Research in Veterinary Science 97 (2014) 440–449

Contents lists available at ScienceDirect

Research in Veterinary Science j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / r v s c

Insertion and stable expression of Gaussia luciferase gene by the genome of bovine viral diarrhea virus S. Arenhart a,b, E.F. Flores b, R. Weiblen b, L.H.V.G. Gil a,* a Laboratório de Virologia e Terapia Experimental (LaViTE), Departamento de Virologia e Terapia Experimental, Centro de Pesquisas Aggeu Magalhães (CPqAM), Fundação Oswaldo Cruz (Fiocruz), Recife, PE 50670-420, Brasil b Setor de Virologia (SV), Departamento de Medicina Veterinária Preventiva (DMVP), Centro de Ciências Rurais (CCR), Universidade Federal de Santa Maria, Santa Maria, RS 97105-900, Brasil

A R T I C L E

I N F O

Article history: Received 11 June 2013 Accepted 8 July 2014 Keywords: Pestivirus Reverse genetics Infectious clone Reporter gene Yeast homologous recombination

A B S T R A C T

As a tool to address selected issues of virus biology, we constructed a recombinant cDNA clone of bovine viral diarrhea virus (BVDV) expressing Gaussia luciferase (Gluc) reporter gene. A full-length genomic cDNA clone of a non-cytopathic BVDV isolate was assembled by recombination in yeast Saccharomyces cerevisiae. The Gluc gene was inserted between the Npro and Core protein coding regions by recombination. The cDNA transcribed in vitro was infectious upon transfection of MDBK cells, resulting in reporter gene expression and productive virus replication. The rescued viruses were stable for 15 passages in cell culture, maintaining the replication kinetics, focus size and morphology similar to those of the parental virus. Expression and correct processing of the reporter protein were also maintained, as demonstrated by Gluc activity. These results demonstrate that genes up to 555 bp are simply assembled by a single step in yeast recombination and are stably expressed by this cDNA clone. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Bovine viral diarrhea virus (BVDV) is a small, enveloped, positive sense RNA virus belonging to the genus Pestivirus, family Flaviviridae (Lindenbach and Rice, 2001). The BVDV genome is a linear single stranded RNA molecule of approximately 12.3 kilobases. The genome contains a single long open reading frame (ORF) that encodes a polyprotein of approximately 4000 amino acids (Donis, 1995). The viral RNA genome is directly translated by host cell ribosomes in a cap independent fashion, dependent on a 5′-UTR internal ribosomal entry site (IRES). Translation of the genomic RNA produces a polyprotein that is co- and post-translationally cleaved by cellular and viral encoded proteases, giving rise to eleven mature proteins: NH2-Npro-C-Erns-E1-E2-p7-NS2/3-NS4A-NS4B-NS5A-NS5BCOOH (Collett et al., 1988). BVDV is an important pathogen of cattle and produces important losses to the livestock industry worldwide (Ridpath, 2010). Infection of seronegative cattle with BVDV may result in a variety of clinical manifestations ranging from subclinical infection to a fatal disease called mucosal disease (Baker, 1995). Respiratory or gastroenteric disease, thrombocytopenia, hemorrhagic disease and immunosuppression-associated syndromes are commonly associated with BVDV infection (Bolin and Grooms, 2004). Infection of

* Corresponding author. Tel.: +55 81 2101 2564; fax: +55 81 2101 2564. E-mail address: laura@cpqam.fiocruz.br (L.H.V.G. Gil). http://dx.doi.org/10.1016/j.rvsc.2014.07.007 0034-5288/© 2014 Elsevier Ltd. All rights reserved.

pregnant cows may result in embryonic or fetal death, abortions, congenital malformations and the birth of weak and unthrifty calves (Bolin and Grooms, 2004). Fetal infection between days 40 and 120 of gestation frequently results in the birth of immunotolerant, persistently infected (PI) calves. PI animals are the main carriers and shedders of BVDV in nature and represent the key point in the epidemiology of the infection (McClurkin et al., 1984). Field BVDV isolates present high genetic and antigenic variability and are classified into two species, BVDV-1 and BVDV-2. The two species are distinguished mainly by differences in the 5′-UTR of the genome and on the diversity in the major envelope glycoprotein E2 (Kümmerer and Meyers, 2000). BVDV isolates may also be divided into two biotypes: cytopathic (cp) and non-cytopathic (ncp) viruses, based on the effects of virus replication in cell cultures (Gillespie et al., 1960). Ncp-BVDV is responsible for most infections in the field and is the only biotype to establish persistent fetal infection (Bolin and Grooms, 2004). A small proportion of field isolates contain a mixture of ncp and cp viruses, the latter being generated from the ncp virus by diverse genetic mechanisms, all leading to the expression of NS3 as a separate polypeptide. In contrast, ncp viruses express NS3 as a COOH-terminal third of the NS2/3 protein (Kümmerer and Meyers, 2000; Ridpath, 2005; Tautz et al., 1994). Thus, ncp isolates are considered the “true” BVDV since they are responsible for most infections and associated with the main clinical and reproductive consequences of BVDV infection (Bolin and Grooms, 2004). The biology of persistent fetal infection remains a major issue on BVDV biology and has been subject of extensive investigations

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

441

in recent decades. In this sense, the development of reverse genetics for pestiviruses (Moormann et al., 1996) and for BVDV (Meyers et al., 1996) paved the way for a number of studies concerning different aspects of pestivirus biology. A number of BVDV cDNA clones have been constructed and used to investigate several aspects of virus replication, pathogenesis and interactions with the host immune system (Dehan et al., 2005; Fan and Bird, 2008b; Gil et al., 2006; Harding et al., 2002; Henningson et al., 2009; Kümmerer and Meyers, 2000; Meyer et al., 2002; Meyers et al., 2007; Reimann et al., 2003; Vassilev et al., 1997). Most recombinant BVDV clones were constructed by the assembly of full genome length cDNA in bacterial plasmid vectors. The bacterial artificial chromosome (BAC) strategy was recently used to generate a full-length cDNA copy of the BVDV SD-1 strain, which seemed to be more stable in Escherichia coli (Fan and Bird, 2008a, 2008b). We recently described the construction of a chimeric BVDV cDNA clone by homologous recombination in yeast method (Saccharomyces cerevisiae) (Arenhart et al., submitted for publication). This strategy has been shown to overcome the problem of instability of some flavivirus genomes in E. coli (Polo et al., 1997; Puri et al., 2000). Using this method, a chimeric full-length cDNA clone containing the entire ORF of a representative Brazilian BVDV-1 strain (IBSP4ncp) flanked by the 5′ and 3′-UTRs of the reference BVDV strain NADL was assembled. In the present article we demonstrate that this clone can be manipulated easily and that foreign genes up to 555 bp may be inserted and expressed by the recombinant BVDV genome, thus representing a powerful tool to address many aspects of virus biology.

