EVOLUTION & DEVELOPMENT
17:2, 160–169 (2015)
DOI: 10.1111/ede.12115
Insights into Frizzled evolution and new perspectives Quentin Schenkelaars,a,* Laura Fierro-Constain,a Emmanuelle Renard,a April L. Hill,b and Carole Borchiellinia,* a , IMBE UMR CNRS 7263, Institut Me diterrane en de Biodiversite et d'Ecologie marine et Aix-Marseille Universite continentale, Station Marine d'Endoume, Marseille, France b Department of Biology, University of Richmond, Richmond, VA, USA *Author for correspondence (e-mail: [email protected]; [email protected])
SUMMARY The Frizzled proteins (FZDs) are a family of trans-membrane receptors that play pivotal roles in Wnt pathways and thus in animal development. Based on evaluation of the Amphimedon queenslandica genome, it has been proposed that two Fzd genes may have been present before the split between demosponges and other animals. The major purpose of this study is to go deeper into the evolution of this family of proteins by evaluating an extended set of available data from bilaterians, cnidarians, and different basally branching animal lineages (Ctenophora,
Placozoa, Porifera). The present study provides evidence that the last common ancestor of metazoans did possess two Fzd genes, and that the last common ancestor of cnidarians and bilaterians may have possessed four Fzd. Furthermore, amino acid analyses revealed an accurate diagnostic motif for these four FZD subfamilies facilitating the assignation of Frizzled paralogs to each subfamily. By highlighting conserved amino acids for each FZD subfamily, our study could also provide a framework for further research on the precise mechanisms that have driven FZD neo-functionalization.
INTRODUCTION
FZDs are major and pivotal receptor proteins of Wnt pathways, retracing the evolution of this family and highlighting critical amino acid composition at the metazoan scale should provide us key data for cross phyla comparisons and for understanding function of FZD family members. Whereas 10 FZDs have been identified in most vertebrates, only 4 Frizzled members seem to be carried by most bilaterians (van Amerongen and Nusse 2009; Qian et al. 2013). Concerning Cnidaria and more basally branching lineages (placozoans, ctenophores, and poriferans), only a few data sets are currently available (Pang et al. 2010; Riesgo et al. 2014). These lineages are presently represented by only one whole genome: Nematostella vectensis for Cnidaria, Trichoplax adhaerens for Placozoa, Mnemiopsis leydii for Ctenophora, and Amphimedon queenslandica for Porifera (Pang et al. 2010; Srivastava et al. 2008, 2010). In addition, FZDs have not been reported in T. adhaerens. This limited sampling would likely yield artifactual conclusions, especially for Porifera which is a highly diversified phylum with more than 8000 described species separated into four clearly distinct classes: Demospongiae, Hexactinellida, Calcarea, and Homoscleromorpha (Dohrmann et al. 2008; Gazave et al. 2009; Van Soest et al. 2012). Thus, previous studies describing the main components of the Wnt pathways in non-bilaterians suffer from the lack of phylum specific comparisons and the lack of robust phylogenetic hypotheses at the basis of the metazoan tree (Sperling et al. 2007; Nosenko et al. 2013; Ryan et al. 2013) that would yield to a more complete view of Fzd evolution.
The Wnt signaling pathways have been extensively investigated as one of the major regulatory modules for animal development (Stathopoulos and Levine 2005; Nichols et al. 2006; Richards and Degnan 2009; Niehrs 2012; Nusse and Varmus 2012). The Wnt pathways are complex gene networks involving evolutionarily conserved components such as the seven trans-membrane receptor Frizzled (FZD) (Schulte 2010; Niehrs 2012). Receptors of the Frizzled family contain an N-terminal Cysteine rich domain (CRD) followed by seven trans-membrane domains (TMs) and an N-terminus with a KTXXXW motif (Fig. 1; Huang and Klein 2004; Punchihewa et al. 2009; Strutt et al. 2012). The extracellular CRD is involved in WNT recognition (Dann et al. 2001; Pei and Grishin 2012), while the seven TMs allow the protein to anchor to the cell surface. Concerning the KTXXXW motif it is required for signal transduction to the cytoplasmic protein called Dishevelled (DVL) (Huang and Klein 2004; Punchihewa et al. 2009; Strutt et al., 2012; Tauriello et al., 2012). The Frizzled family was first described as proteins controlling hair polarity in the Drosophila wing (Vinson et al. 1989; Adler 2002; Simons and Mlodzik 2008; McNeill 2009). Since that time, FZDs have been described as important pivotal proteins for dispatching WNT signals to different transduction cascades such as the b-catenin pathway, the Rho-Rock pathway, or the Planar Cell Polarity pathway (PCP) (Fig. 1; Simons and Mlodzik 2008; Rao and K€uhl 2010; Schulte 2010). Because 160
© 2015 Wiley Periodicals, Inc.
Schenkelaars et al.
Evolution of Frizzled receptor
161
Fig. 1. Schematic of the putative ancestral FZD proteins and hypothesis for the evolution of the Frizzled family in metazoan evolution. This schematic shows how the four eumetazoan subfamilies likely arose from two ancestral Fzd (Fzda-like and Fzdb-like) genes, highlighting their respective diagnostic motifs (i.e., 1C-G-2C). In addition, domain composition is shown as well as some downstream signaling pathways: the canonical Wnt pathway, the Rho/Rock pathway, and the planar cell polarity pathway.
Previous analyses showed that the Wnt pathway is less complex in basal lineages than in bilaterians or cnidarians with a restricted number of genes. Adamska et al. (2010) reported the presence of two ancestral Fzd genes from the A. queenslandica genome (Porifera, Demospongiae). However, several studies have reported that the A. queenslandica genome has many gene
losses even compared to other sponges (Peterson and Sperling 2007; Larroux et al. 2008; Gazave et al. 2009) which highlights why one species cannot be considered as representative of a whole phylum. Thus, in order to better understand the evolution of this gene family at the metazoan scale, it is important to characterize Fzd genes in other sponge lineages and to take a
162
EVOLUTION & DEVELOPMENT
Vol. 17, No. 2, March–April 2015
comparative and global approach for understanding the relationships between the different FZD members. Here, we characterized Fzd members in Corallium rubrum (Cnidaria, Octocorallia), several sponge species: Oscarella lobularis, Oscarella carmela (Homoscleromorpha), Ephydatia muelleri (Demospongiae), and Oopsacas minuta (Hexactinellida) and in T. adhaerens in order to evaluate the ancestral FZD content of basally branching animals (including the first report of FZD in Placozoa) in context with data obtained in Cnidaria and Bilateria. Then, we investigated the main metazoan lineages and the distribution of their FZDs within the phylogenetic tree to infer orthologous relationships and to determine how this family has evolved from sponges to vertebrates. Finally, analysis of characteristic amino acids improves our understanding of phylogenetic relationships and permits a description of diagnostic residues for the different subfamilies which should facilitate assignation of highly divergent sequences. Thus, this study proposes an evolutionary scenario of fzd genes and draws attention to some residues (especially cysteines) that may have allowed neo-functionalization in eumetazoan lineages.
METHODS AND MATERIALS
More complete analysis of each transcriptome, such as the total number of contigs or the total length of sequence was evaluated.
