MECHANISMS
MICROBIAL DRUG RESISTANCE Volume 00, Number 00, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/mdr.2014.0004
Insertion Sequence Transposition Determines Imipenem Resistance in Acinetobacter baumannii Han-Yueh Kuo,1,2,* Kai-Chih Chang,3,* Chih-Chin Liu,4,5 Chuan Yi Tang,5,6 Jhih-Hua Peng,3 Chia-Wei Lu,6 Chi-Chao Tu,7,8 and Ming-Li Liou 5,8,*
This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenemsusceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.
position of this insertion sequence may play an important role in enhancing the spread of resistance and virulence traits.15 Despite whole-genome sequence of A. baumannii after tigecycline exposure has been already published,8 a genomewide assessment of recombination upon exposure to carbapenem in A. baumannii has yet to be reported. A. baumannii can rapidly alter its genome to evade both natural host defense mechanisms and antibiotic intervention.6,21 Snitkin et al.21 reported that genomewide recombination improved the diversification of epidemic strains of A. baumannii, resulting in polyclonal outbreaks. A study of representative A. baumannii genomes highlighted a propensity for horizontal gene transfer, with large genomic islands enriched in transposons and antibiotic resistance determinants.6,12 Another study conducted to discern determinates of antibiotic resistance in A. baumannii revealed highly dynamic resistance gene repertoires even in closely related isolates.1 Thus, the plasticity of the A. baumannii
Introduction
C
arbapenem resistance in Acinetobacter baumannii (CRAB) is increasingly reported and has become a global public health concern.18 This phenotypic observation is likely mediated by changes in porin proteins, modification of penicillin-binding proteins, and the acquisition of a class B or class D b-lactamase.14 Recently, several reports suggested that high-level carbapenem resistance due to the expression of genes encoding class D b-lactamase requires a strong promoter, such as that provided by the mobile insertion sequence ISAba1.5,22 Additionally, ours and other studies showed that most of the CRAB strains contain ISAbal adjacent to blaOXA.11,22 Although ISAbal is widely distributed across most of the clinical A. baumannii isolates, ISAbal adjacent to blaOXA is mostly restricted to CRAB rather than CSAB, implying that carbapenem resistance may be mediated by genetic recombination. Clearly, the trans1
Department of Medicine, National Taiwan University Hospital Hsin-Chu Branch, Hsin-Chu City, Taiwan. School of Medicine, National Taiwan University, Taipei City, Taiwan. 3 Department of Laboratory Medicine and Biotechnology, Tzu Chi University, Hualien City, Taiwan. 4 Department of Bioinformatics, Chung Hua University, Hsin-Chu City, Taiwan. 5 Department of Computer Science and Information Engineering, Providence University, Taichung County, Taiwan. 6 Department of Computer Science, National Tsing Hua University, Hsin-Chu City, Taiwan. 7 Medical Laboratory, Keelung Hospital Ministry of Health and Welfare, Keelung city, Taiwan. 8 Department of Medical Laboratory Science and Biotechnology, Yuanpei University, Hsin-Chu City, Taiwan. *These authors contributed equally to this work. 2
1
2
KUO ET AL.
genome may be regarded as the capacity of this organism to survive and adapt in the environment. In this study, we report the results of whole genome sequencing of imipenem-selected A. baumannii (ATCC 17978), and further develop an understanding of the mechanism(s) by which imipenem exposure may initiate insertion sequence transposition, resulting in antibiotic resistance in A. baumannii.
was performed at the Beijing Genomics Institute in Shenzhen, China. Contigs were determined using the CLC Genomics Workbench (version 6.0.5; CLC bio, Cambridge, MA). The order of the contigs was predicted from the chromosome sequences of A. baumannii ATCC 17978 (GenBank accession number CP000521).
Materials and Methods
The in silico analysis of genomes was performed by BLAST search (blastn) using the contigs and the A. baumannii ATCC 17978 sequence; mutants were determined from these BLAST results. PCR confirmation of genetic recombination between A1S_0676 and A1S_1517 was carried out using primers (A1S_0676 FP and A1S_1517 RP) designed to anneal around the recombination region.
Bacterial strains
A. baumannii reference strain ATCC 17978 was purchased from Bioresource Collection and Research Center (Hsin-Chu, Taiwan). Resistance to imipenem in the parental strain A. baumannii ATCC 17978 was generated according to the procedures described by Kuo et al.9 Imipenem-selected strains were exposed to 0.5, 1, 2, 4, and 8 mg/L imipenem and were collected during the induction period, as shown in Table 1. The genotypic patterns in the selected mutants and their parental strain were determined by pulsed-field gel electrophoresis (PFGE), as previously described.10 Antimicrobial susceptibilities
The susceptibilities of the Acinetobacter mutants and their parental strain to antimicrobial agents were determined by the microdilution method, in accordance with the guidelines of the Clinical and Laboratory Standards Institute.23 The agents tested included ampicillin/sulbactam, ceftazidime, cefepime, amikacin, ciprofloxacin, trimethoprim/sulfamethoxazole, imipenem, and meropenem. Escherichia coli strain ATCC 25922 and Pseudomonas aeruginosa strain ATCC 27853 were used as reference controls for the susceptibility testing. A fourfold or greater induction in the minimum inhibitory concentration (MIC) values after exposure to imipenem was considered significantly different from control. DNA sequencing and assembly
The genomic DNA of A. baumannii IPM-32m strain was prepared using Wizard genomic DNA purification kits (Promega, Madison, WI) according to the manufacturer’s instructions. The Illumina HiSeq 2000 platform sequencing
Genomic analysis and PCR confirmation
Reverse transcriptase-quantitative PCR
Gene expression was analyzed using a previously described method.9 Briefly, total RNA was isolated from 1 · 109 Acinetobacter baumannii cells. DNase treatment of RNA samples, cDNA synthesis, and reverse transcriptasequantitative PCR were carried out as described previously.9 Template cDNA was diluted 1:100 and 2.5 ml was added to SYBR green PCR master mix (Applied Biosystems, Foster City, CA) for each reaction. An ABI Prism 7000 instrument (Applied Biosystems) was used for analysis. Internal forward and reverse primers for each gene were designed using PrimerExpress (Applied Biosystems). Experiments were repeated with three independent experiments. Normalization to the 16S ribosomal gene allowed calculation of the fold change by the threshold cycle (CT) method.13 Statistical analysis
The differences in expression of the blaOXA-95 genes between the resistant mutants and their parental strains were analyzed by the Student’s t-test, as appropriate. The differences between two groups of isolates were considered significant at the p < 0.05 level. The data entry and analyses were performed using the Statistical Package for the Social Sciences (SPSS) software version 15.0 (SPSS, Inc., Chicago, IL).
