Accepted Manuscript Title: Insecticides resistance in the Culex quinquefasciatus populations from northern Thailand and possible resistance mechanisms Author: Jintana Yanola Saowanee Chamnanya Nongkran Lumjuan Pradya Somboon PII: DOI: Reference:

S0001-706X(15)30033-4 http://dx.doi.org/doi:10.1016/j.actatropica.2015.06.011 ACTROP 3653

To appear in:

Acta Tropica

Received date: Revised date: Accepted date:

19-3-2015 6-6-2015 12-6-2015

Please cite this article as: Yanola, Jintana, Chamnanya, Saowanee, Lumjuan, Nongkran, Somboon, Pradya, Insecticides resistance in the Culex quinquefasciatus populations from northern Thailand and possible resistance mechanisms.Acta Tropica http://dx.doi.org/10.1016/j.actatropica.2015.06.011 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Insecticides resistance in the Culex quinquefasciatus populations from northern Thailand and possible resistance mechanisms Jintana Yanolaa, Saowanee Chamnanyab, Nongkran Lumjuanc, Pradya Somboonb*

a

Division of Clinical Microscopy, Department of Medical Technology, Faculty of Associated Medical Sciences, Chiang Mai University 50200, Thailand b

Department of Parasitology, Faculty of Medicine, Chiang Mai University 50200, Thailand c

*

Research Institute for Health Sciences, Chiang Mai University 50200, Thailand

Corresponding author

Email addresses: JY: [email protected], [email protected] SC: [email protected] NL: [email protected]

PS: [email protected]

Highlights

• First time for detection of the L1014F mutation in Thai Culex quinquefasciatus populations • Resistance to pyrethroids in Cx. quinquefasciatus is widely distributed in northern Thailand. • A strong positive correlation between the L1014F mutation and deltamethrin resistance • Kdr mutation and cytochrome P450 monoxygenases may confer resistance to deltamethrin.

Abstract

The mosquito vector Culex quinquefasciatus is known to be resistant to insecticides worldwide, including Thailand. This study was the first investigation of the insecticide resistance mechanisms, involving metabolic detoxification and target site insensitivity in Cx. quinquefasciatus from Thailand. Adult females reared from field-caught larvae from six provinces of northern Thailand were

determined for resistant status by exposing to 0.05% deltamethrin, 0.75% permethrin and 5% malathion papers using the standard WHO susceptibility test. The overall mortality rates were 45.8%, 11.4% and 80.2%, respectively. A fragment of voltage-gated sodium channel gene was amplified and sequenced to identify the knock down resistance (kdr) mutation. The ace-1 gene mutation was determined by using PCR-RFLP. The L1014F kdr mutation was observed in all populations, but the homozygous mutant F/F1014 genotype was found only in two of the six provinces where the kdr mutation was significantly correlated with deltamethrin resistance. However, none of mosquitoes had the G119S mutation in the ace-1 gene. A laboratory deltamethrin resistant strain, Cq_CM_R, has been established showing a highly resistant level after selection for a few generations. The mutant F1014 allele frequency was significantly increased after one generation of selection. A synergist assay was performed to assess the metabolic detoxifying enzymes. Addition of Bis (4-nitrophenyl)-phosphate (BNPP) and diethyl maleate (DEM), inhibitors of esterases and glutathione S transferases (GST), respecitively, into the larval bioassay of the Cq_CM strain with deltamethrin showed no significant reduction. By contrast, addition of piperonyl butoxide (PBO), an inhibitor of cytochrome P450 monooxygenases, showed a 9-fold reduction of resistance. Resistance to pyrethroids in Cx. quinquefasciatus is widely distributed in northern Thailand. This study reports for the first time for the detection of the L1014F kdr mutation in wild populations of Cx. quinquefasciatus in Thailand. At least two major mechanisms, kdr and cytochrome P450 monoxygenases, confer resistance to deltamethrin in Thai Cx. quinquefasciatus populations.

Keywords

Culex quinquefasciatus, Insecticide, Resistance, Knockdown resistance, Cytochrome P450 monooxygenases, Thailand

1. Introduction The mosquito Culex quinquefasciatus Say is an important vector of a wide variety of pathogens and parasites of medical and veterinary diseases worldwide. In the Association of Southeast Asian Nations (ASEAN) community, Cx. quinquefasciatus is a potential vector of the filarial worm Wuchereria bancrofti, the agent of bancroftian filariasis, in urban areas [1-3]. In Thailand, the number of migrant workers from endemic countries, as well as from hill tribes along the Thai-Myanmar border has been increasing in recent years [4]. Some of them carry W. bancrofti microfilariae without noticeable symptoms [5,6]. This has prompted public health concerns about the possibility of increased transmission of bancroftian filariasis in Thailand. Disease control and prevention efforts involve vector control by insecticide application, space spraying with deltamethrin, is the most common method for controlling outbreaks of mosquito borne diseases in Thailand [4]. However, the heavy and long-term use of insecticides in public health and agriculture has led to the development of insecticide resistance [7,8]. Resistance to DDT and

pyrethroids has been documented in populations of Cx. quinquefasciatus in Thailand and many other countries [4,9-13], but little is known about the resistance mechanism of this vector in Thailand. Understanding insecticide resistance mechanisms is essential for vector control strategies. Resistance mechanisms can be divided into two major groups, decreased sensitivity of the target proteins known as target site insensitivity and increased metabolic detoxification of insecticides