Sequence acquisition Fzd sequences were searched within O. carmela genome (http:// www.compagen.org/) using BioEdit tblastn function (Altschul et al. 1997) with 1.0 as threshold e-value. Then, proteins were predicted by GenScan software (http://genes.mit.edu/GENSCAN.html) or manually. Fzd transcripts were also identified in the O. lobularis transcriptomic database using the same approach. Since OcFZDA1 and OcFZDA2 were predicted by GenScan on the same scaffold, a PCR using a forward primer designed at the 30 terminal end of OlFZDA1 and a reverse primer at the 50 terminal end of OlFZDA2 was made in order to confirm if whether or not these sequences are also located on the same chromosome in O. lobularis (primers: TTTCTGTTTCGCTGTCGATG and CGATTGTAGAACTGACGGCA). As well, O. minuta, E. muelleri, and C. rubrum transcriptomes were investigated for the presence of Fzd genes in addition to the T. adhaerens genome (http://metazoa. ensembl.org/Trichoplax_adhaerens/Info/Index).
Transcriptomic constructions Samples of O. lobularis were collected in the Marseille Bay. A specimen containing many embryos at different developmental stages has been sent to Eurofins mwg/operon for cDNA library construction and 454 sequencing. Total RNA was isolated and purified from sponge tissue. Poly(A) RNA was isolated and used as template for cDNA synthesis. First-stand cDNA synthesis was primed with an N6 randomized primer and 454 adaptaters were ligated. The cDNA was amplified by a proof-reading PCR and cDNAs in the size range of 500–1100 bp were sequenced. The transcriptomic database was created by a de novo assembly method. O. minuta transcriptome was constructed using exactly the same approach. C. rubrum have been obtained from a previously obtained transcriptome database (Pratlong et al. in press) that was constructed using mRNA from 12 specimens. Sequences were obtained and provided by the GenoToul platform using the Illumina HiSeq2000 Sequencing system.
Evaluation of transcriptomes quality and coverage The longest ORF was identified for each contig. ORFs smaller than 120 bp were removed whereas others were searched using BLAST against the referenced genome (N. vectensis for C. rubrum and A. queenslandica for sponges) with a fixed threshold value: 105. The number of orthologous proteins of those predicted for the referenced genome was estimated for each transcriptome by the number of different best hits.
Sequence assignation Sequence assignations to the FZD family were performed using reverse tblastx on NCBI (www.ncbi.nlm.nih.gov) and domain analyses. Subfamilies were highlighted by two other complementary studies: phylogenetic analysis and amino acid analysis. Sequences of interest were collected from UNIPROT or NCBI website (www.uniprot.org, http://www.ncbi.nlm.nih.gov/ ); see Supplemental data S1). All paralogous Fzd genes from main metazoan groups were gathered. Vertebrata: Callorhinchus milii, Cm; Danio rerio, Dr; Homo sapiens, Hs, and Pseudopodoces humilis, Ph. Urochordata: Ciona intestinalis, Ci. Cephalochordata: Branchiostoma floridae, Bf. Echinodermata: Paracentrotus lividus, Pl. Hemichordata: Saccoglossus kowalewski, Sk. Ecdysozoa: Acromyrmex echinatior, Ae; Caenorhabditis elegans, Ce, and Drosophila melanogaster, Dm. Lophotrochozoa: Capitella teleta, Ct; Crassostrea gigantea, Cg; Lottia gigantea, Lg, and Schistosoma japonicum, Sj. Cnidaria: Clytia hemisphaerica, Ch and N. vectensis. Porifera: A. queenslandica, Aq and Aphrocallistes vastus, Ap. Ctenophora: Mnemiopsis leidyi, Ml. Sequence alignment was made using ClustalW function of Bioedit (Hall 1999) and then manually improved. Highly divergent positions were removed using Gblock software (Castresana 2000). Branch support of Maximum Likelihood analyses were performed using aLRT SH-like method and bootstrap resampling using the ATGC-Montpellier website (www.atcg-montpellier.fr). According to ProtTest, the LG substitution model was used (Anisimova and Gascuel 2006). A Bayesian analysis
Schenkelaars et al.
was also performed using MrBayes software and 100 000 000 generations. Domain analyses were conducted using InterProScan4 software (www.ebi.ac.uk) whereas the KTXXXW motif was manually searched at the C-terminal end of proteins. Finally, metazoan amino acids sequences were manually examined in order to find characteristic residues that corroborate the discrimination of the different subfamilies found by the phylogenetic approach.
RESULTS
Evolution of Frizzled receptor
163
(545aa) whereas only one Fzd gene was found in O. minuta, OmFZDB (565aa) and four were detected in C. rubrum, CrFZD1 (545aa), CrFZD2 (589aa), CrFzd3 (604aa), and CrFZD4 (543aa). Tblastx searches against NCBI databases and InterProScan4 analyses confirmed that new sequences belong to the FZD family (Supplemental data S3). Moreover, newly discovered Fzd genes encode for proteins containing the CRD and including 10 highly conserved cysteine residues (Supplemental data S4). All these sequences have seven TMs whereas the characteristic KTXXXW motif is missing in the C-terminal tails of OlFZDA2, OcFZDA2, TaFZDA, and OmFZDB (Supplemental data S5).
Transcriptome quality and coverage Transcriptomes were compared to reference genomes (A. queenslandica for sponges and N. vectensis for C. rubrum) in order to estimate their relative coverage (Supplemental data S2). For instance, this analysis revealed that the number of orthologous proteins found in our transcriptomes is comparable to those found in previous studies in Cnidarians (e.g., KarakoLampert et al. 2014). Moreover, 50% of the total sequence length in the O. lobularis transcriptome (44.8 Mbp) is contained in 26,440 contigs of more than 570 bp; 50% of total sequence length in the O. minuta transcriptome (28.1 Mbp) is contained in 9133 contigs of more than 914 bp; and 50% of total sequence length in the C. rubrum transcriptome (87.3 Mbp) is contained in 10,493 contigs of more than 2470 bp. Further information concerning C. rubrum should be available in the near future (Pratlong et al. 2014, in press).