Table 1. Bacterial Strains and Primers Used in This Study Strains or primers
Relevant characteristic(s), description, or sequence
Strain 17978 19606 IPM-2m IPM-4m IPM-8m IPM-16m IPM-32m Primers A1S_0676F A1S_1517R A1S_1517qF A1S_1517qR 16S rRNA qF 16S rRNA qR
Type strain Type strain 17978 strain selected with 0.5 mg/L imipenem 17978 strain selected with 1 mg/L imipenem 17978 strain selected with 2 mg/L imipenem 17978 strain selected with 4 mg/L imipenem 17978 strain selected with 8 mg/L imipenem 5¢ to 3¢ AATGATTGGTGACAATGAAG TGGATTGCACTTCATCTTGG ATGGCAATGCAGATATCGGTAC; q-PCR TGGATTGCACTTCATCTTGGAC; q-PCR CAGCTCGTGTCGTGAGATGT; q-PCR CGTAAGGGCCATGATGACTT; q-PCR
Source ATCC 17978 ATCC 19606 This study This study This study This study This study This This This This This This
study study study study study study
IS TRANSPOSITION DETERMINES IMIPENEM RESISTANCE
3
testing for these mutants and their parental strain is shown in Table 2. The reference strain 17978 was susceptible to all the antibiotics tested. The MICs to meropenem and imipenem were fourfold higher in the ATCC 17978 mutants when they were gradually exposed to imipenem concentrations ranging from 0.5 to 8 mg/L. Meanwhile, the MICs for imipenem-selected mutants were still susceptible to the other antibiotics. Translocation of ISAba1 upstream of blaOXA-95 in imipenem-selected mutants
Ten genes that originated from two regions in the parental chromosome were rearranged in order in the AB13_1. Two gene fragments, putative transposase (A1S_0676) and transposase (A1S_0677), were reversibly inserted into the region upstream of blaOXA-95 (A1S_1517), as shown in Fig. 2A. The two gene fragments constitute the transposase of ISAba1.15 The blaOXA-95 gene belongs to the blaOXA-51 cluster, which represents the intrinsic oxacillinase of A. baumannii.2 Moreover, all the genes in the AB13_1 were present in a reverse orientation compared to the parental genome. An inverted repeat (IR) sequence is located just 7 bp upstream of the start codon of the blaOXA-95 gene. The - 35 and - 10 sequences (TTAGAA and TTATTT, respectively) were separated by 16 bp in a Pout promoter configuration and were identified at the downstream boundary of the transposition site, 39 bp upstream of the start codon of the blaOXA-95 gene. This transposition likely enhanced blaOXA-95 expression. The transposition of ISAba1 generated a 9-bp target site duplication (TSD) (AATCAAAAT), as shown in Fig. 2B. This 9-bp TSD near the IRL sequence was separated and reversibly inserted into the region downstream of blaOXA-95. The transposition of this insertion sequence was confirmed by PCR using the A1S_0676 forward primer and the A1S_1517 reverse primer. PCR fragments indicating the insertion of this sequence were detected in all the imipenem-selected mutants but, as expected, were absent from the parental strain.
FIG. 1. Comparison of the genotypic patterns in the selected mutants and their parental strain by pulsed-field gel electrophoresis. Lane 1: DNA from parental strain ATCC 17978; Lanes 2 to 6: DNA from IPM-2m, IPM-4m, IPM8m, IPM-16m, and IPM-32m derived from exposure to 0.5, 1, 2, 4, and 8 mg/L imipenem, respectively; Lane 7: DNA from the control strain ATCC 19606; Lane M: Lambda ladder PFG marker (New England Biolabs, Herts, United Kingdom). Nucleotide sequence accession number
The nucleotide sequence data of contig AB13_1 are available in the GenBank nucleotide database under accession number KF724152. Results
The expression of blaOXA-95 in imipenem-selected mutants
Susceptibility testing
Antibiotic-selected mutants were generated from the ATCC 17978 type strain. The identities of the selected mutants that originated from ATCC17978 were confirmed by PFGE, as shown in Fig. 1. The result of antibiotic susceptibility
The transcription of blaOXA-95 was analyzed by qPCR, as shown in Fig. 3. A gradual increase in blaOXA-95 expression corresponded to those mutants with progressively increased
Table 2. Susceptibility of Acinetobacter baumannii ATCC 17978 Selected with Various Concentrations of Imipenem 17978
IPM-2m
IPM-4m
IPM-8m
IPM-16m
IPM-32m
Imipenem-selected concentrations (mg/L) Antibiotics a
Imipenem Meropenema Ceftazidime Cefepime Amikacin Ciprofloxacin Ampicillin/subactam Trimethoprim/Sulfamethoxazole a
0
0.5
1
2
4
8
£ 0.25 £ 0.25 4 2 £2 £ 0.25 £2 160
1 2 4 2 £2 £ 0.25 4 160
2 8 4 2 £2 £ 0.25 4 160
‡ 16 ‡ 16 4 2 £2 £ 0.25 4 160
‡ 16 ‡ 16 4 2 £2 £ 0.25 4 160
‡ 16 ‡ 16 4 2 £2 £ 0.25 4 160
A more than fourfold induction is indicated in boldface.
4
KUO ET AL.