NS3) (Corapi et al., 1989) as primary antibodies, followed by washing in PBS and incubation with an anti-mouse IgG FITC-conjugated secondary antibody (1:100 in PBS; Sigma-Aldrich). Slides were examined under UV light in an epifluorescence microscope (Zeiss). Immunoperoxidase (IPX) staining for BVDV antigens was performed in cell monolayers grown in 6-well plates and inoculated with dilutions of the respective viruses. Acetone-fixed cell monolayers were incubated with the same MAbs described above (1 h at 37 °C), washed and incubated with an anti-mouse HRPOconjugated antibody (1:1000 in PBS; Sigma-Aldrich). After washing, HRPO substrate (AEC, aminoethylcarbazole in acetate buffer 50 mM, pH 5.0) was added to cell monolayers and incubated for an additional hour at 37 °C. Viral foci were visualized under light microscopy.

2. Materials and methods

2.4. Construction of a BVDV cDNA clone expressing the Gaussia luciferase gene

A recombinant BVDV cDNA clone expressing the Gaussia luciferase (Gluc) reporter gene was constructed by homologous recombination in yeast, using the previously constructed cDNA clone IC-pBSC_IBSP4ncp#2 as the parental vector. The Gluc gene (555 bp) was introduced between the genes encoding the Npro and Core viral proteins, along with a linker and the foot and mouth disease virus protease 2A gene (FMDV2Apro). The viruses rescued from the recombinant cDNA clones – after in vitro transcription and RNA transfection into MDBK cells – were characterized concerning their biological properties and Gluc expression. 2.1. Cells, viruses and plasmid vectors Pestivirus-free MDBK cells (Madin–Darby bovine kidney, ATCC CCL22) were used for all procedures of virus multiplication, characterization and quantification. Cells were maintained in MEM (minimal essential medium – Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% equine serum, penicillin (100 U/mL) and streptomycin (10 μg/mL, GIBCO, BRL). Cell cultures were maintained at 37 °C with 5% CO2. The recombinant cDNA clone ICpBSC_IBSP4ncp#2 (Arenhart et al., submitted for publication) was used as the parental clone. The plasmid pGluc-NS (WF10) containing the Gaussia princeps luciferase gene was kindly provided by Dr. Daniel R. Perez (Department of Veterinary Medicine, University of Maryland, USA). The virus chi-NADL/IBSP4ncp#2 rescued from the parental clone was used as the control in the characterization of viruses expressing the Gluc reporter gene. 2.2. Fluorescent antibody (IFA) and peroxidase (IPX) assays Indirect fluorescent antibody assays (IFA) for BVDV antigens were performed on MDBK cells that had been deposited on to glass coverslips, left to attach and fixed in cold acetone. Fixed cells were incubated for 1 h at 37 °C with a pool of monoclonal antibodies (MAbs) to BVDV (MAb 15c5 against E0; MAb 12g4 to E2; MAb 20.10.6 to

2.3. Assay for Gluc activity The expression and activity of the Gluc reporter gene was detected through a Gaussia luciferase assay performed on the supernatants of MDBK cells transfected with RNA obtained by in vitro transcription of recombinant clones and from cells inoculated with the progeny viruses at different passages, as described below. Gluc activity was measured using a BioLux Gaussia luciferase Assay Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s protocol. Briefly, 10 μL of supernatant was mixed with 50 μL of 1× Biolux buffer and read in a luminometer Mithras LB 940 (Berthold). The results were expressed as RLU (Relative Light Units) and mock-infected MDBK cells were used as negative control.

The recombinant BVDV cDNA clone IC-pBSC_IBSP4ncp#2 was used as platform to construct the recombinant genome expressing the Gaussia luciferase (Gluc) gene. The cDNA clone ICpBSC_IBSP4ncp#2 contains the entire ORF of a Brazilian ncp BVDV isolate (IBSP4ncp, GenBank accession number KJ620017) flanked by the 5′ and 3′-UTRs of NADL strain (Arenhart et al., submitted for publication). The recombinant BVDV IBSP-4ncp cDNA was assembled according to a strategy described by Fan et al. (2008), who introduced the gene eGFP2A between the genes Npro and Core of the BVDV SD-1. All manipulations of the plasmid IC-pBSC_ IBSP4ncp#2 were performed by homologous recombination in yeast. The strategy of construction is depicted in Fig. 1. 2.5. Preparation of the vector for recombination Plasmid IC-pBSC_IBSP4ncp#2 was digested with SacI (New England BioLabs, Ipswich, MA, USA) removing part of the Npro and NS2 genes and intervening sequences. Four μg of plasmid DNA was digested at 37 °C during 3 h followed by dephosphorylation with 5 U of the enzyme CIAP (New England Laboratories) for 45 min at 37 °C. The final product was resolved in an ethidium bromide stained 1% agarose gel followed by excision of the band and purification with QIAquick Gel Extraction kit (Qiagen). 2.6. PCR reaction for construction of the recombinant The recombinant clone IC-pBSC_IBSP4ncpGluc was assembled by yeast recombination of three PCR products containing homologous ends, and the vector IC-pBSC_IBSP4ncp#2 digested with SacI. The first PCR fragment (561 bp) was amplified with oligonucleotides BVDVqm 5′-UTR_NADL_IBSP4-F and IBSP-4/Npro_linker_GlucR, from the plasmid IC-pBSC_IBSP4ncp#2, which contains part of Npro and a linker sequence of 21 nt N-terminal of Core protein gene modified and optimized. The second fragment (632 bp) was

442

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

Fig. 1. Schematic strategy for construction of the recombinant BVDV IBSP-4ncp cDNA clone expressing the Gaussia luciferase reporter gene. (A) Homologous recombination in yeast of three PCR products and the SacI digested vector IC-pBSC_IBSP4ncp. PCR products are represented with indications of the contained sequences. (B) Genome organization of the chimeric clone IC-pBSC_IBSP4ncpGluc.

amplified from the plasmid pGluc-NS (WF10) using the oligos Linker_Gluc-F and part of FMDV2A_GLuc-R. This fragment contains the Gluc gene (555 bp), the 21 bp linker and the protease 2Apro of FMDV. The third fragment (3614 bp) was amplified from plasmid pBSC_IBSP4ncp with oligos FMDV2A_IBSP4/Core-F and BVDVOsloss–4458-R containing part of FMDV2Apro sequence and the sequence of IBSP4ncp comprising a sequence from protein Core gene up to NS2-3. The oligonucleotides used for amplification, cloning and construction of the recombinant and sequencing were planned based on the sequences of plasmids IC-pBSC_IBSP4ncp#2 and pGlucNS (WF10) are shown in Table 1. The oligos were designed such that the amplicons would have the homologous sequences necessary for recombination in yeast (~20–25 nt) at their ends. Reactions were performed in 50 μL with 1× KlenTaq-LA polymerase buffer (Clontech), 1.3% DMSO, 0.4 M betain (Sigma-Aldrich), 200 μM of each dNTP, 1 U KlenTaq-LA polymerase (Clontech), 20 pmol of each oligonucleotide and 50 ng of cDNA template. PCR conditions were: 5 min at 95 °C for initial denaturation, 35 cycles (denaturation 30 sec at 95 °C;

Table 1 Oligonucleotides used on the construction of the recombinant virus IBSP4ncp expressing the Gaussia luciferase reporter gene. Oligonucleotide

Sequence

BVDVqm 5′UTR_NADL_ IBSP-4Fa IBSP-4/Npro_linker_ GlucRb,c Linker_GlucFc

CTAAAAATCTCTGCTGTACATGGCACATGGAGTT GATTGCAAATGAAC CCATTCCCTCGGCGTTGGTATCACTGCAGCTTGA AACCCATAGGG CTGCAGTGATACCAACGCCGAGGGAATGGGAGT CAAAGTTCTGTTTG GGGCCCAGGGTTGGACTCGACGTCTCCCGCAAGC TTAAGAAGGTCAAAATTGTCACCACCGGCCCCCT AGACGTCGAGTCCAACCCTGGGCCCTCCGACAC AAATGCAGAAGG TGAGGGGCAAGAGTATGCTGACATT

FMDV2A_GLucRd FMDV2A_IBSP4/CoreFd BVDV-Osloss–4458R

Oligonucleotides are identified according to the sequences they amplify/possess. a F-sense. b R-antisense. c Linker sequence inserted by the underlined sequences. d Protease FMDV2Apro sequence inserted by the sequence in bold.