Characterization of FZD genes in Cnidaria, Porifera, and Placozoa Tblastn searches allowed us to identify two different scaffolds that potentially code for FZD proteins in the O. carmela genome. Scaffold analysis using GenScan revealed a 585aa sequence (OcFZDB) in the first scaffold whereas two other genes (OcFZDA1, 641aa and OcFZDA2, 559aa) were manually identified within the second one. O. lobularis transcriptomic database also revealed three putative FZD proteins. These sequences, termed OlFZDA1, OlFZDA2, and OlFZDB, encoded for proteins of 636, 614, and 573 amino acids, respectively. Moreover, PCR confirms that OlFzda1 and OlFzda2 are arranged in tandem along a same chromosome as it was suspected for OcFzda1 and OcFzda2. Thus, three Fzd genes including a two-gene cluster formed by Fzda1 and Fzda2 members were identified in both Oscarella sponges. The same approach was used on E. muelleri (Porifera, Demospongiae), O. minuta (Porifera, Hexactinellida), and C. rubrum (Cnidaria, Octocorallia) transcriptomes in addition to T. adhaerens genome (Placozoa). This enabled the characterization of two genes in E. muelleri and T. adhaerens, EmFZDA (568aa), EmFZDB (526aa), TaFZDA (548aa), and TaFZDB
Phylogenetic analyses Both ML and Bayesian analyses support that the 10 FZD paralogous vertebrate proteins FZD1 to FZD10 (represented here by Callorhinchus milii, Cm; Danio rerio, Dr; Homo sapiens, Hs, and Pseudopodoces humilis, Ph; Fig. 2 and Supplemental data S5) are clustered in five main subfamilies FZD1/2/7, FZD3/6, FZD4, FZD5/8, and FZD9/10. Interestingly, five Fzd genes have been characterized within the Urochordata C. intestinalis. Whereas CiFZD3/6, CiFZD4, CiFZD5/8, and CiFZD10 seem to be the orthologous proteins of corresponding vertebrate subfamilies, CiFZD1/2/7 also branches basally with vertebrate subfamily FZD3/6. In all other bilaterians, four of the five vertebrate FZD subfamilies (all except FZD3/6) appear to have representatives in the species included in this analysis (A. echinatior, B. floridae, C. elegans, C. gigantea, D. melanogaster, L. gigantea, P. lividus, S. kowalewski; Fig. 2). Moreover, only three FZDs were found in the Platyhelminth S. japonicum (SjFZD5, SjFZD7, and SjFZD9) and the annelid Capitella teleta (CtFZD2, CtFZD3, and CtFZD4). Nevertheless, whereas all analyses reveal the same four bilaterian groups (here designated as subfamilies FZDI to FZDIV), only ML analyses using the aLRT SHlikelihood method and Bayesian analysis well support each node (Supplemental data S5). As well, each bilaterian subfamily seems to have a cnidarian orthologous protein in the N. vectensis (Cnidaria, Hexacorallia), C. hemisphaerica (Cnidaria, Medusozoa) and C. rubrum (Cnidaria, Octocorallia). FZDA sequences from basally branching metazoans (A. queenslandica, E. muelleri, M. leidyi, O. carmela, O. lobularis, and T. adhaerens) cluster with FZDI subfamily. A second group, corresponding to OcFZDB and OlFZDB, branch with both FZDIII and FZDIV subfamilies. Finally, all other FZDB sequences (AqFZDB, AvFZDB, EmFZDB, OmFZDB, and TaFZDB) appear to group with long branches of the FZDIII subfamily. Concerning MlFZDB, its position is unclear depending on method of analysis. In some cases, it groups with the FZDIV subfamily (with ML þ aLRT) and sometimes it is clustered with FZDA within FZDI subfamily (with Bayesian method).
164
EVOLUTION & DEVELOPMENT
Vol. 17, No. 2, March–April 2015
Fig. 2. Bayesian phylogenetic unrooted tree of metazoan FZDs showing the four eumetazoan subfamilies and their respective FZD motifs (i.e., 1C-G-2C). Black triangles correspond to vertebrates subfamilies whereas white triangles correspond to non-vertebrate clusters. Black, grey, and white circles correspond to nodes supported (>0.75) by three, two, or only one method (ML þ aLRT support, ML þ Bootstrap support, and/or Bayesian). Asterisks correspond to non bilaterian species (Cnidaria, Porifera, Placozoa, and Ctenophora).
Characteristic amino acids The analysis of amino acid sequences allowed us to identify characteristic residues for each identified bilaterian subfamily. Amongst the most interesting, all proteins related to bilaterian FZDI subfamily (n ¼ 43) have a conserved glycine residue (G) at position 372 whereas 92% of the proteins corresponding to
other subfamilies (n ¼ 72) show an arginine residue (R) at the same position (Fig. 1 and Supplemental data S4). In addition, FZDII, FZDIII, and FZDIV subfamilies can be easily distinguished by different cysteine patterns (Fig. 1). Indeed, all bilaterian and cnidarian FZDII proteins (including vertebrate FZD5/8, n ¼ 24) have three adjacent cysteine residues within the poorly conserved region between the CRD and the first TM
Schenkelaars et al.
instead of the only one identified in all other subfamilies. In contrast, the absence of two cysteines in another poorly conserved region, between TM6 and TM7, seem to distinguish all FZDIV proteins (n ¼ 18). Finally, sequences from FZDIII subfamily (n ¼ 22 except NvFzd3) show exactly the same cysteine pattern than those of the FZDI subfamily (containing the G residue). Therefore, amino acids distribution tends to support the characterization of four FZD subfamilies. Hence, the FZDI subfamily is characterized by a 1C-G-2C pattern, the FZDII by a 1C-R-0C pattern, and the subfamily FZDIII by a 1C-R-2C pattern whereas FZDIV harbor a 3C-R-2C motif (Fig. 1). Regarding sequences of the basal lineages, FZDB sequences from O. carmela and O. lobularis contain a 1C-R-2C motif, which basically characterize the FZDIII clade where all other sponge sequences are found. As well, characteristic residues confirm the assignation of hexactinellid sequences to the FZDIII family. In contrast, other species show less conserved motifs preventing conclusions for these sequences using only the amino acids analysis: AqFZDB (1C-S-2C), EmFZDB (1C-A2C), MlFZDB (1C-S-2C), and TaFZDB (2C-R-1C). However, all FZDA proteins (except EmFZDA) show a 1C-G-2C motif like those found in the FZDI subfamilies.
DISCUSSION
Four ancestral FZD genes in bilaterians and cnidarians Our analyses show that vertebrate FZD sequences are clustered within five subfamilies: FZD1/2/7, FZD3/6, FZD5/8, FZD9/10, and FZD4 confirming previous results (Fredriksson et al. 2003; Adamska et al. 2010; Qian et al. 2013). Interestingly, the characterization of five orthologous FZDs in the vertebrate sister group, the Urochordata C. intestinalis, strongly suggests that all vertebrate sequences arise from the duplication of five ancestral FZDs that occurred after the Urochordata/vertebrate split (Fig. 3). More precisely, global organization of vertebrate paralogous genes reveals that most of them result from duplications during early evolution of vertebrates (Figs. 2 and 3) (Dehal and Boore 2005; Meyer and Van de Peer 2005 Kasahara 2007). Comparing other bilaterian species (except the Plathelminth S. japonicum and the annelid C. teleta) and cnidarians, we recovered orthologous genes of FZD1/2/7, FZD4, FZD5/8, and FZD9/10, whereas either in our phylogeny or in other publications, no FZD3/6 subfamily orthologs have been identified (Fig. 2; Adamska et al. 2010; Qian et al. 2013). Hence, this FZD subfamily appears as an innovation of both vertebrate and Urochordata derived from an ancestral sequence that gave rise to the FZD1/2/7 subfamily (Fig. 2). Consequently, we propose here to define four main subfamilies of FZD proteins at this phylogenetic scale: (i) subfamily I corresponding to
Evolution of Frizzled receptor
165
FZD1/2/7 subfamily; (ii) subfamily II containing vertebrate FDZ5, FZD8, and their orthologs; (iii) subfamily III with vertebrate FZD9, FZD10, and their orthologs; and (iv) subfamily IV containing FZD4. Concerning the fifth subfamily (previously called subfamily FZD3/6), it is likely an innovation that occurred in the last common ancestor of vertebrates and Urochordata and thus it can be included in subfamily I (Fig. 2). Taken together, phylogeny and amino acid characterization strongly supports that the last common ancestor of bilaterians and cnidarians already possessed four Fzd genes containing different motifs corresponding to each subfamily: (i) 1C-G-2C (subfamily I), (ii) 3C-R-2C (subfamily II), (iii) 1C-R-2C (subfamily III), and (iv) 1C-R-0C (subfamily IV) (Fig. 1).