[14]. The axonic voltage-gated sodium channel (VGSC) and the synaptic acetylcholinesterases

(AChE1), encoded by the ace-1 gene, are the primary target sites of insecticides [15-19] . In Cx. quinquefasciatus, the most common target site insensitivity is the L1014F kdr mutation in the voltage-gated sodium channel (VGSC) gene, conferring resistance to DDT and pyrethroids, followed by the G119S ace-1mutation, conferring resistance to organophosphate and carbamate [10,13,19-22]. Three major classes of enzymes, cytochrome P450 oxidases, esterases and glutathione-S-transferases (GST) have been reported to be involved in metabolic resistance to pyrethroids, organophosphate and organocholine, respectively, in Cx. quinquefasciatus [12,21,23,24]. In Thailand, a study of metabolic resistance in populations of Cx. quinquefasciatus revealed a positive correlation involving increased GST and DDT dehydrogenase activities with DDT resistance [25]. However, target site insensitivity, kdr and ace-1 mutations, conferring resistance to pyrethroids and organophosphate in Cx. quinquefasciatus have not been documented. In the dengue virus vector Aedes aegypti, we have recently reported that the F1534C and V1016G mutations in the VGSC gene are the major mechanism of pyrethroids resistance in Thailand and neighboring countries [26-29]. The purpose of this study was to investigate the

resistance mechanisms responsible for pyrethroids and organophosphate resistance in Cx. quinquefasciatus from northern Thailand. The correlations between the L1014F kdr mutation and the deltamethrin resistant phenotype, as well as the increased kdr allele frequency following deltamethrin selection pressure in the laboratory were investigated.

2. Materials and Methods 2.1 Mosquito collection Larvae and pupae of Cx. quinquefasciatus were collected from polluted drains or waste water containers in urban areas from six provinces in northern Thailand, i.e. Chiang Mai, Chiang Rai, Phayao, Phrae, Lamphun and Lampang, in 2013 (Figure 1). They were reared to adulthood in the insectary at the Department of Parasitology, Faculty of Medicine, Chiang Mai University. The mosquitoes from Chiang Mai Province have been maintained as a colony, named Cq_CM strain.

2.2 Insecticide susceptibility test Adult and larvalsusceptibility tests were conducted according to WHO standard methods [30,31]. In the adult bioassay test, batches of 25 non-blood fed, 1-day-old, adult females were exposed to 0.05% deltamethrin, 0.75% permethrin and 5% malathion

impregnated papers for 60 min in standard WHO test tubes, with minor modifications. Control mosquitoes were exposed to paper without insecticide. The test mosquitoes and the controls were held for a 24-h recovery period and the mortality recorded. For larval bioassays, stock and serial dilutions of deltamethrin (Supelco, Belefonte, PA, USA) were prepared in ethanol. The bioassays were conducted in 400 ml beakers containing 250 ml of distilled water and one of 7-8 different insecticide concentrations (0.05 – 5 µg/L) giving 0 – 100% mortality. There were 4 replicates per concentration. The ethanol content in each assay solution was limited to 0.4%. Batches of 25 early 4th instar larvae were tested per beaker. In the control experiments, 0.4% ethanol was included in 250 ml of water. Larval mortality was recorded after 24 hours exposure. Mortality data was corrected by natural control mortality using Abbott’s formula [32]. The concentration-mortality responses were determined by probit analysis [33] using the software LdP Line (LdP Line, copyright 2000 by Ehab Mostofa Bakr, Cairo, Egypt).

2.3 Deltamethrin selection The Cq_CM strain was selected with deltamethrin for three generations in the laboratory. The larvae were treated with concentrations of deltamethrin sufficient to kill 50% of treated individuals after 24 hours. Survivors were kept and reared for the next generation. The larval LC50, adult mortality and the mutant allele frequency in each generation were determined by the larval bioassay, the adult bioassay and DNA sequencing, respectively.

2.4 Metabolic resistance studies based on larval bioassay and inhibitor effect The Cq_CM larvae were tested with deltamethrin in combination with detoxification enzyme inhibitors to determine the biochemical mechanisms involved in deltamethrin resistance. Three inhibitors, piperonyl butoxide (PBO), Bis (4-nitrophenyl)phosphate (BNPP) and diethyl maleate (DEM), which are inhibitors of cytochrome P450 monooxygenases, esterases and glutathione S transferases (GST), respectively, were used in this study. The larval susceptibility test of deltamethrin with the inhibitors was conducted.

The inhibitors, PBO, BNPP and DEM, were applied simultaneously with deltamethrin at the maximal sublethal

concentrations of 0.3, 25 and 25 mg/L, respectively. The concentration-mortality responses were analyzed. A significant increase in deltamethrin toxicity in the presence of an inhibitor indicates the role of the associated detoxification enzyme conferring resistance.