30 sec of annealing at 52 °C, 1 min extension for each 1000 bp at 72 °C) and a final extension of 10 min at 72 °C. 2.7. Yeast transformation and identification of recombinant clones The three PCR products containing the IBSP4ncp genes, the Gluc gene and the SacI digested IC-pBSC-IBSP4ncp#2 vector were introduced into S. cerevisiae, strain RFY206 (MATa his3Δ200 leu2-3 lys2Δ201 ura3-52 trp1Δ::hisG) (Finley and Brent, 1994), using the lithium acetate (LiAc) method essentially as described previously (Sambrook and Russel, 2001). After transformation, yeast were inoculated in YNB solid medium (Yeast Nitrogen Base – 6.7 g Yeast Nitrogen Base w/o amino acids, w/ammonium sulfate – SigmaAldrich, 20 g glucose, 1:10 V/V amino acid solution 10× – yeast synthetic drop-out medium without tryptophan – Sigma-Aldrich) without tryptophan and maintained at 30 °C for up to three days. Five recombinant yeast colonies were chosen, picked and amplified in 20 mL of tryptophan-free liquid YNB medium for 18–24 h at 30 °C. Cells were then concentrated by centrifugation, washed in ddH2O, resuspended in 400 μL SCE buffer (1 M Sorbitol, 100 mM NaAc and 60 mM EDTA), with 4 μL zymolyase (200 mg/mL) and 2 μL of 2-mercaptoethanol, incubated 1 h and centrifuged again. Plasmid DNA was extracted from yeast spheroplast pellets using the QIAprep Spin MiniPrep kit (Qiagen). The presence of the cloned fragments was confirmed by PCR using the primers (757F-GGAGAGTAA CTGGTAGTGA and 1137R-GTCACGCAAGAAACTAGAG), followed by nucleotide sequencing. After confirmation, two recombinant clones (IC-pBSC_IBSP4ncpGluc#3 and IC-pBSC_IBSP4ncpGluc#4) were further amplified and extracted using the Plasmid Midi kit (Qiagen, Hilden, Germany). 2.8. Nucleotide sequencing The regions corresponding to the reporter gene of ICpBSC_IBSP4ncpGluc#3 and #4 were initially sequenced for confirmation of the correct cloning. Subsequently, the parental plasmid IC-pBSC_IBSP4ncp#2, the recombinant plasmids (IC-pBSC_ IBSP4ncpGluc#3 and #4) were entirely sequenced. The parental

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

virus (chi-NADL/IBSP4ncp#2) and a rescued virus (chi-NADL/ IBSP4ncpGluc#3) were entirely sequenced at passages 0 (rescued virus) and 5. All viral sequences were amplified from supernatant of infected cells. Sequencing reactions were performed using the mix BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer. Products of sequencing were resolved in an ABI 3100 Genetic Analyzer sequencer (Applied Biosystems). Sequence analyses were conducted by using the package Lasergene® (DNAstar Inc.) and a consensus sequence of each virus was generated by the program SeqMan II (Lasergene®, DNAstar Inc.).

2.9. Full genome PCR amplification and in vitro transcription Yeast plasmid DNA (100 ng) of the recombinant clones ICpBSC_IBSP4ncpGluc#3 and #4 was used as template. PCR was performed using 1 U KlenTaq-LA DNA polymerase mix (Clontech), designed for long and accurate amplifications, 1× KlenTaq-LA buffer (Clontech), 0.5 U Vent DNA polymerase (New England BioLabs), 1.3% dimethyl sulfoxide (DMSO), 0.4 M betain (Sigma-Aldrich), 200 μM of each dNTP, 20 pmol of each primer (pBSC-T7-NADL-F and NADL3′-UTR-R). These primers anneal at 5′-UTR and 3′-UTR ends of NADL genome, respectively. Oligonucleotide pBSC-T7-NADL-F contains the sequence of the bacteriophage T7 RNA polymerase promoter for in vitro transcription. PCR conditions were: 4 min at 95 °C initial denaturation followed by 32 cycles of 1 min denaturation at 93 °C, 1 min annealing at 58 °C, 13 min extension at 72 °C. PCR products were phenol-chloroform purified and ethanol precipitated prior to in vitro transcription using the MEGAscript® T7 kit according to manufacturer’s instructions (Ambion).

2.10. Transfection and monitoring of infectivity of in vitro transcribed RNAs For transfection, MDBK cells were trypsinized, washed in serum-free MEM, washed twice with PBS pH 7.2/DEPC (diethylpyrocarbonate) at 4 °C and resuspended at 8 × 106/mL in 400 μL Cytomix (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4/ KH2PO4 pH 7.6, 25 mM HEPES pH 7.6, 2.0 mM EGTA, 5.0 mM MgCl2) plus 2.0 mM of ATP and 5.0 mM of glutathione (Van den Hoff et al., 1992). Electroporation was performed in 4 mm cuvettes in an ECM830 BTX electroporator, at the following conditions: 900 V, 99 msec, 10 pulses, 1 sec between pulses (Qu et al., 2001). Electroporated cells were maintained at room temperature for 10 min, resuspended in culture medium (MEM + 5% equine serum), placed in T-75 cm2 flasks and incubated at 37 °C and 5% CO2. Cell cultures were maintained for five days and monitored for BVDV antigens by IFA, typically at 24, 48 and 72 h. The presence of infectious virus in the supernatants of transfected cells was confirmed by inoculating aliquots in fresh MDBK cells, followed by IFA for BVDV antigens 48 h later. Viruses rescued from the supernatant of transfected cells were thereafter designated chi-NADL/IBSP4ncpGluc#3 and #4 at passage 0 (p0).

2.11. Characterization of viruses derived from cDNA clones 2.11.1. Virus infectivity and stability To evaluate the infectivity and stability of viruses recovered from the recombinant clones, chi-NADL/IBSP4ncpGluc#3 and #4 were submitted to 15 passages in cell culture at a multiplicity of infection (MOI) of 0.5 in 24-well plates. At each passage, inoculated cells were submitted to IFA for viral antigens and the supernatants were submitted to Gluc activity assay. At selected passages, viral RNA extracted from culture supernatants was submitted to RT-PCR for monitoring the presence of the reporter sequences.