Two FZD genes in common ancestor of Porifera The publication of the first sponge genome revealed components of the molecular toolkit of this early branching phylum and more generally, the origin and evolution of key gene families and molecular pathways in Metazoa (Adamska et al. 2011; Riesgo et al. 2014). Notably, research on the Wnt pathway components in A. queenslandica genome showed that two Fzd genes are carried by this sponge (Adamska et al. 2010). As one species cannot be considered as representative of all sponge lineages (Ereskovsky et al. 2009), we have searched FZD members in E. muelleri transcriptome (another Demospongiae), in two Homoscleromorpha species, and in O. minuta (a Hexactinellida). Our results confirm that the last common ancestor of Demospongiae possessed two Fzd genes as we also found only two orthologous Fzd transcripts in E. muelleri. In contrast, analyses of both O. carmela genome and O. lobularis transcripts revealed three Fzd genes in these sponges proving the importance of phylum level comparisons. Remarkably, two of the three genes identified in Oscarella species are carried by the same chromosome. Therefore, Oscarella Fzda1 and Fzda2 represent the first description of a Fzd gene cluster at the metazoan scale. As it was proposed for T-box clusters in mouse genomes, a likely explanation for this Fzd gene placement along the chromosome is that an unequal crossing over occurred between homologous chromosomes (Agulnik et al. 1996). More than a simple gene duplication, in this case, it seems that this event may have also duplicated a part of the regulatory sequence since expression patterns of OlFzda1 and OlFzda2 are highly similar (data not shown). This leads us to propose that both O. lobularis Fzda copies may have the same and relatively recent origin. Hence, phylogenetic and sequence analysis of sponge sequences suggest that the last common ancestor of sponges may have possessed only two Fzd genes (Fzda with the 1C-G-2C motif and Fzdb with the 1C-R-2C motif) and that a more recent, lineage specific, tandem duplication of Fzda occurred in the Homoscleromorpha lineage (at least in the
166
EVOLUTION & DEVELOPMENT
Vol. 17, No. 2, March–April 2015
Fig. 3. Evolution in Fzd genes in Metazoa. White arrows represent gene duplications of Fzda-like while black ones correspond to duplications of Fzdb-like. The numbers above each arrow correspond to the number of duplications. The white arrow with two cross circles represents the tandem duplication observed in the Oscarella genus. White background corresponds to FZDA-like proteins containing a G residue at position 372 whereas light grey background corresponds to FZDB-like proteins containing the R residue. Dark grey background designates proteins that do not contain a specific 372th residue and black background corresponds to proteins that are not found in the given transcriptome or genome. LCAM abbreviation is the last common ancestor of metazoans.
Schenkelaars et al.
Oscarella lineage) leading to Fzda1 and Fzda2 establishment (Fig. 3). To date, only one Fzdb have been identified in our transcriptomic database of O. minuta and A. vastus (Hexactinellida). Nevertheless, acquisition of new data for O. minuta is in progress and it will be necessary to confirm the apparent loss of Fzda in this lineage (genome and transcriptome by Amidex project 2013). Concerning Calcarea, a recent study has identified four Fzd sequences (Leininger et al. 2014). This discovery could be consistent with the hypothesis of two ancestral Fzd genes as data shown in this paper strongly suggests the tetraploid state of the species (2 Dvl, 2 Tcf, 2 Pl10, etc. instead of one in other sponge species) (Adamska et al. 2010).
Two FZD genes in the last common ancestor of metazoans We previously assessed that the last common ancestor of bilaterians and cnidarians already carried four Fzd members with 1C-G-2C, 3C-R-2C, 1C-R-2C, and 1C-R-0C motifs respectively (Figs. 1 and 3; Supplemental data S4). Moreover, we concluded that the last common ancestor of Porifera likely possessed only two Fzd genes, one containing the 1C-G-2C motif (Fzda) and a second one with a 1C-R-2C motif (Fzdb). In addition, the recent acquisition of the Mnemiopsis leidyi genome (Ctenophora) also reveals only two Fzd genes (including MlFZDA containing a 1C-G-2C motif; Pang et al. 2010). Moreover, here we report two FZDs (TaFZDA: 1C-G-2C and TaFZDB: 1C-R-1C) in the Placozoan T. adhaerens. Together, these results raise the possibility of understanding the ancestral Fzd content of the last common ancestor of Metazoa. In this regard, a parsimonious scenario retracing the putative origin and evolution of FZDs in metazoans can be described (Figs. 1 and 3). In this scenario, the last common ancestor of Metazoa may have possessed two Fzd genes (Fzda-like: 1C-G-2C and Fzdb-like: 1C-R-2C). Then, two Fzdb duplications followed by mutations in FZD motif would have occurred in the last common ancestor of bilaterians þ cnidarians clade, giving rise to the four reported subfamilies (Fig. 1). Thus, the subfamily I would have resulted from a unique and ancestral Fzda-like sequence whereas an ancestral Fzdb-like sequence would have given rise to all other sequences (subfamily II, III, and IV).
Characteristics of ancestral FZD proteins The finding that the last common ancestor of Metazoa likely possessed two Fzd genes raises questions concerning their appearance and their molecular interactions. In order to retrace the Fzd origin, several clues can be collected from the amino acid sequences. Domain analyses of FZDs revealed putative features of the two paralogous ancestral proteins. Indeed, all sequences show the succession of seven trans-membrane domains (7TMs) indicating that these ancestral FZD proteins
Evolution of Frizzled receptor
167
were anchored in the cell surface and thus probably already able to mediate information between extra-cellular environment and the cytoplasm. The systematic occurrence of the cysteine rich domain at the N-terminal end of current sequences, even in basal species, reinforces the notion that the early proteins may have interacted with extracellular proteins such as WNTs or LRPs (Dann et al. 2001; Povelones and Nusse 2005; Rao and K€uhl 2010; Niehrs 2012). The KTXXXW motif, described as a crucial motif to transduce Wnt signal to disheveled (DSH) (Umbhauer et al. 2000; Huang and Klein 2004; Punchihewa et al. 2009; Tauriello et al. 2012), was also probably present in the last common FZD proteins as these residues are found in most sequences (Supplemental data S4). Consequently, we suggest that the ancestral FZD protein sequences already functioned as bridges between extra- and intra-cellular environments and were able to transduce the signal of ancestral WNTs to a cytoplasmic DVL-like protein.