FIG. 2. Target site of ISAba1 in contig AB13_1. (A) Genetic recombination in contig AB13_1 and the nucleotide sequence of the insertion upstream of blaOXA-95. The - 35 and - 10 motifs of promoters are indicated. Pout is the promoter of blaOXA-95 provided by ISAba1. IRL indicates left inverted repeat sequences. (B) The orientation of direct repeat (DR) sequences of ISAba1. Arrow, the breakpoint of the 9-bp DR. resistance to imipenem. Despite fold changes in blaOXA-95 expression that ranged from 29 to 50 in the IPM-2m and IPM4m mutants, those strains were still susceptible to imipenem (Table 2 and Fig. 3). However, an approximate 200-fold increase in blaOXA-95 expression for the IPM-8m, IPM-16m, and IPM-32m strains conferred resistance to imipenem. Discussion
Carbapenem resistance in A. baumannii has become a global challenge. Most of the carbapenem-resistant A. baumannii produce carbapenemase or, more specifically, enzymes known as carbapenem-hydrolyzing class D b-lactamases (CHDLs).4 Recently, several reports have demonstrated that insertion sequences (ISs) may play important roles in resistance to antibiotics. First, ISs may enhance b-lactamase gene expression by providing promoters to drive greater gene expression.7,22 It has been shown that overexpression of
the OXA carbapenemase genes and ADC AmpC b-lactamase genes is determined mostly by the promoters present in their upstream ISAba1 element.5,11,22 ISAba2, ISAba3, and ISAba4 elements have also been found to precede the blaOXA-58 and the blaOXA-23 genes in clinical isolates of A. baumannii.3,19 Second, ISAba1-related gene disruption was also observed for other genes in carbapenem-resistant A. baumannii strains.16 Third, ISAba1 and the composite transposon, Tn2006, are capable of transposition in E. coli strains, in addition to the ability of ISAba1 to mobilize as an antibiotic resistance gene.15 In this article, we compared the genome sequences of imipenem-selected mutants and their parental strains. The results show that imipenem exposures at twice the MIC for the IPM-2m strain may initiate IS transposition in the ATCC 17978 type strain. ISAba1, which is located nearly 800 kb away from blaOXA-95 in the genome of the 17978 type strain, is present as an inverted, transposed sequence upstream of
IS TRANSPOSITION DETERMINES IMIPENEM RESISTANCE
5
tended -10 promoter in the inserted ISAba1 region.20 Nevertheless, the association between stress responses and the mechanisms of downstream gene regulation should be characterized further in the future. In conclusion, this study investigated the resistance mechanisms to imipenem in A. baumannii. Our results demonstrated that imipenem exposure (0.5 mg/L) initiated genetic recombination in A. baumannii. Transposition of ISAba1 upstream of the blaOXA-95 gene resulted in overexpression of this gene, potentially playing a critical role in imipenem resistance. Strict monitoring of the use of carbapenem in hospitals will be required to reduce the spread of carbapenem-resistant A. baumannii.
FIG. 3. Expression of blaOXA-95 from imipenem-selected mutants and their parental strain. The relative mRNA expression of blaOXA-95 is normalized to that of the 16S rRNA gene. The relative expression of blaOXA-95 in 17978 type strain is defined as 1. The fold change is defined as the expression level of blaOXA-95 in mutant strains normalized to their parental strain. Each bar represents the average value of three independent experiments, and the error bars represent the standard deviations. *p < 0.05; **p < 0.001. the blaOXA-95 gene, thereby resulting in overexpression of blaOXA-95. A previous study showed that the transposition of IS generated a 9-bp TSD.15 Our study reveals that the 9-bp TSD is reversibly inserted into the downstream region of blaOXA-95, which may be mediated by the reversible recombination of blaOXA-95. Moreover, the ISAba1/blaOXA-95 gene junction (AAGTCTT) in imipenem-selected mutants is consistent with those in clinical strains as described by Turton et al.22 Although ISAba1 sequences are commonly detected in the genomes of both carbapenem-susceptible and -resistant strains,22 the insertion of ISAba1-like sequences upstream of blaOXA is unique to a majority of CRAB isolates, suggesting that genetic recombination through IS transposition may confer resistance to carbapenem in most clinical isolates. In this report, we provide direct evidence to demonstrate genetic recombination through transposition of IS upon imipenem exposures at just twice the MIC. In addition to the contig AB13_1, the sequences of remaining contigs in the IPM-32m mutant strain are identical to those in their parental strain, suggesting that IS transposition may play a major role in the resistance to carbapenem on the genome level. Several resistance mechanisms are involved in carbapenem resistance.17 However, the contribution of each resistance gene to carbapenem resistance was previously unclear. Our study revealed that increased blaOXA-95 mRNA levels corresponded to ATCC 17978 strain isolates selected with gradually increased imipenem concentrations, suggesting that blaOXA-95 may play a critical role in the resistance to carbapenem. Additionally, our results showed that more than 200-fold increases in blaOXA-95 expression were required for resistance to imipenem. Despite the fact that overexpression of blaOXA-95 gene is predominantly driven by the promoter in the upstream ISAba1 region, gradual increases in blaOXA-95 gene expression may be modulated by additional transcriptional factors. One study of ISAba1-mediated gene regulation demonstrated that the as subunit of RNA polymerase, chief regulator of the general stress response in E. coli, may regulate downstream gene expression by binding to an ex-