2.5 Genomic DNA extraction Genomic DNA was extracted using the method as described previously (Yanola et al., 2011). Briefly, a mosquito was homogenized in 100 µl of DNAzol Reagent (Invitrogen, Carlsbad, CA, USA). The supernatant was precipitated DNA by addition of a half volume of 100% ethanol and centrifuged for 5 min at 8,000 g. The DNA pellet was washed twice with 70% ethanol, air dried and resuspended in 20 µl of sterile distilled water. DNA concentration was determined by absorption at 260 nm using a NanoDrop 2000 spectrophotometer (Thermo Scientific, DE, USA).

2.6 Amplification and DNA sequencing of a fragment of the Cx. quinquefasciatus voltage-gated sodium channel gene

A fragment of VGSC gene, the IIP-IIS6 region, was amplified by PCR using two primers according to Yanola et al. (2011) (IIP_F primer: 5’ GGTGGAACTTCACCGACTTC3’ and IIS6_R primer: 5’GGACGCAATCTGGCTTGTTA3’). The PCR was carried out in a 50 µl reaction volume containing 1.0 unit of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 0.1 mM dNTPs, 1.5 mM MgCl2 and 0.5 µM each of the forward and reverse primers. The amplification consists of an initial heat activation step at 95 oC for 2 min, followed by 35 cycles of 95 oC for 30 s, 60 oC for 30 s and 72 oC for 30 s with a final extension step at 72 oC for 2 min. The amplified fragments were analyzed by electrophoresis on a 1.5% agarose gel (Invitrogen, Carlsbad, CA, USA) and visualized under UV light by ethidium bromide staining. PCR fragments were purified using illustra™ ExoStar™ 1-Step kit (GE Healthcare, Buckinghamshire, UK). Nucleotide sequences were determined on both strands of purified PCR products at the Macrogen sequencing facility (Macrogen Inc., Seoul, Korea). Sequences were aligned using Geneious Pro software version 5.04 [34]. Nucleotide sequences of the voltage-gated sodium channel gene of Cx. quinquefasciatus have been deposited in the database [GenBank: KM377241 and KM377242].

2.7 Determination of Ace-1 gene mutation Determination for the presence of the G119S mutation in the ace-1 gene was carried out in surviving and dead mosquitoes of Cx. quinquefasciatus after one hour exposure to WHO 5% malathion paper using PCR-RFLP method as described previously [19] with

some

modifications.

A

fragment

of

the

ace-1

gene

was

amplified

with

the

primer

CqAce1-sh-F

(5’-

ATCGTGGACACGTGTTCGGTG-3’) and CqAce1-sh-R (5’-ACGATCACGTTCTCCTCCGA-3’). PCR products were digested with the AluI restriction enzyme (New England BioLabs, Beverly, MA) according to the manufacturer’s instructions and run on a 2% agarose gel. In order to confirm the G119S genotyping results, a fragment of the ace-1 gene was amplified with the primer CqAce1lg-F (5’- GCGCGAGCATATCCATAGCACT -3’) and CqAce1-lg-R (5’- TCTGATCAAACAGCCCCG CGT -3’) and directly sequenced at the Macrogen sequencing facility (Macrogen Inc., Seoul, Korea).

2.8 Statistical analysis Kdr genotype and allele frequencies in mosquito from six populations were calculated and statistical differences among populations were examined by Fisher’s exaction test using Genepop version 4.2 [35]. To test the association of the kdr genotype and resistance phenotype, a Pearson Chi-square test was used to compare the allele frequency between the dead and survivor mosquito groups.

3. Results 3.1 Insecticide susceptibility bioassay The overall mortality rate of six populations of Cx. quinquefasciatus from northern Thailand tested with 0.05% deltamethrin paper was 45.8%, ranging from 12.9% to 93.4%, (Table 1). The mortality rate for those tested with 5% malathion paper was 80.2%, with a range of 69.9% to 100%.

Moreover, a total of 272 female mosquitoes from Chiang Mai Province showed 11.4% mortality

after exposure to 0.75% permethrin paper for one hour.

3.2 Kdr allele frequencies in wild populations from northern Thailand One hundred deltamethrin-exposed females, consisting of 52 resistant and 48 susceptible individuals pooled from each location, were randomly selected and genotyped for the L1014F mutation (Table 2). A 668-bp fragment of IIP-IIS6 region of the VGSC gene was amplified and sequenced. Analysis of the VGSC sequences showed a substitution of A to T at the third position of codon 1014, which results in the substitution of leucine (L) with phenylalanine (F), known as the L1014F mutation [10]. No other non-synonymous mutations were observed. Of the six populations, only two (Chiang Mai and Phrae Provinces) contained individuals with the homozygous mutation F/F1014 genotype. The homozygous wild type L/L1014 genotype was observed across all study sites, while heterozygous genotype was seen to a lesser extent. Significant differences between mutant allele frequencies of survivor and dead groups were observed in Chiang Mai and Phrae populations (p < 0.01) but not in the others. This suggests the role of the L1014F

kdr mutation in resistance in these areas. However, genotyping revealed that 33 of 52 resistant individuals did not have the mutation suggesting that other resistance mechanisms were involved in all populations.