Evolution of FZD subfamilies and FZD functions The high conservation of both G and R residues (respectively in FZA-like and FZB-like clades) at the 372th position indicates that these amino acids are likely essential for protein function (Supplemental data S4). Furthermore, because of their localization inside the second TM of the protein (Fig. 1), it is unlikely that this conserved amino acid distribution within subfamilies is due to convergence. Although cysteine residues are one of the least abundant amino acids, they often occur in functional sites of proteins (Marino and Gladyshev 2010). Moreover, as cysteines play an important role in protein conformation and protein–protein interactions, this residue is subjected to a high selection pressure, and thus tends to be either completely degenerated or deeply conserved. Thus, changes in cysteine patterns that have occurred in subfamilies II and IV and their strict conservation within their respective subfamily indicate that these changes in residues are required for a specific subfamily function such as a particular protein–protein interaction or a particular FDZ conformation. This is highlighted as differences in cysteine patterns were localized outside of the TMs (between CRD and the first TM or between TM6 and TM7; Fig. 1) where they are thus accessible for different kinds of interactions. Thus, each duplication of Fzdb-like genes in the last common ancestor of bilaterians and cnidarians could have been followed by the acquisition of a new cysteine motif in one of the two daughter sequences (Fig. 1). In contrast, the second one has conserved the ancestral residues (1C-R-2C) and thus an ancestral function (Fig. 1). Therefore, the presence of three cysteines within subfamily II (instead of one) and the absence of cysteine in subfamily IV (instead of two) are likely derived characters which led to the acquisition of new function. Hence, our investigation of cysteine patterns within the different
168
EVOLUTION & DEVELOPMENT
Vol. 17, No. 2, March–April 2015
subfamilies may have revealed neo-functionalization of both subfamilies II and IV by changes in cysteine motifs while the subfamily IV may have conserved a more “ancestral function”. Consequently, functional studies targeting these residues may help to better understand the precise mechanisms that control the affinity of the different FZD members for different ligands, different co-receptors and thus for different pathways. To conclude, in this study, we demonstrate that the last common ancestor of Metazoa already possessed two functional Fzd genes (Fzda-like and Fzdb-like). These two ancestral genes were conserved in Cnidaria, Placozoa, Ctenophora, and Porifera with a tandem duplication that occurred in the Oscarella genus, giving rise to the first descrition of a Fzd cluster (Fzda1 and Fzda2). In contrast, two duplications of Fzdb-like gene took place in the last common ancestor of bilaterians and cnidarians explaining the four paralogous members (belonging to subfamilies I, II, III, and IV) found in most species of this clade. Finally, several duplications during early evolution of vertebrates led to the high number of paralogs in vertebrates. Amino acid sequence analyses revealed that the 372th residue and the cysteine motif are diagnostic for a new classification of FZD proteins in four subfamilies. Indeed, while the 1C-G-2C is characteristic of the subfamily I; subfamilies II, III, and IV can be easily and quickly discriminated by their cysteine motif (3C-R-2C, 1C-R-2C and 1C-R-0C motifs, respectively). Furthermore, the deviation in cysteine motifs within subfamilies II and IV maybe considered as an essential and sufficient explanation for the neo-functionalization or the sub-functionalization of FZD families in eumetazoan species. Hence, the duplication of FZD members in bilaterians and cnidarians followed by potential neo-functionalization (due to modifications in cysteine pattern) provides us a new framework for further research in order to better understand the precise mechanisms that have driven FZD evolution and the diversity of eumetazoan body plans. Acknowledgments This work has been carried out thanks to the support of the A*MIDEX project (n°ANR-11-IDEX-0001-02) funded by the “Investissements d’Avenir” French Government program, managed by the French National Research Agency (ANT). This university foundation A*MIDEX supports the “Spongex” project in order to develop the poriferan models Oscarella lobularis and Oopsacas minuta. We also gratefully acknowledge M. Pratlong, A. Haguenauer, P. Pontarotti, and D. Aurelle for helping us and giving us the opportunity to use their Corallium rubrum data and the ECCOREV Research foundation (FR 3098) that financed the production of C. rubrum transcriptome. We also thank S.P. Leys for providing us sequences from Ephydatia muelleri transcriptomic database.
REFERENCES Adamska, M., Degnan, B. M., Green, K., and Zwafink, C. 2011. What sponges can tell us about the evolution of developmental processes. Zoology 114: 1–10.
Adamska, M., et al. 2010. Structure and expression of conserved Wnt pathway components in the demosponge Amphimedon queenslandica: Wnt pathway components in Amphimedon queenslandica. Evol. Dev. 12: 494–518. Adler, P. N. 2002. Planar signaling and morphogenesis in drosophila. Dev Cell 2: 525–535. Agulnik, S. I., et al. 1996. Evolution of mouse T-box genes by tandem duplication and cluster dispersion. Genetics 144: 249–254. Altschul, S. F., et al. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389–3402. van Amerongen, R., and Nusse, R. 2009. Towards an integrated view of Wnt signaling in development. Development 136: 3205–3214. Anisimova, M., and Gascuel, O. 2006. Approximate likelihood-ratio test for branches: a fast, accurate, and powerful alternative. Syst. Biol. 55: 539– 552. Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 17: 540–552. Dann, C. E., Hsieh, J. C., Rattner, A., Sharma, D., Nathans, J., and Leahy, D. J. 2001. Insights into Wnt binding and signalling from the structures of two Frizzled cysteine-rich domains. Nature 412: 86–90. Dehal, P., and Boore, J. L. 2005. Two rounds of whole genome duplication in the ancestral vertebrate. PLoS Biol. 3: e314. Dohrmann, M., Janussen, D., Reitner, J., Collins, A., and Worheide, G. 2008. Phylogeny and evolution of glass sponges (Porifera, Hexactinellida). Syst. Biol. 57: 388–405. Ereskovsky, A. V., et al. 2009. The Homoscleromorph sponge Oscarella lobularis, a promising sponge model in evolutionary and developmental biology: model sponge Oscarella lobularis. BioEssays News Rev. Mol. Cell. Dev. Biol. 31: 89–97. Fredriksson, R., Lagerstr€ om, M. C., Lundin, L-G., and Schi€ oth, H. B. 2003. The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Mol. Pharmacol. 63: 1256–1272. Gazave, E., et al. 2009. Origin and evolution of the Notch signalling pathway: an overview from eukaryotic genomes. BMC Evol. Biol. 9: 249. Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41: 95–98. Huang, H-C., and Klein, P. S. 2004. The frizzled family: receptors for multiple signal transduction pathways. Genome Biol. 5: 234. Karako-Lampert, S., et al. 2014. Transcriptome analysis of the scleractinian coral stylophora pistillata. PLoS ONE 9: e88615. Kasahara, M. 2007. The 2R hypothesis: an update. Curr. Opin. Immunol. 19: 547–552. Larroux, C., Luke, G. N., Koopman, P., Rokhsar, D. S., Shimeld, S. M., and Degnan, B. M. 2008. Genesis and expansion of metazoan transcription factor gene classes. Mol. Biol. Evol. 25: 980–996. Leininger, S., et al. 2014. Developmental gene expression provides clues to relationships between sponge and eumetazoan body plans. Nat. Commun. 5, doi: 10.1038/ncomms4905. Marino, S. M., and Gladyshev, V. N. 2010. Cysteine function governs its conservation and degeneration and restricts its utilization on protein surfaces. J. Mol. Biol. 404: 902–916. McNeill, H. 2009. Planar cell polarity: keeping hairs straight is not so simple. Cold Spring Harb. Perspect. Biol. 2: a003376–a003376. Meyer, A., and Van de Peer, Y. 2005. From 2R to 3R: evidence for a fishspecific genome duplication (FSGD). BioEssays 27, 937–945. Nichols, S. A., Dirks, W., Pearse, J. S., and King, N. 2006. Early evolution of animal cell signaling and adhesion genes. Proc. Natl. Acad. Sci. 103: 12451–12456. Niehrs, C. 2012. The complex world of WNT receptor signalling. Nat. Rev. Mol. Cell. Biol. 13: 767–779. Nosenko, T., et al. 2013. Deep metazoan phylogeny: when different genes tell different stories. Mol. Phylogenet. Evol. 67: 223–233. Nusse, R., and Varmus, H. 2012. Three decades of Wnts: a personal perspective on how a scientific field developed. EMBO J. 31: 2670–2684. Pang, K., Ryan, J. F., Mullikin, J. C., Baxevanis, A. D., and Martindale, M. Q. 2010. Genomic insights into Wnt signaling in an early diverging metazoan, the ctenophore Mnemiopsis leidyi. EvoDevo 1: 10–10.