Acknowledgments
The authors would like to thank the Clinical Microbiology Laboratory of Hsin-Chu Hospital for technical assistance. The present work was partially supported by a grant from the National Science Council (grant NSC 102-2311-B-264001; grant NSC 102-2622-E-126-002-CC1) and the Taiwan University Hospital Hsin Chu Branch (grant HCH101-22). Disclosure Statement
No competing financial interests exist. References
1. Adams, M.D., E.R. Chan, N.D. Molyneaux, and R.A. Bonomo. 2010. Genomewide analysis of divergence of antibiotic resistance determinants in closely related isolates of Acinetobacter baumannii. Antimicrob. Agents Chemother. 54:3569–3577. 2. Bonnin, R.A., P. Nordmann, and L. Poirel. 2013. Screening and deciphering antibiotic resistance in Acinetobacter baumannii: a state of the art. Expert. Rev. Anti Infect. Ther. 11:571–583. 3. Chen, T.L., R.C. Wu, M.F. Shaio, C.P. Fung, and W.L. Cho. 2008. Acquisition of a plasmid-borne blaOXA-58 gene with an upstream IS1008 insertion conferring a high level of carbapenem resistance to Acinetobacter baumannii. Antimicrob. Agents Chemother. 52:2573–2580. 4. Dijkshoorn, L., A. Nemec, and H. Seifert. 2007. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat. Rev. Microbiol. 5:939–951. 5. Figueiredo, S., L. Poirel, J. Croize, C. Recule, and P. Nordmann. 2009. In vivo selection of reduced susceptibility to carbapenems in Acinetobacter baumannii related to ISAba1-mediated overexpression of the natural bla(OXA66) oxacillinase gene. Antimicrob. Agents Chemother. 53: 2657–2659. 6. Fournier, P.E., D. Vallenet, V. Barbe, S. Audic, H. Ogata, L. Poirel, H. Richet, C. Robert, S. Mangenot, C. Abergel, et al. 2006. Comparative genomics of multidrug resistance in Acinetobacter baumannii. PLoS Genet. 2:e7. 7. Heritier, C., L. Poirel, and P. Nordmann. 2006. Cephalosporinase over-expression resulting from insertion of ISAba1 in Acinetobacter baumannii. Clin. Microbiol. Infect. 12:123–130. 8. Hornsey, M., N. Loman, D.W. Wareham, M.J. Ellington, M.J. Pallen, J.F. Turton, A. Underwood, T. Gaulton, C.P. Thomas, M. Doumith, et al. 2011. Wholegenome comparison of two Acinetobacter baumannii
6
9.
10.
11.
12.
13.
14. 15.
16.
17.
KUO ET AL.
isolates from a single patient, where resistance developed during tigecycline therapy. J. Antimicrob. Chemother. 66: 1499–1503. Kuo, H.Y., K.C. Chang, J.W. Kuo, H.W. Yueh, and M.L. Liou. 2012. Imipenem: a potent inducer of multidrug resistance in Acinetobacter baumannii. Int J Antimicrob Agents 39:33–38. Kuo, H.Y., C.M. Yang, M.F. Lin, W.L. Cheng, N. Tien, and M.L. Liou. 2010. Distribution of blaOXA-carrying imipenem-resistant Acinetobacter spp. in 3 hospitals in Taiwan. Diagn. Microbiol. Infect. Dis. 66:195–199. Lin, M.F., H.Y. Kuo, H.W. Yeh, C.M. Yang, C.H. Sung, C.C. Tu, M.L. Huang, and M.L. Liou. 2011. Emergence and dissemination of bla(OXA-23)-carrying imipenemresistant Acinetobacter sp in a regional hospital in Taiwan. J. Microbiol. Immunol. Infect. 44:39–44. Liu, C.C., C.Y. Tang, H.Y. Kuo, C.W. Lu, K.C. Chang, and M.L. Liou. 2013. The origin of Acinetobacter baumannii TYTH-1: a comparative genomics study. Int. J. Antimicrob. Agents 41:318–324. Livak, K.J., and T.D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408. Maragakis, L.L., and T.M. Perl. 2008. Acinetobacter baumannii: epidemiology, antimicrobial resistance, and treatment options. Clin. Infect. Dis. 46:1254–1263. Mugnier, P.D., L. Poirel, and P. Nordmann. 2009. Functional analysis of insertion sequence ISAba1, responsible for genomic plasticity of Acinetobacter baumannii. J. Bacteriol. 191:2414–2418. Mussi, M.A., A.S. Limansky, and A.M. Viale. 2005. Acquisition of resistance to carbapenems in multidrugresistant clinical strains of Acinetobacter baumannii: natural insertional inactivation of a gene encoding a member of a novel family of beta-barrel outer membrane proteins. Antimicrob. Agents Chemother. 49:1432–1440. Peleg, A.Y., H. Seifert, and D.L. Paterson. 2008. Acinetobacter baumannii: emergence of a successful pathogen. Clin. Microbiol. Rev. 21:538–582.
18. Perez, F., A.M. Hujer, K.M. Hujer, B.K. Decker, P.N. Rather, and R.A. Bonomo. 2007. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob. Agents Chemother. 51:3471–3484. 19. Poirel, L., and P. Nordmann. 2006. Genetic structures at the origin of acquisition and expression of the carbapenemhydrolyzing oxacillinase gene blaOXA-58 in Acinetobacter baumannii. Antimicrob. Agents Chemother. 50:1442–1448. 20. Segal, H., R.K. Jacobson, S. Garny, C.M. Bamford, and B.G. Elisha. 2007. Extended -10 promoter in ISAba-1 upstream of blaOXA-23 from Acinetobacter baumannii. Antimicrob. Agents Chemother. 51:3040–3041. 21. Snitkin, E.S., A.M. Zelazny, C.I. Montero, F. Stock, L. Mijares, P.R. Murray, and J.A. Segre. 2011. Genomewide recombination drives diversification of epidemic strains of Acinetobacter baumannii. Proc. Natl. Acad. Sci. U. S. A. 108:13758–13763. 22. Turton, J.F., M.E. Ward, N. Woodford, M.E. Kaufmann, R. Pike, D.M. Livermore, and T.L. Pitt. 2006. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol. Lett. 258:72–77. 23. Wikler, M.A., and Clinical and Laboratory Standards Institute. 2009. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically: approved standard. Clinical and Laboratory Standards Institute,. 8th ed. Clinical and Laboratory Standards Institute, Wayne, PA, pp. xvi, 65 p.