443

2.11.2. Kinetics of virus replication and Gaussia luciferase activity Ninety percent confluent MDBK cells were inoculated in duplicates with the rescued viruses (chi-NADL/IBSP4ncpGluc#3 and #4) or with the parental rescued virus (chi-NADL/IBSP4ncp#2) at an MOI of 0.3 in 24-well plates. After 1 h adsorption at 37 °C, the inoculum was removed, cell monolayers were washed three times with MEM, culture medium was added and plates were incubated at 37 °C in a 5% CO2 atmosphere for 72 h. Aliquots of the culture supernatant were collected at intervals (0, 8, 16, 24, 32, 40, 48, 56, 64, 72 h) and frozen at −80 °C for subsequent virus quantification. Virus quantification was performed by limiting dilution and virus titers were calculated as log10 median plaques forming units/mL (PFU/mL). The virus rescued from the parental clone, chi-NADL/IBSP4ncp#2, was used as control in all experiments. The same supernatants were submitted to quantification of the Gluc activity. 2.11.3. Viral focus assays The size and morphology of infectious foci produced by the recombinant viruses were investigated in 90% confluent MDBK cells grown in 6-well plates. Cells were inoculated with serial dilutions of each virus (10−1 to 10−7), left to adsorb 1 h at 37 °C, followed by removal of the inoculum, washing and overlaying of cells with MEM containing 1% agarose and 5% equine serum. After three days of incubation at 37 °C and 5% CO2, the agar overlay was removed, cell monolayers were fixed in 30% acetone for 13 min, air dried and submitted to IPX staining as described above. 2.11.4. Stability of recombinant yeast cDNA clones in E. coli Recombinant plasmids IC-pBSC_IBSP4ncpGluc#3 and #4 were electroporated into E. coli DH10B (Invitrogen) for DNA amplification. Electroporation conditions were: 2.75 kV, 99 μsec, 5 pulses, 1 sec between pulses, electroporator ECM-830, BTX. Transformed E. coli were grown in solid LB medium containing chloramphenicol (20 μg/mL) at 37 °C for 18–20 h. Positive colonies were confirmed for the presence of the respective plasmids by PCR and were subsequently grown in liquid LB medium with chloramphenicol for 16–20 h. Cells were centrifuged and plasmid DNA was extracted using Plasmid Midi Kit (Qiagen). Plasmid DNA was used as template for the PCR encompassing the whole genome and addition of the T7 polymerase promoter, as described above. After purification, in vitro transcribed RNA was electroporated into MDBK cells as described. Infectivity of the RNAs was accessed by IFA performed at 48 h after transfection; progeny viruses were harvested and submitted to five passages in MDBK cells with infectivity and Gluc activity being monitored at each passage by IFA and Gluc assay, respectively. 3. Results 3.1. Construction of a chimeric BVDV cDNA clone containing the Gluc reporter gene Using the parental cDNA clone IC-pBSC_IBSP4ncp#2, which contains the ORF of the Brazilian BVDV strain IBSP4ncp and the UTRs of NADL strain, two recombinant clones containing the reporter gene Gaussia luciferase (Gluc) were constructed (IC-pBSC_IBSP4ncpGluc#3 and #4). The cloning strategy used three PCR products and the vector IC-pBSC_IBSP4ncp#2 digested with SacI to remove the sequence between Npro and part of NS2-3 (Fig. 1A). The first fragment (555 bp) reconstructed the complete Npro, contained part of the 5′-UTR at its 5′ end for recombination and introduced a linker sequence at its 3′ end. This sequence was constructed to allow for the correct cleavage of the reporter gene between N pro and Gluc by the N pro autoprotease activity. The linker sequence consisted of a 21 nt region modified and optimized yet still coding for the first seven amino acids of the Core protein. The second fragment (631 bp) contained

444

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

the linker at its 5′ end, the whole Gluc sequence (555 bp) and the FMDV2Apro sequence (51 nt) at its 3′ end. Fragment 3 (3614 bp) contained part of the FMDV2Apro sequence (25 nt), the viral sequence from the Core gene up to part of NS2-3, for reconstructing the fragment excised by SacI digestion. The correct recombination and introduction of the Gluc sequence was confirmed by nucleotide sequencing (not shown). The genome organization of the chimeric cDNA clone containing the Gluc reporter gene and the additional sequences (linker + FMDV2Apro) is depicted in Fig. 1B. Upon confirmation of the correct cloning, plasmid DNA from two clones (#3 and #4) was amplified in yeast, extracted and submitted to a PCR of the whole genome for the addition of the phage T7 polymerase promoter. The amplicons were purified and submitted to in vitro transcription by T7 polymerase. In vitro transcribed RNAs were then purified and transfected into MDBK cells to investigate genome translation, replication and production of progeny virus and gene reporter expression.

3.2. Infectivity and Gluc expression by RNAs in vitro transcribed from cDNA clones Transfection of MDBK cells with RNA transcribed in vitro from both recombinant clones (IC-pBSC_IBSP4ncpGluc#3 and #4) resulted in production of viral proteins and Gluc activity, as demonstrated by IFA and Gluc assay, respectively, performed at 48 h posttransfection (not shown). Typically, approximately 40–50% of cells were positive for BVDV proteins at this time (not shown). To investigate the presence of infectious progeny virus, supernatants from these cultures were inoculated onto fresh MDBK cells, followed by IFA for viral antigens at 72 h post-infection (pi). Again, viral antigens were detected in inoculated cells, thus confirming the presence of infectious virus in the supernatant of transfected cells. The viruses recovered from transfected cells were designated chi-NADL/ IBSP4ncpGluc#3 and #4, respectively, at passage #0 (p0). Taken together, these results demonstrated that RNA transcribed in vitro from the recombinant cDNA clones containing the Gluc gene was infectious upon transfection, supporting genome translation and replication and leading to production of progeny virus. In addition, genome translation resulted in expression of viable and biologically active Gaussia luciferase (not shown).

3.3. Stability of Gluc-expressing viruses in cell culture We next investigated the stability of the rescued viruses chiNADL/IBSP4ncpGluc#3 and #4 upon passages in cell culture. Supernatants collected from transfected cells (p0) were submitted to 15 successive passages in MDBK cells. Passages were performed every 72 h; cells were monitored for BVDV antigens by IFA at the end of each passage. Viral RNA extracted from selected passages was submitted to RT-PCR amplification for monitoring the presence of the reporter gene. The rescued virus obtained from the parental clone (chi-NADL/IBSP4ncp#2) was used as control. Infectivity of both viruses (chi-NADL/IBSP4ncpGluc#3 and #4) was maintained for at least 15 passages, as demonstrated by a high percentage of antigen-positive cells detected at each passage (Fig. 2). Amplification of the genomic region corresponding to the inserted sequences confirmed the presence of cloned genes at different passages (Fig. 3). Thus, viruses rescued from RNA transcribed from the recombinant cDNA clones containing the Gluc gene were infectious and remained stable for at least 15 passages in cultured cells. These results demonstrate that introduction of 555 bp of the Gaussia luciferase gene (plus the linker and FMDV2Apro) between Npro and Core genes did not affect the replication properties of the viruses.

Chi-NADL/IBSP4ncp#2

Chi-NADL/IBSP4ncpGluc#3

MDBK mock-infected

Chi-NADL/IBSP4ncpGluc#4

p1

p5

p10

p15

Fig. 2. Infectivity of viruses rescued from the recombinant clones expressing Gluc determined by IFA performed on MDBK cells inoculated with the parental virus chiNADL/IBSP4ncp#2 and viruses rescued from the recombinant clones chi-NADL/ IBSP4ncpGluc#3 and #4 in different passage number (indicated by letter p). Magnification bars: 25 μm.