Schenkelaars et al.
Pei, J., and Grishin, N. V. 2012. Cysteine-rich domains related to Frizzled receptors and Hedgehog-interacting proteins. Protein Sci. 21: 1172– 1184. Peterson, K. J., and Sperling, E. A. 2007. Poriferan ANTP genes: primitively simple or secondarily reduced. Evol. Dev. 9: 405–408. Philippe, H., et al. 2009. Phylogenomics revives traditional views on deep animal relationships. Curr. Biol. 19: 706–712. Pick, K. S., et al. 2010. Improved phylogenomic taxon sampling noticeably affects nonbilaterian relationships. Mol. Biol. Evol. 27: 1983–1987. Povelones, M., and Nusse, R. 2005. The role of the cysteine-rich domain of Frizzled in Wingless-Armadillo signaling. EMBO J. 24: 3493–3503. Pratlong, M., Haguenauer, A., Chabrol, O., Klopp, C., Pontarotti, P., and Aurelle, D. 2015. The red coral (Corallium rubrum) transcriptome: a new resource for population genetics and local adaptation studies. Mol. Ecol. Resour. In press. Punchihewa, C., Ferreira, A. M., Cassell, R., Rodrigues, P., and Fujii, N. 2009. Sequence requirement and subtype specificity in the high-affinity interaction between human frizzled and dishevelled proteins. Protein Sci. 18: 994–1002. Qian, G., Li, G., Chen, X., and Wang, Y. 2013. Characterization and embryonic expression of four amphioxus Frizzled genes with important functions during early embryogenesis. Gene Expr. Patterns 13: 445–453. Rao, T. P., and K€ uhl, M. 2010. An updated overview on Wnt signaling pathways: a prelude for more. Circ. Res. 106: 1798–1806. Richards, G. S., and Degnan, B. M. 2009. The dawn of developmental signaling in the Metazoa. Cold Spring Harb. Symp. Quant. Biol. 74: 81–90. Riesgo, A., Farrar, N., Windsor, P. J., Giribet, G., and Leys, S. P. 2014. The analysis of eight transcriptomes from all Porifera classes reveals surprising genetic complexity in sponges. Mol. Biol. Evol. doi: 10.1093/molbev/msu057 Ryan, J. F., et al. 2013. The genome of the ctenophore mnemiopsis leidyi and its implications for cell type evolution. Science 342: 1242592. Schulte, G. 2010. International union of basic and clinical pharmacology. LXXX. The class Frizzled receptors. Pharmacol. Rev. 62: 632–667. Simons, M., and Mlodzik, M. 2008. Planar cell polarity signaling: from fly development to human disease. Annu. Rev. Genet. 42: 517–540. Van Soest, R. W. M., et al. 2012. Global diversity of sponges (Porifera). PLoS ONE 7(4): e35105 doi: 10.1371/journal.pone.0035105. Sperling, E. A., Pisani, D., and Peterson, K. J. 2007. Poriferan paraphyly and its implications for Precambrian palaeobiology. Geol. Soc. Lond. Spec. Publ. 286: 355–368. Srivastava, M., et al. 2008. The Trichoplax genome and the nature of placozoans. Nature 454: 955–960. Srivastava, M., et al. 2010. The Amphimedon queenslandica genome and the evolution of animal complexity. Nature 466: 720–726. Stathopoulos, A., and Levine, M. 2005. Genomic regulatory networks and animal development. Dev. Cell 9: 449–462. Strutt, D., Madder, D., Chaudhary, V., and Artymiuk, P. J. 2012. Structurefunction dissection of the frizzled receptor in drosophila melanogaster suggests different mechanisms of action in planar polarity and canonical Wnt signaling. Genetics 192: 1295–1313.
Evolution of Frizzled receptor
169
Tauriello, D. V. F., et al. 2012. Wnt/ -catenin signaling requires interaction of the Dishevelled DEP domain and C terminus with a discontinuous motif in Frizzled. Proc. Natl. Acad. Sci. USA 109, E812–E820. Umbhauer, M., et al. 2000. The C-terminal cytoplasmic Lys-thr-X-X-X-Trp motif in frizzled receptors mediates Wnt/beta-catenin signalling. EMBO J. 19: 4944–4954. Vinson, C. R., Conover, S., and Adler, P. N. 1989. A Drosophila tissue polarity locus encodes a protein containing seven potential transmembrane domains. Nature 338: 263–264.
SUPPORTING INFORMATION Additional supporting information may be found in the online version of this article at the publisher’s web-site. Fig. S1. Accession numbers of sequences used for phylogeny and amino acid analyses. Fig. S2. Venn diagrams comparing Oscarella lobularis (Porifera, Homoscleromorpha), Oopsacas minuta (Porifera, Hexactinellida), and Corallium rubrum (Cnidaria, Octocorallia) transcritomes to the referenced genomes, Amphimedon queenslandica (Porifera, Demospongiae) and Nematostella vectensis (Cnidaria, Hexacorallia). Fig. S3. Information on newly discovered Fzd genes: name, accession number, and NCBI tblastx score (top hit and e-value). Fig. S4. Frizzled alignment highlighting the 10 cysteine residues composing the Cysteine Rich Domain (purple), the KTXXXW motif (green), and the diagnostic residues for four bilaterian and cnidarian FZD subfamilies: cysteine amino acids (red) and the 372th residue (yellow or blue). Fig. S5. Phylogenetic trees using Bayesian methodology with 100.000.000 generations (A), Maximum Likelihood and the aLRT SH-like method (B) and Maximum Likelihood method with 1000 bootstrap re-sampling. Black triangles correspond to vertebrate subfamilies.