3.3 Ace-1 gene mutation in malathion resistance mosquitoes A total of 36 survivor and 3 dead Cx. quinquefasciatus mosquitoes exposed to WHO 5% malathion papers for one hour were randomly genotyped for the ace-1gene mutation, G119S. None of them had the G119S mutation. This indicates that resistance to malathion in Cx. quinquefasciatus in northern Thailand is not conferred by the ace-1 gene mutation.

3.4 Kdr allele frequency following deltamethrin selection The larval bioassay test of the wild caught parental Cq_CM larvae (F0) showed a deltamethrin LC50 value of 0.18 µg/L (Table 3). The adults reared from the same batch of larvae showed 15.2% mortality after exposure to 0.05% deltamethrin papers (Table 3). After three generations of selection, the LC50 value of deltamethrin in the larval bioassay gradually increased to 3.09 µg/L (17.2 fold). Mortality in the adult bioassay has decreased to 0% after only one generation (F1) of selection. Further selection is ongoing. The mutant F1014 allele frequency of the parental Cq_CM females was estimated to be 0.47 (Table 4). This estimation was derived by multiplying the total number of insecticide tested mosquitoes against the genotype frequencies of the survivor and dead

groups from Chiang Mai listed in Table 2, deducing the absolute phenotypic frequencies. The mutant allele frequency increased significantly after one generation of selection, but no significant difference was observed among F1 to F3 generations. 3.5 Detoxification resistance mechanism in deltamethrin resistance of Cq_CM strain The larval bioassay test of deltamethrin with and without inhibitor was performed on the Cq_CM strain (Parental strain, F0) to determine the metabolic detoxification mechanisms contributing to deltamethrin resistance. Larvae treated with PBO, an inhibitor of P450 monooxygenases enzyme, showed a significant increase (9-fold) in deltamethrin toxicity relative to untreated mosquitoes (p < 0.05) (Table 5). This suggests that there is P450 monooxygenase-mediated detoxification of deltamethrin in the Cq_CM strain. However, BNPP and DEM, inhibitors of esterases and glutathione-S-transferases enzymes, respectively, could not enhance the toxicity of deltamethrin, indicating that esterase- and glutathione-S-transferases-mediated metabolism may not contribute to resistance.

4. Discussion

Insecticide resistance levels of Cx. quinquefasciatus in northern Thailand have largely increased in the past 15 years. In 1998, this mosquito species in Chiang Mai and Lampang Provinces was susceptible to deltamethrin and permethrin [9]. The present study clearly shows that this species was generally resistant to deltamethrin and permethrin, although the resistance level is considered to be an underestimate due to our use of 0.05% deltamethrin paper which is at a higher concentration than the discriminating dose (0.025%) recommended for adult Cx. quinquefasciatus [36]. Similarly, increased resistance to malathion in Chiang Mai and Lampang Provinces was observed, with mortality rates decreasing from 94.7% and 98.9% [9] to 69.9% and 80.9%, respectively. No historic resistance information is available for the other provinces studied. The increase of resistance may be explained by the continuous use of pyrethroids (mainly deltamethrin) for control of dengue vectors by using thermal fogging or ultra-low volume spraying (ULV) throughout Thailand.

Malathion has been rarely used for mosquito vector control in recent years. In central Thailand, Cx.

quinquefasciatus was reported susceptible to malathion [11], but the present situation is not known.

In this study, we report for the first time the detection of the L1014F mutation in the populations of Cx. quinquefasciatus from Thailand. The classical L1014F kdr mutation has been reported among Cx. quinquefasciatus mosquitoes worldwide at varying genotype frequencies [12,13,20-22,37]. Two variants of the L1014F kdr mutation, consisting of A to T and A to C substitutions, have been detected in Cx. quinquefasciatus mosquitoes [20,21]. However, only the A to T substitution was observed in the current study. This study has provided evidence that the mutant F1014 allele has spread widely among six populations in northern Thailand. It should be noted that due to a small number of tested samples for the genotyping of L1014F mutation in this study, the observed allele

frequency may not be an accurate estimation of allele frequency in the area. The F1014 allele frequency was low except in Chiang Mai and Phrae Provinces where the homozygous mutant (F/F1014) genotype was found. This is in accordance with the relatively higher levels of deltamethrin resistance. This suggests a relation between the L1014F kdr mutation and resistance to deltamethrin in both populations. This is supported by our selection in the laboratory in which the mutant allele frequency of the L1014F mutation increased significantly along with resistance level. At presence, temephos is the main organophosphate compound used as larvicide and deltamethrin as adulticide throughout Thailand. The amount of usage varies depending on the policy of local administration offices [4] that may result in the difference in the frequency of allele mutations and level of resistance among the studied provinces.