Address correspondence to: Ming-Li Liou, PhD Department of Medical Laboratory Science and Biotechnology Yuanpei University No. 306, Yuanpei Street Hsin-Chu City 30015 Taiwan E-mail: [email protected]
MICROBIAL DRUG RESISTANCE Volume 00, Number 00, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/mdr.2014.0004
Insertion Sequence Transposition Determines Imipenem Resistance in Acinetobacter baumannii Han-Yueh Kuo,1,2,* Kai-Chih Chang,3,* Chih-Chin Liu,4,5 Chuan Yi Tang,5,6 Jhih-Hua Peng,3 Chia-Wei Lu,6 Chi-Chao Tu,7,8 and Ming-Li Liou 5,8,*
This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenemsusceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.
position of this insertion sequence may play an important role in enhancing the spread of resistance and virulence traits.15 Despite whole-genome sequence of A. baumannii after tigecycline exposure has been already published,8 a genomewide assessment of recombination upon exposure to carbapenem in A. baumannii has yet to be reported. A. baumannii can rapidly alter its genome to evade both natural host defense mechanisms and antibiotic intervention.6,21 Snitkin et al.21 reported that genomewide recombination improved the diversification of epidemic strains of A. baumannii, resulting in polyclonal outbreaks. A study of representative A. baumannii genomes highlighted a propensity for horizontal gene transfer, with large genomic islands enriched in transposons and antibiotic resistance determinants.6,12 Another study conducted to discern determinates of antibiotic resistance in A. baumannii revealed highly dynamic resistance gene repertoires even in closely related isolates.1 Thus, the plasticity of the A. baumannii
Introduction
C
arbapenem resistance in Acinetobacter baumannii (CRAB) is increasingly reported and has become a global public health concern.18 This phenotypic observation is likely mediated by changes in porin proteins, modification of penicillin-binding proteins, and the acquisition of a class B or class D b-lactamase.14 Recently, several reports suggested that high-level carbapenem resistance due to the expression of genes encoding class D b-lactamase requires a strong promoter, such as that provided by the mobile insertion sequence ISAba1.5,22 Additionally, ours and other studies showed that most of the CRAB strains contain ISAbal adjacent to blaOXA.11,22 Although ISAbal is widely distributed across most of the clinical A. baumannii isolates, ISAbal adjacent to blaOXA is mostly restricted to CRAB rather than CSAB, implying that carbapenem resistance may be mediated by genetic recombination. Clearly, the trans1
Department of Medicine, National Taiwan University Hospital Hsin-Chu Branch, Hsin-Chu City, Taiwan. School of Medicine, National Taiwan University, Taipei City, Taiwan. 3 Department of Laboratory Medicine and Biotechnology, Tzu Chi University, Hualien City, Taiwan. 4 Department of Bioinformatics, Chung Hua University, Hsin-Chu City, Taiwan. 5 Department of Computer Science and Information Engineering, Providence University, Taichung County, Taiwan. 6 Department of Computer Science, National Tsing Hua University, Hsin-Chu City, Taiwan. 7 Medical Laboratory, Keelung Hospital Ministry of Health and Welfare, Keelung city, Taiwan. 8 Department of Medical Laboratory Science and Biotechnology, Yuanpei University, Hsin-Chu City, Taiwan. *These authors contributed equally to this work. 2
1
2
KUO ET AL.
genome may be regarded as the capacity of this organism to survive and adapt in the environment. In this study, we report the results of whole genome sequencing of imipenem-selected A. baumannii (ATCC 17978), and further develop an understanding of the mechanism(s) by which imipenem exposure may initiate insertion sequence transposition, resulting in antibiotic resistance in A. baumannii.
was performed at the Beijing Genomics Institute in Shenzhen, China. Contigs were determined using the CLC Genomics Workbench (version 6.0.5; CLC bio, Cambridge, MA). The order of the contigs was predicted from the chromosome sequences of A. baumannii ATCC 17978 (GenBank accession number CP000521).
Materials and Methods
The in silico analysis of genomes was performed by BLAST search (blastn) using the contigs and the A. baumannii ATCC 17978 sequence; mutants were determined from these BLAST results. PCR confirmation of genetic recombination between A1S_0676 and A1S_1517 was carried out using primers (A1S_0676 FP and A1S_1517 RP) designed to anneal around the recombination region.
Bacterial strains
A. baumannii reference strain ATCC 17978 was purchased from Bioresource Collection and Research Center (Hsin-Chu, Taiwan). Resistance to imipenem in the parental strain A. baumannii ATCC 17978 was generated according to the procedures described by Kuo et al.9 Imipenem-selected strains were exposed to 0.5, 1, 2, 4, and 8 mg/L imipenem and were collected during the induction period, as shown in Table 1. The genotypic patterns in the selected mutants and their parental strain were determined by pulsed-field gel electrophoresis (PFGE), as previously described.10 Antimicrobial susceptibilities
The susceptibilities of the Acinetobacter mutants and their parental strain to antimicrobial agents were determined by the microdilution method, in accordance with the guidelines of the Clinical and Laboratory Standards Institute.23 The agents tested included ampicillin/sulbactam, ceftazidime, cefepime, amikacin, ciprofloxacin, trimethoprim/sulfamethoxazole, imipenem, and meropenem. Escherichia coli strain ATCC 25922 and Pseudomonas aeruginosa strain ATCC 27853 were used as reference controls for the susceptibility testing. A fourfold or greater induction in the minimum inhibitory concentration (MIC) values after exposure to imipenem was considered significantly different from control. DNA sequencing and assembly
The genomic DNA of A. baumannii IPM-32m strain was prepared using Wizard genomic DNA purification kits (Promega, Madison, WI) according to the manufacturer’s instructions. The Illumina HiSeq 2000 platform sequencing
Genomic analysis and PCR confirmation
Reverse transcriptase-quantitative PCR
Gene expression was analyzed using a previously described method.9 Briefly, total RNA was isolated from 1 · 109 Acinetobacter baumannii cells. DNase treatment of RNA samples, cDNA synthesis, and reverse transcriptasequantitative PCR were carried out as described previously.9 Template cDNA was diluted 1:100 and 2.5 ml was added to SYBR green PCR master mix (Applied Biosystems, Foster City, CA) for each reaction. An ABI Prism 7000 instrument (Applied Biosystems) was used for analysis. Internal forward and reverse primers for each gene were designed using PrimerExpress (Applied Biosystems). Experiments were repeated with three independent experiments. Normalization to the 16S ribosomal gene allowed calculation of the fold change by the threshold cycle (CT) method.13 Statistical analysis
The differences in expression of the blaOXA-95 genes between the resistant mutants and their parental strains were analyzed by the Student’s t-test, as appropriate. The differences between two groups of isolates were considered significant at the p < 0.05 level. The data entry and analyses were performed using the Statistical Package for the Social Sciences (SPSS) software version 15.0 (SPSS, Inc., Chicago, IL).