17:2, 160–169 (2015)
DOI: 10.1111/ede.12115
Insights into Frizzled evolution and new perspectives Quentin Schenkelaars,a,* Laura Fierro-Constain,a Emmanuelle Renard,a April L. Hill,b and Carole Borchiellinia,* a , IMBE UMR CNRS 7263, Institut Me diterrane en de Biodiversite et d'Ecologie marine et Aix-Marseille Universite continentale, Station Marine d'Endoume, Marseille, France b Department of Biology, University of Richmond, Richmond, VA, USA *Author for correspondence (e-mail: [email protected]; [email protected])
SUMMARY The Frizzled proteins (FZDs) are a family of trans-membrane receptors that play pivotal roles in Wnt pathways and thus in animal development. Based on evaluation of the Amphimedon queenslandica genome, it has been proposed that two Fzd genes may have been present before the split between demosponges and other animals. The major purpose of this study is to go deeper into the evolution of this family of proteins by evaluating an extended set of available data from bilaterians, cnidarians, and different basally branching animal lineages (Ctenophora,
Placozoa, Porifera). The present study provides evidence that the last common ancestor of metazoans did possess two Fzd genes, and that the last common ancestor of cnidarians and bilaterians may have possessed four Fzd. Furthermore, amino acid analyses revealed an accurate diagnostic motif for these four FZD subfamilies facilitating the assignation of Frizzled paralogs to each subfamily. By highlighting conserved amino acids for each FZD subfamily, our study could also provide a framework for further research on the precise mechanisms that have driven FZD neo-functionalization.
INTRODUCTION
FZDs are major and pivotal receptor proteins of Wnt pathways, retracing the evolution of this family and highlighting critical amino acid composition at the metazoan scale should provide us key data for cross phyla comparisons and for understanding function of FZD family members. Whereas 10 FZDs have been identified in most vertebrates, only 4 Frizzled members seem to be carried by most bilaterians (van Amerongen and Nusse 2009; Qian et al. 2013). Concerning Cnidaria and more basally branching lineages (placozoans, ctenophores, and poriferans), only a few data sets are currently available (Pang et al. 2010; Riesgo et al. 2014). These lineages are presently represented by only one whole genome: Nematostella vectensis for Cnidaria, Trichoplax adhaerens for Placozoa, Mnemiopsis leydii for Ctenophora, and Amphimedon queenslandica for Porifera (Pang et al. 2010; Srivastava et al. 2008, 2010). In addition, FZDs have not been reported in T. adhaerens. This limited sampling would likely yield artifactual conclusions, especially for Porifera which is a highly diversified phylum with more than 8000 described species separated into four clearly distinct classes: Demospongiae, Hexactinellida, Calcarea, and Homoscleromorpha (Dohrmann et al. 2008; Gazave et al. 2009; Van Soest et al. 2012). Thus, previous studies describing the main components of the Wnt pathways in non-bilaterians suffer from the lack of phylum specific comparisons and the lack of robust phylogenetic hypotheses at the basis of the metazoan tree (Sperling et al. 2007; Nosenko et al. 2013; Ryan et al. 2013) that would yield to a more complete view of Fzd evolution.
The Wnt signaling pathways have been extensively investigated as one of the major regulatory modules for animal development (Stathopoulos and Levine 2005; Nichols et al. 2006; Richards and Degnan 2009; Niehrs 2012; Nusse and Varmus 2012). The Wnt pathways are complex gene networks involving evolutionarily conserved components such as the seven trans-membrane receptor Frizzled (FZD) (Schulte 2010; Niehrs 2012). Receptors of the Frizzled family contain an N-terminal Cysteine rich domain (CRD) followed by seven trans-membrane domains (TMs) and an N-terminus with a KTXXXW motif (Fig. 1; Huang and Klein 2004; Punchihewa et al. 2009; Strutt et al. 2012). The extracellular CRD is involved in WNT recognition (Dann et al. 2001; Pei and Grishin 2012), while the seven TMs allow the protein to anchor to the cell surface. Concerning the KTXXXW motif it is required for signal transduction to the cytoplasmic protein called Dishevelled (DVL) (Huang and Klein 2004; Punchihewa et al. 2009; Strutt et al., 2012; Tauriello et al., 2012). The Frizzled family was first described as proteins controlling hair polarity in the Drosophila wing (Vinson et al. 1989; Adler 2002; Simons and Mlodzik 2008; McNeill 2009). Since that time, FZDs have been described as important pivotal proteins for dispatching WNT signals to different transduction cascades such as the b-catenin pathway, the Rho-Rock pathway, or the Planar Cell Polarity pathway (PCP) (Fig. 1; Simons and Mlodzik 2008; Rao and K€uhl 2010; Schulte 2010). Because 160
© 2015 Wiley Periodicals, Inc.
Schenkelaars et al.
Evolution of Frizzled receptor
161
Fig. 1. Schematic of the putative ancestral FZD proteins and hypothesis for the evolution of the Frizzled family in metazoan evolution. This schematic shows how the four eumetazoan subfamilies likely arose from two ancestral Fzd (Fzda-like and Fzdb-like) genes, highlighting their respective diagnostic motifs (i.e., 1C-G-2C). In addition, domain composition is shown as well as some downstream signaling pathways: the canonical Wnt pathway, the Rho/Rock pathway, and the planar cell polarity pathway.
Previous analyses showed that the Wnt pathway is less complex in basal lineages than in bilaterians or cnidarians with a restricted number of genes. Adamska et al. (2010) reported the presence of two ancestral Fzd genes from the A. queenslandica genome (Porifera, Demospongiae). However, several studies have reported that the A. queenslandica genome has many gene
losses even compared to other sponges (Peterson and Sperling 2007; Larroux et al. 2008; Gazave et al. 2009) which highlights why one species cannot be considered as representative of a whole phylum. Thus, in order to better understand the evolution of this gene family at the metazoan scale, it is important to characterize Fzd genes in other sponge lineages and to take a
162
EVOLUTION & DEVELOPMENT
Vol. 17, No. 2, March–April 2015
comparative and global approach for understanding the relationships between the different FZD members. Here, we characterized Fzd members in Corallium rubrum (Cnidaria, Octocorallia), several sponge species: Oscarella lobularis, Oscarella carmela (Homoscleromorpha), Ephydatia muelleri (Demospongiae), and Oopsacas minuta (Hexactinellida) and in T. adhaerens in order to evaluate the ancestral FZD content of basally branching animals (including the first report of FZD in Placozoa) in context with data obtained in Cnidaria and Bilateria. Then, we investigated the main metazoan lineages and the distribution of their FZDs within the phylogenetic tree to infer orthologous relationships and to determine how this family has evolved from sponges to vertebrates. Finally, analysis of characteristic amino acids improves our understanding of phylogenetic relationships and permits a description of diagnostic residues for the different subfamilies which should facilitate assignation of highly divergent sequences. Thus, this study proposes an evolutionary scenario of fzd genes and draws attention to some residues (especially cysteines) that may have allowed neo-functionalization in eumetazoan lineages.
METHODS AND MATERIALS
More complete analysis of each transcriptome, such as the total number of contigs or the total length of sequence was evaluated.
Sequence acquisition Fzd sequences were searched within O. carmela genome (http:// www.compagen.org/) using BioEdit tblastn function (Altschul et al. 1997) with 1.0 as threshold e-value. Then, proteins were predicted by GenScan software (http://genes.mit.edu/GENSCAN.html) or manually. Fzd transcripts were also identified in the O. lobularis transcriptomic database using the same approach. Since OcFZDA1 and OcFZDA2 were predicted by GenScan on the same scaffold, a PCR using a forward primer designed at the 30 terminal end of OlFZDA1 and a reverse primer at the 50 terminal end of OlFZDA2 was made in order to confirm if whether or not these sequences are also located on the same chromosome in O. lobularis (primers: TTTCTGTTTCGCTGTCGATG and CGATTGTAGAACTGACGGCA). As well, O. minuta, E. muelleri, and C. rubrum transcriptomes were investigated for the presence of Fzd genes in addition to the T. adhaerens genome (http://metazoa. ensembl.org/Trichoplax_adhaerens/Info/Index).