However, no correlation could be seen between deltamethrin survival and mutant allele frequencies in the other provinces. The majority of the survivors did not have the F1014 allele, suggesting that resistance may not be conferred by this mutation only. Elsewhere, the kdr mutations A99S and W1594R have been previously identified, in combination with synonymous mutations of the VGSC gene, to be associated with pyrethroids resistance in Cx. quinquefasciatus mosquitoes [38,39]. The role of these mutations in resistance needs further investigation. Resistance to DDT and pyrethroids has been found to be correlated with the L1014F kdr mutation in Cx. quinquefasciatus populations from Benin [12] but not in many other areas [10,13,21,22]. The DNA variant at the kdr locus of the Cx. quinquefasciatus VGSC gene is reportedly not correlated with insecticide resistance, whereas the RNA allelic variant at the kdr locus has shown a strong correlation with pyrethroids resistance [37,40]. In addition, metabolic detoxification enzymes, i.e.

cytochrome P450 monoxygenases and esterases , have been reported to confer resistance or enhance resistance in Cx. quinquefasciatus [10,12,13,21,41,42]. At least two major mechanisms are responsible for deltamethrin resistance in Cx. quinquefasciatus mosquitoes from Chiang Mai Province (Cq_CM mosquitoes). One is the L1014F kdr mutation that is associated with resistance to deltamethrin (Type II pyrethroids) and likely confers cross-resistance to permethrin (Type I pyrethroids). Insects with kdr mutations generally show cross resistance to both type I and type II pyrethroids [17]. Another mechanism of deltamethrin resistance in the Cq_CM mosquitoes is the detoxifying enzyme mechanism. We determined the effects of an oxidase inhibitor on the toxicity of deltamethrin and concluded that the cytochrome P450 monoxygenases are one of the major mechanisms responsible for deltamethrin resistance in the larval stage of Cq_CM strain. Our bioassays with inhibitor were performed in the larval stage of the Cq_CM strain, however, resistance mechanisms and their phenotype can vary between the stages of life. Therefore, the mechanisms conferring resistance in the larvae may be different to those in the adult stage. The role of both kdr mutation and metabolic mechanism in the pyrethroids resistant-Cx. quinquefasciatus populations has previously been reported [10,12,21] in addition to this study. The interaction between two pyrethroids resistance loci, kdr and cytochrome P450 monoxygenases, presents multiplicative interactions in the permethrin resistant-Cx. quinquefasciatus mosquitoes in both homozygous and heterozygous genotypes [43]. Moreover, multiple insecticide resistance mechanisms have been observed to confer resistance to pyrethroids in Cx. quinquefasciatus populations throughout the world [10,12,21,24].

Resistance to organophosphate insecticides in Cx. quinquefasciatus populations has also substantially increased over the past decade [9,11]. The target site insensitivity mechanism, ace-1 mutation, has been previously reported to be associated with resistance to organophosphate and carbamate in Cx. quinquefasciatus [18,19]. However, the ace-1 mutation, G119S, was not observed in the current study. The relative contribution of both kdr and metabolic resistance mechanisms conferring deltamethrin resistance will be further assessed in the Cq_CM mosquitoes. A quick and inexpensive molecular diagnostic method to detect the L1014F mutation is required for testing larger sample sizes throughout Thailand.

5. Conclusion This study has demonstrated for the first time the presence of the L1014F kdr mutation in wild populations of Cx. quinquefasciatus in northern Thailand. Laboratory selection of deltamethrin resistant Cx. quinquefasciatus confirmed a strong positive correlation between the L1014F kdr mutation and deltamethrin resistance phenotype. However, this kdr mutation is not the only resistance mechanism. Cytochrome P450 monooxygenases may play a role in resistance to deltamethrin.

Acknowledgements

This work was funded by the Thailand Research Fund through the Research Grant for New Scholar (MRG5680063) and the Chiang Mai University Grant for New Researcher to Jintana Yanola. In addition, this study was partially supported by Diamond Research Grant of the Faculty of Medicine to Pradya Somboon, and the research administration office Chiang Mai University provided budget to our Excellence Center in Insect Vector Study. We thank Steven A Stenhouse for editing the manuscript. References 1.

Jitpakdi A, Choochote W, Panart P, Tookyang B, Panart K, Prajakwong S: Possible transmission of two types of Wuchereria bancrofti in Muang District, Chiang Mai, northern Thailand. Southeast Asian J Trop Med Public Health 1998, 29: 141-143.

2. Triteeraprapab S, Kanjanopas K, Suwannadabba S, Sangprakarn S, Poovorawan Y, Scott AL: Transmission of the nocturnal periodic strain of Wuchereria bancrofti by Culex quinquefasciatus: establishing the potential for urban filariasis in Thailand. Epidemiol Infect 2000, 125: 207-212. 3. Pumidonming W, Polseela P, Maleewong W, Pipitgool V, Poodendaen C: Culex quinquefasciatus in Phitsanulok as a possible vector of nocturnally periodic Wuchereria bancrofti transmission in Myanmar immigrants. Southeast Asian J Trop Med Public Health 2005, 36 Suppl 4: 176-179. 4. Chareonviriyaphap T, Bangs MJ, Suwonkerd W, Kongmee M, Corbel V, Ngoen-Klan R: Review of insecticide resistance and behavioral avoidance of vectors of human diseases in Thailand. Parasit Vectors 2013, 6: 280.

