidermal melanocytes and the underlying mechanisms involved are not well elucidated. The tyrosine kinase c-Kit may be a target of imatinib, causing skin depigmentation.
What does this study add? In this study, 1–4 lmol/L of imatinib produced
both time-dependent and dose-dependent inhibition of cellular melanogenic activity, whereas higher concentrations of imatinib caused massive apoptosis in melanocytes. Inactivation of c-Kit by imatinib inhibited MAPK and AKT signalling in melanocytes and reduced the expression of MiTF and tyrosinase. Imatinib may be used as a depigmentation agent for hyperpigmentation disorders.
Acknowledgements This work was supported by the National Natural Science Foundation of China (81100387, 81170501, 81070443) and the Key Project of the National Natural Science Foundation of China (81230014). We thank Norvartis for generously providing the imatinib mesylate for laboratory use.
References 1 Druker BJ, Talpaz M, Resta DJ et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 2001; 344: 1031–7. 2 Schiffer CA. BCR-ABL tyrosine kinase inhibitors for chronic myelogenous leukemia. N Engl J Med 2007; 357: 258–65.
Clinical and Experimental Dermatology (2014) 39, pp202–208
207
Imatinib induces skin hypopigmentation Y. Wang et al.
3 Leong KW, Lee TC, Goh AS. Imatinib mesylate causes hypopigmentation in the skin. Cancer 2004; 100: 2486–7; author reply 7–8. 4 Deshmukh C, Saikia T, Bakshi A et al. Imatinib mesylate in chronic myeloid leukemia: a prospective, single arm, non-randomized study. J Assoc Physicians India 2005; 53: 291–5. 5 Sharma A, Vora A, Bhutani M. Generalized hypopigmentation due to imatinib: a fairness boon? Indian J Dermatol Venereol Leprol 2005; 71: 45–6. 6 Aleem T. Hypopigmentation of the skin due to imatinib mesylate in patients with chronic myeloid leukemia. Hematol Oncol Stem Cell Ther 2009; 2: 358–61. 7 Reksodiputro AH, Syafei S, Prayogo N et al. Clinical characteristics and hematologic responses to imatinib in patients with chronic phase myeloid leukemia (CML) at Cipto Mangunkusumo Hospital. Acta Med Indones 2010; 42: 2–5. 8 Zhao Y, Liu L, Wang Y et al. Efficacy and prognosis of chronic myeloid leukemia treated with imatinib mesylate in a Chinese population. Int J Hematol 2009; 89: 445–51. 9 Cario-Andre M, Ardilouze L, Pain C et al. Imatinib mesilate inhibits melanogenesis in vitro. Br J Dermatol 2006; 155: 493–4. 10 Savage DG, Antman KH. Imatinib mesylate–a new oral targeted therapy. N Engl J Med 2002; 346: 683–93. 11 Aoki H, Motohashi T, Yoshimura N et al. Cooperative and indispensable roles of endothelin 3 and KIT signalings in melanocyte development. Dev Dyn 2005; 233: 407–17. 12 Campbell T, Felsten L, Moore J. Disappearance of lentigines in a patient receiving imatinib treatment for familial gastrointestinal stromal tumor syndrome. Arch Dermatol 2009; 145: 1313–16. 13 Balagula Y, Pulitzer MP, Maki RG, Myskowski PL. Pigmentary changes in a patient treated with imatinib. J Drugs Dermatol 2011; 10: 1062–6. 14 Tsao AS, Kantarjian H, Cortes J et al. Imatinib mesylate causes hypopigmentation in the skin. Cancer 2003; 98: 2483–7. 15 McPartlin S, Leach M. Loss of skin pigment caused by imatinib therapy. Br J Haematol 2005; 129: 448. 16 Picard S, Titier K, Etienne G et al. Trough imatinib plasma levels are associated with both cytogenetic and
208
Clinical and Experimental Dermatology (2014) 39, pp202–208
17
18
19 20
21
22
23
24
25
molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood 2007; 109: 3496–9. Larson RA, Druker BJ, Guilhot F et al. Imatinib pharmacokinetics and its correlation with response and safety in chronic-phase chronic myeloid leukemia: a subanalysis of the IRIS study. Blood 2008; 111: 4022–8. Gambacorti-Passerini C, Zucchetti M, Russo D et al. Alpha1 acid glycoprotein binds to imatinib (STI571) and substantially alters its pharmacokinetics in chronic myeloid leukemia patients. Clin Cancer Res 2003; 9: 625–32. Lin JY, Fisher DE. Melanocyte biology and skin pigmentation. Nature 2007; 445: 843–50. Hachiya A, Kobayashi A, Ohuchi A et al. The paracrine role of stem cell factor/c-kit signaling in the activation of human melanocytes in ultraviolet-B-induced pigmentation. J Invest Dermatol 2001; 116: 578–86. Wehrle-Haller B. The role of Kit-ligand in melanocyte development and epidermal homeostasis. Pigment Cell Res 2003; 16: 287–96. Hemesath TJ, Price ER, Takemoto C et al. MAP kinase links the transcription factor Microphthalmia to c-Kit signalling in melanocytes. Nature 1998; 391: 298–301. Englaro W, Bertolotto C, Busca R et al. Inhibition of the mitogen-activated protein kinase pathway triggers B16 melanoma cell differentiation. J Biol Chem 1998; 273: 9966–70. Briganti S, Camera E, Picardo M. Chemical and instrumental approaches to treat hyperpigmentation. Pigment Cell Res 2003; 16: 101–10. Lee SJ, Jeong D, Park WK et al. Screening of Kit inhibitors: suppression of Kit signaling and melanogenesis by emodin. Phytother Res 2010; 24: 308–12.
Supporting Information Additional Supporting Information may be found in the online version of this article: Figure S1 Cell morphology of imatinib-treated melanocytes and fibroblasts. Figure S2 Cellular apoptosis of imatinib-treated melanocytes.
ª 2014 British Association of Dermatologists