3.4. Expression of Gaussia luciferase by the recombinant viruses We next examined the expression of Gaussia luciferase by the recombinant viruses at different passages in cell culture. For this, supernatants of MDBK cells infected with rescued viruses chi-NADL/ IBSP4ncpGluc#3 and #4 and the virus rescued from the parental clone chi-NADL/IBSP4ncp#2 harvested at passages p1, p5, p10 and p15 were submitted to Gluc assay as described. As shown in Fig. 4, Gluc activity in the supernatant was maintained almost steadily along these passages, with an average increase of approximately 4.5 × 105 RLU compared to the negative control (1.5 × 103 RLU). These data indicate that the reporter Gluc gene was correctly expressed and

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

p1 M

1

p5 2

3

p15 4

5

6

7

8

M

1Kb 0.5Kb

Fig. 3. Monitoring of stability of rescued viruses chi-NADL/IBSP4ncpGluc#3 and #4 in different passages. Products of RT-PCR using oligos 757F and 1137R. Lanes 1, 3 and 5 correspond to chi-NADL/IBSP4ncpGluc#3; lanes 2, 4 and 6 correspond to NADL/ IBSP4ncpGluc#4. Lane 7 corresponds to the parental virus chi-NADL/IBSP4ncp#2 and lane 8 to the negative control. M: molecular weight marker, 1 Kb DNA ladder (New England BioLabs).

processed in a stable fashion as indicated by enzyme activity detected in culture supernatants along the passages. 3.5. Characterization of rescued viruses expressing the Gluc gene 3.5.1. Replication kinetics We next investigated the kinetics of replication of chi-NADL/ IBSP4ncpGluc#3 and #4 at p5, using the parental virus chi-NADL/ IBSP4ncp#2 as control. Confluent MDBK monolayers were inoculated with each virus at an MOI of 0.3 and culture supernatants collected at different intervals were submitted to virus quantification. Fig. 5A shows that the Gluc-expressing recombinant viruses replicated to similar levels and with kinetics undistinguishable from that of the parental rescued virus. All viruses reached maximum titers of approximately 6.5 logs at 48 h pi; titers were maintained at steady levels thereafter. Thus, the introduction and expression of Gluc gene by the recombinant viral genomes apparently did not affect the growth kinetics and efficiency of replication in vitro.

4e+05 3e+05 0e+00

1e+05

2e+05

Relative Light Units

5e+05

6e+05

chi-NADL/IBSP4ncpGluc#3 chi-NADL/IBSP4ncpGluc#4 Negative control

1

5

10

15

Passage number Fig. 4. Gaussia luciferase activity on the supernatant of MDBK cells inoculated with viruses recovered from recombinant clones at passages p1, p5, p10 and p15. Gluc activity is expressed as RLU. Negative control (supernatant of mock-infected cells). Each value is the mean of two independent experiments.

445

3.5.2. Gaussia luciferase activity The same experiment was used for determining the curve of Gluc expression accompanying virus replication. Culture supernatants were collected at different intervals and assayed for Gluc activity as described. Gluc activity was initially detected at 16 h pi (around 1.5 × 104 RLU), coinciding with the first peak of virus replication (Fig. 5B). After 16 h, Gluc activity showed a steady increase reaching maximum levels at 72 h (4.15 × 105 RLU). The time of the peak of Gluc activity did not correlate with the peak in virus titer (48 h), probably due to the progressive accumulation and stability of active Gluc in the supernatant. At 64 h pi, Gluc activity reached intermediate values of approximately 3.1 × 105 RLU. At 72 h pi, virus titers showed a slight reduction coinciding with an increase in Gluc activity, reaching values of approximately 4.15 × 105 RLU. This probably occurred due to cellular stress, characterized by cytoplasmic vacuolation, leading to a reduction in virus titers and increase in Gluc activity. 3.5.3. Focus size and morphology We next investigated the morphology and size of infectious foci produced in MDBK cells by chi-NADL/IBSP4ncpGluc#3 and #4 comparing with the rescued parental virus. As these are non-cytopathic viruses, viral foci were visualized by immunoperoxidase staining (IPX) of cell monolayers at 72 h. As shown in Fig. 6, the size and morphology of infected foci produced by the chimeric recombinant viruses expressing Gluc were undistinguishable from those produced by the parental rescued virus. Thus, the introduction of the 555 bp of Gluc gene plus the linker sequence and FMDV2Apro gene, which ensued Gluc expression, had no apparent effect on the replication efficiency of the recombinant viruses as determined by the size and morphology of infectious foci produced in MDBK cell monolayers. 3.5.4. Genome sequencing As demonstrated above, chi-NADL/IBSP4Gluc#3 and #4 maintained the main replication properties of the parental virus. Likewise, Gluc expression was maintained for at least fifteen passages in cell culture. Nevertheless, we wanted to investigate possible mutations in the viral genome acquired during the passages in cell culture. Therefore, the genomes of viruses chi-NADL/IBSP4ncp#2 and chiNADL/IBSP4ncpGluc#3 were submitted to nucleotide sequencing at passage 0 (rescued virus) and 5. At passage 0, no nucleotide changes were identified (not shown). At passage 5, as presented in Table 2, nine nucleotide changes were identified in the genome of chiNADL/IBSP4ncpGluc#3. From these, three resulted in an amino acid change (Glu2602Lys, in E2; Ser3940Pro and Lys4447Glu in NS2-3). All other nucleotide changes were silent and distributed across the genome (one in NS2-3 and NS4B; three in NS5A and one in NS5B). No mutations were observed in the inserted Gluc gene or in the FMDV2Apro sequence. Thus, we hypothesize that these mutations may somehow favor a structural adaptation of the genome concerning the secondary structure, to the inserted gene, allowing for the maintenance of both (insert and viral genome) without affecting the replication efficiency. In a previous study of the parental virus chi-NADL/IBSP4ncp#2, six mutations were detected at passage 5 (Arenhart et al., submitted for publication). Five nucleotide changes were found in the Npro gene. Four of those did not result in amino acid substitution (Ala439Ala, Asn463Asn, Val499Val and Ala514Ala) and one resulted in amino acid change (Glu550Asp). One mutation was detected in the NS5B gene (Ser12079Asn). Nevertheless, there were no phenotypic changes in the infectious clone in vitro. 3.5.5. Stability of cDNA clones in E. coli To assess the stability in bacteria of the recombinant cDNA clones expressing Gluc, clones IC-pBSC_IBSP4ncpGluc#3 and #4 were amplified in E. coli. Then, plasmid DNA was extracted from bacterial

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

7

5e+05

446

B

4e+05

6

A

2e+05

3e+05

Relative Light Units

4 3 1

1e+05

2

Virus titer (log10 PFU/mL)