Table 1. Bacterial Strains and Primers Used in This Study Strains or primers
Relevant characteristic(s), description, or sequence
Strain 17978 19606 IPM-2m IPM-4m IPM-8m IPM-16m IPM-32m Primers A1S_0676F A1S_1517R A1S_1517qF A1S_1517qR 16S rRNA qF 16S rRNA qR
Type strain Type strain 17978 strain selected with 0.5 mg/L imipenem 17978 strain selected with 1 mg/L imipenem 17978 strain selected with 2 mg/L imipenem 17978 strain selected with 4 mg/L imipenem 17978 strain selected with 8 mg/L imipenem 5¢ to 3¢ AATGATTGGTGACAATGAAG TGGATTGCACTTCATCTTGG ATGGCAATGCAGATATCGGTAC; q-PCR TGGATTGCACTTCATCTTGGAC; q-PCR CAGCTCGTGTCGTGAGATGT; q-PCR CGTAAGGGCCATGATGACTT; q-PCR
Source ATCC 17978 ATCC 19606 This study This study This study This study This study This This This This This This
study study study study study study
IS TRANSPOSITION DETERMINES IMIPENEM RESISTANCE
3
testing for these mutants and their parental strain is shown in Table 2. The reference strain 17978 was susceptible to all the antibiotics tested. The MICs to meropenem and imipenem were fourfold higher in the ATCC 17978 mutants when they were gradually exposed to imipenem concentrations ranging from 0.5 to 8 mg/L. Meanwhile, the MICs for imipenem-selected mutants were still susceptible to the other antibiotics. Translocation of ISAba1 upstream of blaOXA-95 in imipenem-selected mutants
Ten genes that originated from two regions in the parental chromosome were rearranged in order in the AB13_1. Two gene fragments, putative transposase (A1S_0676) and transposase (A1S_0677), were reversibly inserted into the region upstream of blaOXA-95 (A1S_1517), as shown in Fig. 2A. The two gene fragments constitute the transposase of ISAba1.15 The blaOXA-95 gene belongs to the blaOXA-51 cluster, which represents the intrinsic oxacillinase of A. baumannii.2 Moreover, all the genes in the AB13_1 were present in a reverse orientation compared to the parental genome. An inverted repeat (IR) sequence is located just 7 bp upstream of the start codon of the blaOXA-95 gene. The - 35 and - 10 sequences (TTAGAA and TTATTT, respectively) were separated by 16 bp in a Pout promoter configuration and were identified at the downstream boundary of the transposition site, 39 bp upstream of the start codon of the blaOXA-95 gene. This transposition likely enhanced blaOXA-95 expression. The transposition of ISAba1 generated a 9-bp target site duplication (TSD) (AATCAAAAT), as shown in Fig. 2B. This 9-bp TSD near the IRL sequence was separated and reversibly inserted into the region downstream of blaOXA-95. The transposition of this insertion sequence was confirmed by PCR using the A1S_0676 forward primer and the A1S_1517 reverse primer. PCR fragments indicating the insertion of this sequence were detected in all the imipenem-selected mutants but, as expected, were absent from the parental strain.
FIG. 1. Comparison of the genotypic patterns in the selected mutants and their parental strain by pulsed-field gel electrophoresis. Lane 1: DNA from parental strain ATCC 17978; Lanes 2 to 6: DNA from IPM-2m, IPM-4m, IPM8m, IPM-16m, and IPM-32m derived from exposure to 0.5, 1, 2, 4, and 8 mg/L imipenem, respectively; Lane 7: DNA from the control strain ATCC 19606; Lane M: Lambda ladder PFG marker (New England Biolabs, Herts, United Kingdom). Nucleotide sequence accession number
The nucleotide sequence data of contig AB13_1 are available in the GenBank nucleotide database under accession number KF724152. Results
The expression of blaOXA-95 in imipenem-selected mutants
Susceptibility testing
Antibiotic-selected mutants were generated from the ATCC 17978 type strain. The identities of the selected mutants that originated from ATCC17978 were confirmed by PFGE, as shown in Fig. 1. The result of antibiotic susceptibility
The transcription of blaOXA-95 was analyzed by qPCR, as shown in Fig. 3. A gradual increase in blaOXA-95 expression corresponded to those mutants with progressively increased
Table 2. Susceptibility of Acinetobacter baumannii ATCC 17978 Selected with Various Concentrations of Imipenem 17978
IPM-2m
IPM-4m
IPM-8m
IPM-16m
IPM-32m
Imipenem-selected concentrations (mg/L) Antibiotics a
Imipenem Meropenema Ceftazidime Cefepime Amikacin Ciprofloxacin Ampicillin/subactam Trimethoprim/Sulfamethoxazole a
0
0.5
1
2
4
8
£ 0.25 £ 0.25 4 2 £2 £ 0.25 £2 160
1 2 4 2 £2 £ 0.25 4 160
2 8 4 2 £2 £ 0.25 4 160
‡ 16 ‡ 16 4 2 £2 £ 0.25 4 160
‡ 16 ‡ 16 4 2 £2 £ 0.25 4 160
‡ 16 ‡ 16 4 2 £2 £ 0.25 4 160
A more than fourfold induction is indicated in boldface.
4
KUO ET AL.