5.

Triteeraprapab S, Nuchprayoon I, Porksakorn C, Poovorawan Y, Scott AL: High prevalence of Wuchereria bancrofti infection among Myanmar migrants in Thailand. Ann Trop Med Parasitol 2001, 95: 535-538.

6. Satimai W, Jiraamonnimit C, Thammapalo S, Choochote W, Luenee P, Boitano JJ et al.: The impact of a national program to eliminate lymphatic filariasis in selected Myanmar immigrant communities in Bangkok and Ranong Province, Thailand. Southeast Asian J Trop Med Public Health 2011, 42: 1054-1064. 7. Hemingway J, Ranson H: Insecticide resistance in insect vectors of human disease. Annu Rev Entomol 2000, 45: 371-391. 8. Rivero A, Vezilier J, Weill M, Read AF, Gandon S: Insecticide control of vector-borne diseases: when is insecticide resistance a problem? PLoS pathogens 2010, 6: e1001000. 9. Somboon P, Prapanthadara LA, Suwonkerd W: Insecticide susceptibility tests of Anopheles minimus s.l., Aedes aegypti, Aedes albopictus, and Culex quinquefasciatus in northern Thailand. Southeast Asian J Trop Med Public Health 2003, 34: 8793. 10. Xu Q, Liu H, Zhang L, Liu N: Resistance in the mosquito, Culex quinquefasciatus, and possible mechanisms for resistance. Pest Manag Sci 2005, 61: 1096-1102.

11.

Sathantriphop S, Paeporn P, Supaphathom K: Detection of insecticides resistance status in Culex quinquefasciatus and Aedes aegypti to four major groups of insecticides. Trop Biomed 2006, 23: 97-101.

12. Corbel V, N'Guessan R, Brengues C, Chandre F, Djogbenou L, Martin T et al.: Multiple insecticide resistance mechanisms in Anopheles gambiae and Culex quinquefasciatus from Benin, West Africa. Acta Trop 2007, 101: 207-216. 13. Sarkar M, Borkotoki A, Baruah I, Bhattacharyya IK, Srivastava RB: Molecular analysis of knock down resistance (kdr) mutation and distribution of kdr genotypes in a wild population of Culex quinquefasciatus from India. Trop Med Int Health 2009, 14: 1097-1104. 14. Hemingway J, Hawkes NJ, McCarroll L, Ranson H: The molecular basis of insecticide resistance in mosquitoes. Insect Biochem Mol Biol 2004, 34: 653-665. 15. Davies TGE, Field LM, Usherwood PNR, Williamson MS: DDT, pyrethrins, pyrethroids and insect sodium channels. IUBMB Life 2007, 59: 151-162. 16. Soderlund DM: Pyrethroids, knockdown resistance and sodium channels. Pest Manag Sci 2008, 64: 610-616. 17. Dong K, Du Y, Rinkevich F, Nomura Y, Xu P, Wang L et al.: Molecular biology of insect sodium channels and pyrethroid resistance. Insect Biochem Mol Biol 2014, 50: 1-17.

18.

Weill M, Lutfalla G, Mogensen K, Chandre F, Berthomieu A, Berticat C et al.: Comparative genomics: Insecticide resistance in mosquito vectors. Nature 2003, 423: 136-137.

19. Weill M, Malcolm C, Chandre F, Mogensen K, Berthomieu A, Marquine M et al.: The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect mol biol 2004, 13: 1-7. 20. Wondji CS, Priyanka De Silva WA, Hemingway J, Ranson H, Parakrama Karunaratne SH: Characterization of knockdown resistance in DDT- and pyrethroid-resistant Culex quinquefasciatus populations from Sri Lanka. Trop Med Int Health 2008, 13: 548-555. 21. Jones CM, Machin C, Mohammed K, Majambere S, Ali AS, Khatib BO et al.: Insecticide resistance in Culex quinquefasciatus from Zanzibar: implications for vector control programmes. Parasit Vectors 2012, 5: 78. 22. Low VL, Chen CD, Lim PE, Lee HL, Tan TK, Lim YA et al.: First molecular genotyping of voltage gated sodium channel alleles in Culex quinquefasciatus populations in Malaysia. Pestic Biochem and Physiol 2013, 107: 127-131. 23. Low VL, Chen CD, Lee HL, Tan TK, Chen CF, Leong CS et al.: Enzymatic characterization of insecticide resistance mechanisms in field populations of malaysian culex quinquefasciatus say (diptera: culicidae). PLoS One 2013, 8: e79928.

24.

Pocquet N, Milesi P, Makoundou P, Unal S, Zumbo B, Atyame CÃ et al.: Multiple insecticide resistances in the disease vector Culex p. quinquefasciatus from western Indian Ocean. PLoS One 2013, 8: e77855.