5

chi-NADL/IBSP4ncpGluc#3 chi-NADL/IBSP4ncpGluc#4 Negative control

0

8

16

24

32

40

48

56

64

0e+00

0

chi-NADL/IBSP4ncp chi-NADL/IBSP4ncpGluc#3 chi-NADL/IBSP4ncpGluc#4 72

0

8

16

24

32

40

48

56

64

72

Hours post inoculation

Hours post inoculation

Fig. 5. Kinetics of replication and Gluc expression by rescued viruses. (A) Replication curve of viruses chi-NADL/IBSP4ncpGluc#3, chi-NADL/IBSP4ncpGluc#4 and parental virus chi-NADL/IBSP4ncp (#2). MDBK cells were inoculated with the respective viruses at an MOI of 0.3. At indicated times, supernatants were collected and submitted to virus quantification by plaque assay. Titers are expressed as log10 PFU/mL. (B) Curve of Gluc activity on the supernatant of infected cells. At the times indicated, aliquots of the supernatants were collected and submitted to a Gluc assay. Gluc activity is expressed as RLU. Negative control (supernatant of mock-infected cells). Each value represents the mean of two independent experiments.

pellets and used as template for PCR. The resulting amplicons were submitted to in vitro transcription and the transcribed RNA was electroporated onto MDBK cells. The RNA transcribed from these amplicons was infectious upon transfection into MDBK cells, as dem-

A

B

onstrated by detection of viral proteins by IFA and recovery of infectious virus in the cell supernatants (Fig. 7). Progeny virus was then submitted to five passages in MDBK cells to investigate viral infectivity and Gluc expression. As shown in Fig. 7A, viruses rescued from clones amplified in E. coli maintained their replication efficiency in cell culture up to the fifth passage. Likewise, Gluc expression was maintained stable for at least five passages in cell culture (Fig. 7B). Thus, the recombinant cDNA clones produced by homologous recombination in yeast are stable in E. coli, what allows for their amplification and/or maintenance in this host without losing the genome integrity and functionality. Virus replication and reporter gene expression were maintained apparently unaltered. 4. Discussion We herein describe the construction and characterization of a recombinant BVDV cDNA clone expressing the Gaussia luciferase

C

D

Fig. 6. Morphology of infectious foci produced by Gluc-expressing BVDV viruses in MDBK cells at passage 5 (p5). (A) and (B) MDBK cells inoculated with rescued viruses chi-NADL/IBSP4ncpGluc#3 and #4, respectively. (C) Positive control (MDBK cells inoculated with the parental virus chi-NADL/IBSP4ncp#2). (D) Negative control (mockinfected MDBK cells). Cell monolayers were inoculated with virus dilutions (10−1– 10−7), agarose overlaid, fixed at 72 h and submitted to IPX staining for viral antigens.

Table 2 Sequence analysis of the rescued virus expressing Gaussia luciferase compared to the parental rescued virus at passage five. Genome region

Nta position

chi-NADL/IBSP4ncp#2

chi-NADL/IBSP4ncpGluc#3

Nucleotide

Amino acid

Nucleotide

Amino acid

E2 NS2-3 NS2-3 NS2-3 NS4B NS5A NS5A NS5A NS5B

2602 3940 4447 6492 8289 8610 9363 9369 9963

G T A A T T T G C

Glu Ser Lys Val Tyr Gly Ile Phe Thr

A C G G C C C A T

Lysb Prob Glub Valc Tyrc Glyc Ilec Phec Thrc

a b c

Nucleotide position based on the IBSP4ncp genome. Amino acid from different chemical group. Silent mutation.

chi-NADL/IBSP4ncpGluc#3 chi-NADL/IBSP4ncpGluc#4 Negative control

A

447

B iii

ii

iv

3e+05

4e+05

i

0e+00

1e+05

2e+05

Raw Luciferase Unit

5e+05

6e+05

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

1

5 Passage number

Fig. 7. Stability of rescued viruses recovered from plasmid DNA amplified in bacteria. (A) Gaussia luciferase activity on the supernatant of MDBK cells inoculated with rescued viruses at passages (p1 and p5), expressed as RLU. (B) Viral infectivity monitored by IFA performed on MDBK cells inoculated with viruses at different passages. (i) Positive control – cells infected with the parental virus IBSP4ncp. (ii) Negative control – mock-infected MDBK cells. (iii and iv) Rescued viruses chi-NADL/IBSP4ncpGluc# 3 and #4, respectively, at passage p5. Magnification bars: 25 μm.

(Gluc) gene by homologous recombination in yeast. Insertion of the Gluc gene between Npro and Core protein genes, along with a linker and FMDV2Apro gene led to efficient and stable expression of the reporter gene without adversely affecting the replication of the recombinant viruses. The rescued viruses were stable for at least 15 passages in cell culture, maintaining the replication kinetics, focus size and morphology similar to those of the parental virus. Likewise, stable expression and correct processing of the reporter protein were maintained over the passages. These results demonstrate that genes up to 555 bp may be introduced between Npro and Core genes of BVDV genome. Along with the ease of manipulating this cDNA clone by homologous recombination in yeast, these results are promising toward using this strategy to manipulate the BVDV genome to answer specific issues of pestivirus biology. A number of BVDV cDNA clones have been constructed, using different strains of both genotypes and biotypes (Dehan et al., 2005; Kümmerer and Meyers, 2000; Meyer et al., 2002; Rasmussen et al., 2010; Vassilev et al., 1997). Manipulation of the viral genome in vitro has allowed the investigation of several aspects of the viral replication cycle, pathogenesis and evasion of the immune response (Dehan et al., 2005; Fan and Bird, 2008b; Gil et al., 2006; Harding et al., 2002; Henningson et al., 2009; Meyers et al., 2007; Reimann et al., 2003) and for development of experimental vaccine strategies (Reimann et al., 2004; Vassilev et al., 2001). Most recombinant clones were constructed by the classical method based on the assembly of full genome length cDNA in bacterial plasmid vectors (Rice et al., 1987). The instability of full-length BVDV cDNA in bacterial hosts has been partially overcome by the use of low copy number plasmids, but mutations in the viral genome were still observed after a few passages in bacteria (Mendez et al., 1998; Meyers et al., 1996). More recently, the bacterial artificial chromosome (BAC) strategy was used to generate a full-length cDNA copy of the BVDV SD-1 strain (Fan and Bird, 2008a, 2008b). Homologous recombination in S. cerevisiae has been used as a method for the construction of cDNA clones of different viruses. Multiple DNA fragments containing nucleotide sequence comple-

mentary to the vector at their ends may be correctly assembled in vivo in a unique molecule (Gibson, 2009; Gibson et al., 2008). This strategy presents several advantages over traditional cloning methods: it does not depend on multiple restriction sites, permits the introduction of mutations and allows the use of many amplification products. Additionally, several fragments can be assembled at once, making it less laborious than traditional cloning strategies (Gibson, 2009; Gibson et al., 2008; Joska et al., 2014; Oldenburg et al., 1997; Shanks et al., 2009). Among other applications, this eukaryotic system has successfully overcome the problems of instability of some flavivirus recombinant cDNA genomes in E. coli (Polo et al., 1997; Puri et al., 2000). As a tool to address selected issues of BVDV biology, especially the biology of persistent infection, we constructed a chimeric recombinant cDNA clone containing the ORF of a Brazilian strain (IBSP4ncp) flanked by 5′ and 3′-UTRs of the reference strain NADL. The full-length genome cDNA clone was assembled in a low copy number plasmid by homologous recombination in yeast (Arenhart et al., submitted for publication). The viruses rescued from the cDNA clone were stable upon successive passages in cell culture and maintained most biological properties of the parental strain, including kinetics of replication and focus size and morphology. The present study extended these observations, demonstrating that the recombinant clone IC-pBSC_IBSP4ncp#2 is easily manipulated by recombination in yeast and that the recombinant BVDV genome supports the insertion and expression of foreign genes between genes Npro and Core. Thus, the strategy of homologous recombination in S. cerevisiae seems a suitable methodology for the assembly of flavivirus genomes as cDNA clones. Gaussia luciferase (Gluc) is the smallest known luciferase (185 aa and 19 kDa). Originally cloned from the sea Copepode G. princeps, Gluc is naturally secreted and emits high amounts of light, facilitating its detection (Tannous et al., 2004). In addition, the small sequence size (555 bp) probably results in minor structural secondary changes in the genomic RNA, thus allowing for higher stability. Additional advantages of Gluc as a reporter gene include its stability