FIG. 2. Target site of ISAba1 in contig AB13_1. (A) Genetic recombination in contig AB13_1 and the nucleotide sequence of the insertion upstream of blaOXA-95. The - 35 and - 10 motifs of promoters are indicated. Pout is the promoter of blaOXA-95 provided by ISAba1. IRL indicates left inverted repeat sequences. (B) The orientation of direct repeat (DR) sequences of ISAba1. Arrow, the breakpoint of the 9-bp DR. resistance to imipenem. Despite fold changes in blaOXA-95 expression that ranged from 29 to 50 in the IPM-2m and IPM4m mutants, those strains were still susceptible to imipenem (Table 2 and Fig. 3). However, an approximate 200-fold increase in blaOXA-95 expression for the IPM-8m, IPM-16m, and IPM-32m strains conferred resistance to imipenem. Discussion
Carbapenem resistance in A. baumannii has become a global challenge. Most of the carbapenem-resistant A. baumannii produce carbapenemase or, more specifically, enzymes known as carbapenem-hydrolyzing class D b-lactamases (CHDLs).4 Recently, several reports have demonstrated that insertion sequences (ISs) may play important roles in resistance to antibiotics. First, ISs may enhance b-lactamase gene expression by providing promoters to drive greater gene expression.7,22 It has been shown that overexpression of
the OXA carbapenemase genes and ADC AmpC b-lactamase genes is determined mostly by the promoters present in their upstream ISAba1 element.5,11,22 ISAba2, ISAba3, and ISAba4 elements have also been found to precede the blaOXA-58 and the blaOXA-23 genes in clinical isolates of A. baumannii.3,19 Second, ISAba1-related gene disruption was also observed for other genes in carbapenem-resistant A. baumannii strains.16 Third, ISAba1 and the composite transposon, Tn2006, are capable of transposition in E. coli strains, in addition to the ability of ISAba1 to mobilize as an antibiotic resistance gene.15 In this article, we compared the genome sequences of imipenem-selected mutants and their parental strains. The results show that imipenem exposures at twice the MIC for the IPM-2m strain may initiate IS transposition in the ATCC 17978 type strain. ISAba1, which is located nearly 800 kb away from blaOXA-95 in the genome of the 17978 type strain, is present as an inverted, transposed sequence upstream of
IS TRANSPOSITION DETERMINES IMIPENEM RESISTANCE
5
tended -10 promoter in the inserted ISAba1 region.20 Nevertheless, the association between stress responses and the mechanisms of downstream gene regulation should be characterized further in the future. In conclusion, this study investigated the resistance mechanisms to imipenem in A. baumannii. Our results demonstrated that imipenem exposure (0.5 mg/L) initiated genetic recombination in A. baumannii. Transposition of ISAba1 upstream of the blaOXA-95 gene resulted in overexpression of this gene, potentially playing a critical role in imipenem resistance. Strict monitoring of the use of carbapenem in hospitals will be required to reduce the spread of carbapenem-resistant A. baumannii.
FIG. 3. Expression of blaOXA-95 from imipenem-selected mutants and their parental strain. The relative mRNA expression of blaOXA-95 is normalized to that of the 16S rRNA gene. The relative expression of blaOXA-95 in 17978 type strain is defined as 1. The fold change is defined as the expression level of blaOXA-95 in mutant strains normalized to their parental strain. Each bar represents the average value of three independent experiments, and the error bars represent the standard deviations. *p < 0.05; **p < 0.001. the blaOXA-95 gene, thereby resulting in overexpression of blaOXA-95. A previous study showed that the transposition of IS generated a 9-bp TSD.15 Our study reveals that the 9-bp TSD is reversibly inserted into the downstream region of blaOXA-95, which may be mediated by the reversible recombination of blaOXA-95. Moreover, the ISAba1/blaOXA-95 gene junction (AAGTCTT) in imipenem-selected mutants is consistent with those in clinical strains as described by Turton et al.22 Although ISAba1 sequences are commonly detected in the genomes of both carbapenem-susceptible and -resistant strains,22 the insertion of ISAba1-like sequences upstream of blaOXA is unique to a majority of CRAB isolates, suggesting that genetic recombination through IS transposition may confer resistance to carbapenem in most clinical isolates. In this report, we provide direct evidence to demonstrate genetic recombination through transposition of IS upon imipenem exposures at just twice the MIC. In addition to the contig AB13_1, the sequences of remaining contigs in the IPM-32m mutant strain are identical to those in their parental strain, suggesting that IS transposition may play a major role in the resistance to carbapenem on the genome level. Several resistance mechanisms are involved in carbapenem resistance.17 However, the contribution of each resistance gene to carbapenem resistance was previously unclear. Our study revealed that increased blaOXA-95 mRNA levels corresponded to ATCC 17978 strain isolates selected with gradually increased imipenem concentrations, suggesting that blaOXA-95 may play a critical role in the resistance to carbapenem. Additionally, our results showed that more than 200-fold increases in blaOXA-95 expression were required for resistance to imipenem. Despite the fact that overexpression of blaOXA-95 gene is predominantly driven by the promoter in the upstream ISAba1 region, gradual increases in blaOXA-95 gene expression may be modulated by additional transcriptional factors. One study of ISAba1-mediated gene regulation demonstrated that the as subunit of RNA polymerase, chief regulator of the general stress response in E. coli, may regulate downstream gene expression by binding to an ex-