25. Prapanthadara L, Koottathep S, Promtet N, Suwonkerd W, Ketterman AJ, Somboon P: Correlation of glutathione Stransferase and DDT dehydrochlorinase activities with DDT susceptibility in Anopheles and Culex mosquitos from northern Thailand. Southeast Asian J Trop Med Public Health 2000, 31 Suppl 1: 111-118. 26. Yanola J, Somboon P, Walton C, Nachaiwieng W, Prapanthadara LA: A novel F1552/C1552 point mutation in the Aedes aegypti voltage-gated sodium channel gene associated with permethrin resistance. Pestic Biochem and Physiol 2010, 96: 127-131. 27. Somwang P, Yanola J, Suwan W, Walton C, Lumjuan N, Prapanthadara LA et al.: Enzymes-based resistant mechanism in pyrethroid resistant and susceptible Aedes aegypti strains from northern Thailand. Parasitol Res 2011. 28. Yanola J, Somboon P, Walton C, Nachaiwieng W, Somwang P, Prapanthadara LA: High-throughput assays for detection of the F1534C mutation in the voltage-gated sodium channel gene in permethrin-resistant Aedes aegypti and the distribution of this mutation throughout Thailand. Trop Med Int Health 2011, 16: 501-509.

29.

Stenhouse S, Plernsub S, Yanola J, Lumjuan N, Dantrakool A, Choochote W et al.: Detection of the V1016G mutation in the voltage-gated sodium channel gene of Aedes aegypti (Diptera: Culicidae) by allele-specific PCR assay, and its distribution and effect on deltamethrin resistance in Thailand. Parasit Vectors 2013, 6: 253.

30. World Health Organization: Instructions for determining the susceptibility or resistance of mosquito larvae to insecticides. In WHO/VBC/ 81.807. 1981:1-6. 31. World Health Organization: Instructions for determining the susceptibility of adult mosquito to organochlorine, organophosphate and carbamate insecticides establishment of base line. In WHO/VBC/81.806. 1981:1-7. 32. Abbott WS: A method of computing the effectiveness of an insecticide. J Econ Entomol 1925, 18: 265-267. 33. Finney DJ: Probit analysis, Cambridge University Press edn. London: 1971. 34. Drummond A, Ashton B, Cheung M, Heled J, Kearse M, Moir R et al.: Geneious Pro v 5.04. 2009. 35. Rousset F: GENEPOP'007: a complete reimplementation of the GENEPOP software for Windows and Linux. Mol Ecol Resources 2008, 8: 103-106. 36. World

Health

Organization:

Discriminating

WHO/CDS/CPC/MAL/98.12. 1998:1.

concentrations

of

insecticides

for

adult

mosquitoes.

In

37.

Liu N, Xu Q, Li T, He L, Zhang L: Permethrin resistance and target site insensitivity in the mosquito Culex quinquefasciatus in Alabama. J Med Entomol 2009, 46: 1424-1429.

38. Xu Q, Zhang L, Li T, Zhang L, He L, Dong K et al.: Evolutionary adaptation of the amino acid and codon usage of the mosquito sodium channel following insecticide selection in the field mosquitoes. PLoS One 2012, 7: e47609. 39. Li T, Zhang L, Reid WR, Xu Q, Dong K, Liu N: Multiple mutations and mutation combinations in the sodium channel of permethrin resistant mosquitoes, Culex quinquefasciatus. Sci Rep 2012, 2. 40. Xu Q, Wang H, Zhang L, Liu N: Kdr allelic variation in pyrethroid resistant mosquitoes, Culex quinquefasciatus (S.). Biochem Biophys Res Commun 2006, 345: 774-780. 41. Hardstone MC, Leichter C, Harrington LC, Kasai S, Tomita T, Scott JG: Cytochrome P450 monooxygenase-mediated permethrin resistance confers limited and larval specific cross-resistance in the southern house mosquito, Culex pipiens quinquefasciatus. Pestic Biochem and Physiol 2007, 89: 175-184. 42. Sarkar M, Bhattacharyya IK, Borkotoki A, Goswami D, Rabha B, Baruah I et al.: Insecticide resistance and detoxifying enzyme activity in the principal bancroftian filariasis vector, Culex quinquefasciatus, in northeastern India. Med Vet Entomol 2009, 23: 122-131.

43.

Hardstone MC, Leichter CA, Scott JG: Multiplicative interaction between the two major mechanisms of permethrin resistance, kdr and cytochrome P450-monooxygenase detoxification, in mosquitoes. J Evol Biol 2009, 22: 416-423.

Figure

Figure 1 Mosquito collection sites. Mosquito collections were conducted from the following sites: Chiang Mai (18o 47’ 15” N, 98o 59’ 35” E), Chiang Rai (19o 54’ 25” N, 99o 49’ 51” E), Phayoa (19o 9’ 59” N, 99o 54’ 6” E), Phrae (18o 8’ 40” N, 100o 8’ 25” ), Lamphun (18o 34’ 38” N, 99o 0’ 15” E) and Lampang (18o 17’ 19” N, 99o 29’ 27” E)

Table Table 1 Mortality of female Cx. quinquefasciatus mosquitoes among six populations from northern Thailand. Mosquitoes were tested by using standard WHO 0.05% deltamethrin and 5% malathion papers.