448

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

in cell culture, pH and temperature resistance, and possibility of storage for long periods (Roda et al., 2009; Tannous et al., 2004). Fan et al. (2008) previously reported the insertion of the eGFP2A gene between Npro and Core protein genes of the ncp BVDV SD-1 clone in E. coli. However, during the construction and manipulation of this clone, the rescued virus deleted part of the foreign gene and could only be entirely rescued after the appearance of two adaptative mutations (A1625G and A1626G) in the heterologous gene. These mutations were subsequently introduced to confirm their need to ensure the stability of the viral genome harboring the foreign sequence. In our strategy, the entire Npro sequence was reconstructed to allow for its autoprotease activity, which would cleave the protein at the COOH-end. In addition, PCR segment 2 used in the construction contained the Gluc gene adjacently linked the FMDV2Apro region, which possesses autoprotease activity at its NH-2 terminus (Ryan and Drew, 1994). Thus, the presence of these proteases flanking the reporter gene would allow for efficient cleavage and release of the nascent reporter protein, followed by protein secretion directed by an internal signal. The strategy proved to be adequate as it led to stable expression and processing of the reporter gene for at least 15 passages in cell culture. In addition, the presence of foreign sequences (Gluc gene + linker + FMDV2Apro gene) had no adverse effects on the replication of the recombinant viruses. As demonstrated above, chi-NADL/IBSP4Gluc#3 and #4 maintained virtually unaltered the main replication properties of the parental virus. Likewise, Gluc expression was stably maintained for at least fifteen passages in cell culture. Nevertheless, the chi-NADL/ IBSP4ncpGluc#3 genome acquired nine nucleotide changes across the genome detected at passage 5: six silent mutations and three resulting in amino acid changes in E2 and NS2-3 genes. No mutations were observed in the inserted Gluc gene or in the FMDV2Apro sequence. Thus, we hypothesize that these mutations may somehow favor a structural adaptation of the genome concerning the secondary structure, to the inserted gene, allowing for the maintenance of both (insert and viral genome) without affecting the replication efficiency. In any case, the nucleotide changes did not result in a protein change or influence the viral phenotype. During the characterization of the parental rescue virus chiNADL/IBSP4ncp#2, a few mutations in the first ORF-encoded protein Npro were detected (Arenhart et al., submitted for publication). Four nucleotides changes did not result an amino acid substitution (Ala439Ala, Asn463Asn, Val499Val and Ala514Ala). One nucleotide change resulted in substitutions by amino acids of the same chemical group (Glu550Asp). In the NS5B gene, one additional mutation (Ser12079Asn) was detected, with substitution by an amino acid of a different chemical group. It was hypothesized that these mutations, concentrated in the 5′ third of the Npro gene, were possibly associated with the replacement of the original IBSP4ncp 5′UTR by the NADL 5′-UTR as the 5′ terminal sequence of Npro gene is believed to play a role in replication of the BVDV genome (Becher et al., 2000; Behrens et al., 1998; Myers et al., 2001). In any case, the nucleotide changes observed in the parental rescued virus and in the genome of virus expressing the Gluc gene apparently had no effect on viral phenotype and were likely associated with genome adaptation to the new, heterologous sequences. In summary, we report the insertion and stable expression of Gluc gene between Npro and Core genes of the genome of a recombinant BVDV cDNA clone. The reporter gene was correctly expressed and processed by the recombinant viruses for at least 15 passages in cell culture and the presence of foreign sequences had no apparent effect on the main biological properties of the viruses in vitro. Along with the ease of manipulating this cDNA clone by homologous recombination in yeast, these results are promising toward using this strategy to express foreign genes to address selection of BVDV biology and pathogenesis.