Acknowledgments
The authors would like to thank the Clinical Microbiology Laboratory of Hsin-Chu Hospital for technical assistance. The present work was partially supported by a grant from the National Science Council (grant NSC 102-2311-B-264001; grant NSC 102-2622-E-126-002-CC1) and the Taiwan University Hospital Hsin Chu Branch (grant HCH101-22). Disclosure Statement
No competing financial interests exist. References
1. Adams, M.D., E.R. Chan, N.D. Molyneaux, and R.A. Bonomo. 2010. Genomewide analysis of divergence of antibiotic resistance determinants in closely related isolates of Acinetobacter baumannii. Antimicrob. Agents Chemother. 54:3569–3577. 2. Bonnin, R.A., P. Nordmann, and L. Poirel. 2013. Screening and deciphering antibiotic resistance in Acinetobacter baumannii: a state of the art. Expert. Rev. Anti Infect. Ther. 11:571–583. 3. Chen, T.L., R.C. Wu, M.F. Shaio, C.P. Fung, and W.L. Cho. 2008. Acquisition of a plasmid-borne blaOXA-58 gene with an upstream IS1008 insertion conferring a high level of carbapenem resistance to Acinetobacter baumannii. Antimicrob. Agents Chemother. 52:2573–2580. 4. Dijkshoorn, L., A. Nemec, and H. Seifert. 2007. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat. Rev. Microbiol. 5:939–951. 5. Figueiredo, S., L. Poirel, J. Croize, C. Recule, and P. Nordmann. 2009. In vivo selection of reduced susceptibility to carbapenems in Acinetobacter baumannii related to ISAba1-mediated overexpression of the natural bla(OXA66) oxacillinase gene. Antimicrob. Agents Chemother. 53: 2657–2659. 6. Fournier, P.E., D. Vallenet, V. Barbe, S. Audic, H. Ogata, L. Poirel, H. Richet, C. Robert, S. Mangenot, C. Abergel, et al. 2006. Comparative genomics of multidrug resistance in Acinetobacter baumannii. PLoS Genet. 2:e7. 7. Heritier, C., L. Poirel, and P. Nordmann. 2006. Cephalosporinase over-expression resulting from insertion of ISAba1 in Acinetobacter baumannii. Clin. Microbiol. Infect. 12:123–130. 8. Hornsey, M., N. Loman, D.W. Wareham, M.J. Ellington, M.J. Pallen, J.F. Turton, A. Underwood, T. Gaulton, C.P. Thomas, M. Doumith, et al. 2011. Wholegenome comparison of two Acinetobacter baumannii
6
9.
10.
11.
12.
13.
14. 15.
16.
17.
KUO ET AL.
isolates from a single patient, where resistance developed during tigecycline therapy. J. Antimicrob. Chemother. 66: 1499–1503. Kuo, H.Y., K.C. Chang, J.W. Kuo, H.W. Yueh, and M.L. Liou. 2012. Imipenem: a potent inducer of multidrug resistance in Acinetobacter baumannii. Int J Antimicrob Agents 39:33–38. Kuo, H.Y., C.M. Yang, M.F. Lin, W.L. Cheng, N. Tien, and M.L. Liou. 2010. Distribution of blaOXA-carrying imipenem-resistant Acinetobacter spp. in 3 hospitals in Taiwan. Diagn. Microbiol. Infect. Dis. 66:195–199. Lin, M.F., H.Y. Kuo, H.W. Yeh, C.M. Yang, C.H. Sung, C.C. Tu, M.L. Huang, and M.L. Liou. 2011. Emergence and dissemination of bla(OXA-23)-carrying imipenemresistant Acinetobacter sp in a regional hospital in Taiwan. J. Microbiol. Immunol. Infect. 44:39–44. Liu, C.C., C.Y. Tang, H.Y. Kuo, C.W. Lu, K.C. Chang, and M.L. Liou. 2013. The origin of Acinetobacter baumannii TYTH-1: a comparative genomics study. Int. J. Antimicrob. Agents 41:318–324. Livak, K.J., and T.D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408. Maragakis, L.L., and T.M. Perl. 2008. Acinetobacter baumannii: epidemiology, antimicrobial resistance, and treatment options. Clin. Infect. Dis. 46:1254–1263. Mugnier, P.D., L. Poirel, and P. Nordmann. 2009. Functional analysis of insertion sequence ISAba1, responsible for genomic plasticity of Acinetobacter baumannii. J. Bacteriol. 191:2414–2418. Mussi, M.A., A.S. Limansky, and A.M. Viale. 2005. Acquisition of resistance to carbapenems in multidrugresistant clinical strains of Acinetobacter baumannii: natural insertional inactivation of a gene encoding a member of a novel family of beta-barrel outer membrane proteins. Antimicrob. Agents Chemother. 49:1432–1440. Peleg, A.Y., H. Seifert, and D.L. Paterson. 2008. Acinetobacter baumannii: emergence of a successful pathogen. Clin. Microbiol. Rev. 21:538–582.
18. Perez, F., A.M. Hujer, K.M. Hujer, B.K. Decker, P.N. Rather, and R.A. Bonomo. 2007. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob. Agents Chemother. 51:3471–3484. 19. Poirel, L., and P. Nordmann. 2006. Genetic structures at the origin of acquisition and expression of the carbapenemhydrolyzing oxacillinase gene blaOXA-58 in Acinetobacter baumannii. Antimicrob. Agents Chemother. 50:1442–1448. 20. Segal, H., R.K. Jacobson, S. Garny, C.M. Bamford, and B.G. Elisha. 2007. Extended -10 promoter in ISAba-1 upstream of blaOXA-23 from Acinetobacter baumannii. Antimicrob. Agents Chemother. 51:3040–3041. 21. Snitkin, E.S., A.M. Zelazny, C.I. Montero, F. Stock, L. Mijares, P.R. Murray, and J.A. Segre. 2011. Genomewide recombination drives diversification of epidemic strains of Acinetobacter baumannii. Proc. Natl. Acad. Sci. U. S. A. 108:13758–13763. 22. Turton, J.F., M.E. Ward, N. Woodford, M.E. Kaufmann, R. Pike, D.M. Livermore, and T.L. Pitt. 2006. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol. Lett. 258:72–77. 23. Wikler, M.A., and Clinical and Laboratory Standards Institute. 2009. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically: approved standard. Clinical and Laboratory Standards Institute,. 8th ed. Clinical and Laboratory Standards Institute, Wayne, PA, pp. xvi, 65 p.
Address correspondence to: Ming-Li Liou, PhD Department of Medical Laboratory Science and Biotechnology Yuanpei University No. 306, Yuanpei Street Hsin-Chu City 30015 Taiwan E-mail: [email protected]