Location

0.05% Deltamethrin

5% Malathion

No dead / total mosquitoes

Mortality rate (%)

No dead / total mosquitoes

Mortality rate (%)

Lampang

113/121

93.4

51/63

80.9

Phayao

150/187

80.2

9/9

100

Chiang Rai

52/126

41.3

29/31

93.6

Lamphun

46/145

31.7

46/60

76.7

Chiang Mai

121/795

15.2

79/113

69.9

Phrae

28/217

12.9

98/113

86.7

Total

510/1591

45.8

312/389

80.2

Table 2 Genotype and allele frequencies of the L1014F mutation among six populations from northern Thailand. Surviving and dead Cx. quinquefasciatus mosquitoes after one hour exposure to WHO 0.05% deltamethrin paper were determined the L1014F mutation by using DNA sequencing.

Location

Lampang Phayoa Chiang Rai Lamphun Chiang Mai Phrae Total

a

Mosquito status a Alive Dead Alive Dead Alive Dead Alive Dead Alive Dead Alive Dead Alive Dead

L1014F genotype b

No. of mosquito 8 113 37 150 74 52 99 46 674 121 189 28 1,081 510

L/L1014

L/F1014

F/F1014

7 8 7 8 6 8 7 7 5 7 1 5 33 43

1 0 1 0 2 0 1 1 1 1 1 3 7 5

0 0 0 0 0 0 0 0 6 0 6 0 12 0

Total number 8 8 8 8 8 8 8 8 12 8 8 8 52 48

F1014 allele frequency 0.06 0.00 0.06 0.00 0.13 0.00 0.06 0.06 0.54 0.06 0.81 0.19 0.30 0.05

pc

> 0.05 > 0.05 > 0.05 > 0.05 < 0.01 < 0.01 < 0.01

Dead or alive mosquitoes after exposure to WHO 0.05% deltamethrin paper for 1 hour, b L1014F mutation was genotyped by direct DNA sequencing, c Fisher’s exact test was used to test mutant F1014 allele frequency differences between alive and dead mosquitoes from each location.

Table 3 Toxicity of deltamethrin to Cq_CM strain of before and after deltamethrin selection in the laboratory.

Mosquito

Selecting

strains

concentration

n

(µg/L) Cq_CM (Parent)

a

Adult bioassay b

Larval bioassay a LC50 (µg/L)

χ2

(95%CI)

(df)

Slope (±SE)

n

% Mortality

-

800

0.18 (0.15-0.21)

3.24 (6)

1.12 (±0.15)

795

15.2

Cq_CM_RF1

0.18

900

0.50 (0.40-0.61)

2.92 (7)

1.22 (±0.08)

81

0.0

Cq_CM_RF2

0.50

900

1.17 (0.63-2.00)

2.30 (7)

1.48 (±0.10)

82

0.0

Cq_CM_RF3

1.17

900

3.09 (2.58-3.70)

8.52(6)

1.45 (±0.10)

90

0.0

The larval susceptibility test of deltamethrin, b The adult susceptibility test of WHO 0.05% deltamethrin paper.

Table 4 The L1014F allele frequency in female Cx. quinquefasciatus Cq_CM strain before and after deltamethrin selection

Mosquito

n

generations

a

Genotype frequency

Mutant F1014

L/L1014

L/F1014

F/F1014

allele frequency

Cq_CM (parent, F0)

20

0.49

0.09

0.42

0.47a

Cq_CM_R F1

12

0.17

0.25

0.58

0.71b

Cq_CM _RF2

12

0.08

0.17

0.75

0.83b

Cq_CM _RF3

12

0.25

0.25

0.50

0.63b

Different letters are significantly different by Fisher’s exact test (p < 0.05), b No significant differences.

Table 5 Toxicity of deltamethrin, with and without enzyme inhibitors, to the Cq_CM strain. Insecticide with or without inhibitors a

n

LC50 (95% CI) (µg/L)

χ2 (df)

Slope (±SE)

Deltamethrin

800

0.18 (0.15-0.21)

3.24 (6)

1.12 (±0.15)

Deltamethrin + PBO

700

0.02 (0.01-0.02)b

5.20 (5)

0.86 (±0.09)

Deltamethrin + BNPP

700

0.16 (0.14-0.19)

3.42 (5)

2.25 (±0.16)

Deltamethrin + DEM

700

0.19 (0.17-0.23)

3.60 (5)

2.00 (±0.16)

a

Piperonyl butoxide (PBO), S,S,S-tributylphosphorotrithioate (DEF), Bis(4-nitrophenyl)-phosphate (BNPP), Diethyl maleate (DEM),

, bP < 0.05 relative to the untreated group; statistical analyzes were performed using one-way ANOVA test.

grahpical abstract_JY et al .