References Baker J.C., 1995. The clinical manifestations of bovine viral diarrhea infection. Vet. Clin. North Am. 11 (3), 425-445. Becher, P., Orlich, M., Thiel, H.-J., 2000. Mutations in the 5′ nontranslated region of bovine viral diarrhea virus result in altered growth characteristics. Journal of Virology 74, 7884–7894. Behrens, S.-E., Grassmann, C.W., Thiel, H.-J., Meyers, G., Tautz, N., 1998. Characterization of an autonomous subgenomic pestivirus RNA replicon. Journal of Virology 72, 2364–2372. Bolin, S.R., Grooms, D.L., 2004. Origination and consequences of bovine viral diarrhea virus diversity. The Veterinary Clinics of North America 20, 51–68. Collett, M.S., Larson, R., Belzer, S.K., Retzel, E., 1988. Proteins encoded by bovine viral diarrhea virus: the genomic organization of a pestivirus. Virology 165, 200–208. Corapi, W.V., French, T.W., Dubovi, E.J., 1989. Severe thrombocytopenia in young calves experimentally infected with noncytopathic bovine viral diarrhea virus. Journal of Virology 63, 3934–3943. Dehan, P., Couvreur, B., Hamers, C., Lewalle, P., Thiry, E., Kerkhofs, P., et al., 2005. Point mutations in an infectious bovine viral diarrhoea virus type 2 cDNA transcript that yields an attenuated and protective viral progeny. Vaccine 23, 4236– 4246. Donis, R.O., 1995. Molecular biology of bovine viral diarrhea virus and its interactions with the host. The Veterinary Clinics of North America 11, 393–423. Fan, Z.C., Bird, R.C., 2008a. An improved reverse genetics systems for generation of bovine viral diarrhea virus as a BAC cDNA. Journal of Virological Methods 149, 309–315. Fan, Z.C., Bird, R.C., 2008b. Generation and characterization of an Npro-disrupted marker bovine viral diarrhea virus derived from a BAC cDNA. Journal of Virological Methods 151, 257–263. Fan, Z.C., Dennis, J.C., Bird, R.C., 2008. Bovine viral diarrhea virus is a suitable vector for stable expression of heterologous gene when inserted between Npro and C genes. Virus Research 138, 97–104. Finley, R.L., Brent, R., 1994. Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators. Proceedings of the National Academy of Sciences 91, 12980–12984. Gibson, D.G., 2009. Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides. Nucleic Acids Research 37, 6984–6990. Gibson, D.G., Benders, G.A., Axelrod, K.C., Zaveri, J., Algire, M.A., Moodie, M., et al., 2008. One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic genome. Proceedings of the National Academy of Sciences 105, 20404–20409. Gil, L.H.V.G., Ansari, I.H., Vassilev, V.B., Liang, D., Lai, V.C.H., Zhong, W., et al., 2006. The amino terminal domain of bovine viral diarrhea virus Npro protein is necessary for alpha/beta interferon antagonism. Journal of Virology 80, 900–911. Gillespie, J., Baker, L., McEntee, K., 1960. A cytopathogenic strain of virus diarrhea virus. The Cornell Veterinarian 50, 73–79. Harding, M.J., Cao, X., Shams, H., Johnson, A.F., Vassilev, V.B., Gil, L.H.V.G., et al., 2002. Role of bovine viral diarrhea virus biotype in the establishment of fetal infections. American Journal of Veterinary Research 63, 1455–1463. Henningson, J.N., Topliff, C.L., Gil, L.H.V., Donis, R.O., Steffen, D.J., Charleston, B., et al., 2009. Effect of the viral protein Npro on virulence of bovine viral diarrhea virus and induction of interferon type I in calves. American Journal of Veterinary Research 70, 1117–1123. Joska, T.M., Mashruwala, A., Boyd, J.M., Belden, W.J., 2014. A universal cloning method based on yeast homologous recombination that is simple, efficient, and versatile. Journal of Microbiological Methods 100, 46–51. Kümmerer, B.M., Meyers, G., 2000. Correlation between point mutations in NS2 and the viability and cytopathogenicity of bovine viral diarrhea virus strain Oregon analyzed with an infectious cDNA clone. Journal of Virology 74, 390–400. Lindenbach, B.D., Rice, C.M., 2001. Flaviviridae: the viruses and their replication. In: Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, Lippincott Williams & Wilkins, Philadelphia, pp. 991–1042. McClurkin, A.W., Littledike, E.T., Cutlip, R.C., Frank, G.H., Coria, M.F., Bolin, S.R., 1984. Production of cattle immunotolerant to BVD virus. Canadian Journal of Comparative Medicine 48, 156–161. Mendez, E., Ruggli, N., Collett, M.S., Rice, C., 1998. Infectious bovine viral diarrhea virus (strain NADL) RNA from stable cDNA: a cellular insert determines NS3 production and viral cytopathogenicity. Journal of Virology 72, 4737–4745. Meyer, C., Von Freyburg, M., Elbers, K., Meyers, G., 2002. Recovery of a virulent and RNAse-negative attenuated type 2 bovine viral diarrhea viruses from infectious cDNA clones. Journal of Virology 76, 8494–8503. Meyers, G., Tautz, N., Becher, P., Thiel, H.-J., Kümmerer, B.M., 1996. Recovery of cytopathogenic and noncytopathogenic bovine viral diarrhea viruses from cDNA constructs. Journal of Virology 70, 8606–8613. Meyers, G., Ege, A., Fetzer, C., Von Freyburg, M., Elbers, K., Carr, V., et al., 2007. Bovine viral diarrhea virus: prevention of persistent fetal infection by a combination of two mutations affecting Erns RNAse and Npro protease. Journal of Virology 81, 3327–3338. Moormann, R.J.M., Van Gennip, H.G.P., Miedema, G.K.W., Hulst, M.M., Van Rijn, P.A., 1996. Infectious RNA transcribed from an engineered full-length cDNA template of the genome of a pestivirus. Journal of Virology 70, 763–770. Myers, T.M., Kolupaeva, V.G., Mendez, E., Baginski, S.G., Frolov, I., Hellen, C.U.T., et al., 2001. Efficient translation initiation is required for replication of bovine viral diarrhea virus subgenomic replicons. Journal of Virology 75, 4226–4238.

S. Arenhart et al./Research in Veterinary Science 97 (2014) 440–449

Oldenburg, K.R., Vo, K.T., Michaelis, S., Paddon, C., 1997. Recombination-mediated PCR-directed plasmid construction in vivo in yeast. Nucleic Acids Research 25, 451–452. Polo, S., Ketner, G., Levis, R., Falgout, B.G., 1997. Infectious RNA transcripts from full-length dengue virus type 2 cDNA clones made in yeast. Journal of Virology 71, 5366–5374. Puri, B., Polo, S., Hayes, C.G., Falgout, B., 2000. Construction of a full-length infectious clone for dengue-1 virus Western Pacific, 74 strain. Virus Genes 20, 57–63. Qu, L., MacMullan, L.K., Rice, C.M., 2001. Isolation and characterization of noncytopathic pestivirus mutants reveals a role for nonstructural protein NS4B in viral cytopathogenicity. Journal of Virology 75, 10651–10662. Rasmussen, T.B., Reimann, I., Uttenthal, A., Leifer, I., Depner, K., Schirmeier, H., et al., 2010. Generation of recombinant pestiviruses using a full-genome amplification strategy. Veterinary Microbiology 142, 13–17. Reimann, I., Meyers, G., Beer, M., 2003. Trans-complementation of autonomously replicating bovine viral diarrhea virus replicons with deletions in the E2 coding region. Virology 307, 213–227. Reimann, I., Depner, K., Trapp, S., Beer, M., 2004. An avirulent chimeric pestivirus with altered cell tropism protects pigs against lethal infection with classical swine fever virus. Virology 322, 143–157. Rice, C.M., Levis, R., Strauss, J.H., Huang, H.V., 1987. Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker, and in vitro mutagenesis to generate defined mutants. Journal of Virology 61, 3809–3819. Ridpath, J.F., 2005. Practical significance of heterogeneity among BVDV strains: impact of biotype and genotype on U.S. control programs. Preventive Veterinary Medicine 72, 17–30.

449

Ridpath, J.F., 2010. Bovine viral diarrhea virus: global status. The Veterinary Clinics of North America 26, 105–121. Roda, A., Guardigli, M., Michelini, E., Mirasoli, M., 2009. Bioluminescence in analytical chemistry and in vivo imaging. Trends in Analytical Chemistry 28, 307– 322. Ryan, M.D., Drew, J., 1994. Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein. The EMBO Journal 13, 928–933. Sambrook, J., Russel, D.W., 2001. Molecular Cloning: A Laboratory Manual, vol. 2. Cold Spring Harbor Laboratory Press, New York. Shanks, R.M.Q., Kadouri, D.E., MacEachran, D.P., O’Toole, G.A., 2009. New yeast recombineering tools for bacteria. Plasmid 62, 88–97. Tannous, B.A., Kim, D.-E., Fernandez, J.L., Weissleder, R., Breakefield, X.O., 2004. Codon optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Molecular Therapy 11, 435–443. Tautz, N., Thiel, H.-J., Dubovi, E.J., Meyers, G., 1994. Pathogenesis of mucosal disease: a cytopathogenic pestivirus generated by an internal deletion. Journal of Virology 68, 3289–3297. Van den Hoff, M.J.B., Moormann, A.F.M., Lamers, W.H., 1992. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Research 20, 2902. Vassilev, V.B., Collet, M.S., Donis, R.O., 1997. Authentic and chimeric full-length genomic cDNA clones of bovine viral diarrhea virus that yield infectious transcripts. Journal of Virology 71, 471–478. Vassilev, V.B., Gil, L.H.V.G., Donis, R.O., 2001. Microparticle-mediated RNA immunization against bovine viral diarrhea virus. Vaccine 19, 2012–2019.