Transcriptomic constructions Samples of O. lobularis were collected in the Marseille Bay. A specimen containing many embryos at different developmental stages has been sent to Eurofins mwg/operon for cDNA library construction and 454 sequencing. Total RNA was isolated and purified from sponge tissue. Poly(A) RNA was isolated and used as template for cDNA synthesis. First-stand cDNA synthesis was primed with an N6 randomized primer and 454 adaptaters were ligated. The cDNA was amplified by a proof-reading PCR and cDNAs in the size range of 500–1100 bp were sequenced. The transcriptomic database was created by a de novo assembly method. O. minuta transcriptome was constructed using exactly the same approach. C. rubrum have been obtained from a previously obtained transcriptome database (Pratlong et al. in press) that was constructed using mRNA from 12 specimens. Sequences were obtained and provided by the GenoToul platform using the Illumina HiSeq2000 Sequencing system.
Evaluation of transcriptomes quality and coverage The longest ORF was identified for each contig. ORFs smaller than 120 bp were removed whereas others were searched using BLAST against the referenced genome (N. vectensis for C. rubrum and A. queenslandica for sponges) with a fixed threshold value: 105. The number of orthologous proteins of those predicted for the referenced genome was estimated for each transcriptome by the number of different best hits.
Sequence assignation Sequence assignations to the FZD family were performed using reverse tblastx on NCBI (www.ncbi.nlm.nih.gov) and domain analyses. Subfamilies were highlighted by two other complementary studies: phylogenetic analysis and amino acid analysis. Sequences of interest were collected from UNIPROT or NCBI website (www.uniprot.org, http://www.ncbi.nlm.nih.gov/ ); see Supplemental data S1). All paralogous Fzd genes from main metazoan groups were gathered. Vertebrata: Callorhinchus milii, Cm; Danio rerio, Dr; Homo sapiens, Hs, and Pseudopodoces humilis, Ph. Urochordata: Ciona intestinalis, Ci. Cephalochordata: Branchiostoma floridae, Bf. Echinodermata: Paracentrotus lividus, Pl. Hemichordata: Saccoglossus kowalewski, Sk. Ecdysozoa: Acromyrmex echinatior, Ae; Caenorhabditis elegans, Ce, and Drosophila melanogaster, Dm. Lophotrochozoa: Capitella teleta, Ct; Crassostrea gigantea, Cg; Lottia gigantea, Lg, and Schistosoma japonicum, Sj. Cnidaria: Clytia hemisphaerica, Ch and N. vectensis. Porifera: A. queenslandica, Aq and Aphrocallistes vastus, Ap. Ctenophora: Mnemiopsis leidyi, Ml. Sequence alignment was made using ClustalW function of Bioedit (Hall 1999) and then manually improved. Highly divergent positions were removed using Gblock software (Castresana 2000). Branch support of Maximum Likelihood analyses were performed using aLRT SH-like method and bootstrap resampling using the ATGC-Montpellier website (www.atcg-montpellier.fr). According to ProtTest, the LG substitution model was used (Anisimova and Gascuel 2006). A Bayesian analysis
Schenkelaars et al.
was also performed using MrBayes software and 100 000 000 generations. Domain analyses were conducted using InterProScan4 software (www.ebi.ac.uk) whereas the KTXXXW motif was manually searched at the C-terminal end of proteins. Finally, metazoan amino acids sequences were manually examined in order to find characteristic residues that corroborate the discrimination of the different subfamilies found by the phylogenetic approach.
RESULTS
Evolution of Frizzled receptor
163
(545aa) whereas only one Fzd gene was found in O. minuta, OmFZDB (565aa) and four were detected in C. rubrum, CrFZD1 (545aa), CrFZD2 (589aa), CrFzd3 (604aa), and CrFZD4 (543aa). Tblastx searches against NCBI databases and InterProScan4 analyses confirmed that new sequences belong to the FZD family (Supplemental data S3). Moreover, newly discovered Fzd genes encode for proteins containing the CRD and including 10 highly conserved cysteine residues (Supplemental data S4). All these sequences have seven TMs whereas the characteristic KTXXXW motif is missing in the C-terminal tails of OlFZDA2, OcFZDA2, TaFZDA, and OmFZDB (Supplemental data S5).
Transcriptome quality and coverage Transcriptomes were compared to reference genomes (A. queenslandica for sponges and N. vectensis for C. rubrum) in order to estimate their relative coverage (Supplemental data S2). For instance, this analysis revealed that the number of orthologous proteins found in our transcriptomes is comparable to those found in previous studies in Cnidarians (e.g., KarakoLampert et al. 2014). Moreover, 50% of the total sequence length in the O. lobularis transcriptome (44.8 Mbp) is contained in 26,440 contigs of more than 570 bp; 50% of total sequence length in the O. minuta transcriptome (28.1 Mbp) is contained in 9133 contigs of more than 914 bp; and 50% of total sequence length in the C. rubrum transcriptome (87.3 Mbp) is contained in 10,493 contigs of more than 2470 bp. Further information concerning C. rubrum should be available in the near future (Pratlong et al. 2014, in press).
Characterization of FZD genes in Cnidaria, Porifera, and Placozoa Tblastn searches allowed us to identify two different scaffolds that potentially code for FZD proteins in the O. carmela genome. Scaffold analysis using GenScan revealed a 585aa sequence (OcFZDB) in the first scaffold whereas two other genes (OcFZDA1, 641aa and OcFZDA2, 559aa) were manually identified within the second one. O. lobularis transcriptomic database also revealed three putative FZD proteins. These sequences, termed OlFZDA1, OlFZDA2, and OlFZDB, encoded for proteins of 636, 614, and 573 amino acids, respectively. Moreover, PCR confirms that OlFzda1 and OlFzda2 are arranged in tandem along a same chromosome as it was suspected for OcFzda1 and OcFzda2. Thus, three Fzd genes including a two-gene cluster formed by Fzda1 and Fzda2 members were identified in both Oscarella sponges. The same approach was used on E. muelleri (Porifera, Demospongiae), O. minuta (Porifera, Hexactinellida), and C. rubrum (Cnidaria, Octocorallia) transcriptomes in addition to T. adhaerens genome (Placozoa). This enabled the characterization of two genes in E. muelleri and T. adhaerens, EmFZDA (568aa), EmFZDB (526aa), TaFZDA (548aa), and TaFZDB
Phylogenetic analyses Both ML and Bayesian analyses support that the 10 FZD paralogous vertebrate proteins FZD1 to FZD10 (represented here by Callorhinchus milii, Cm; Danio rerio, Dr; Homo sapiens, Hs, and Pseudopodoces humilis, Ph; Fig. 2 and Supplemental data S5) are clustered in five main subfamilies FZD1/2/7, FZD3/6, FZD4, FZD5/8, and FZD9/10. Interestingly, five Fzd genes have been characterized within the Urochordata C. intestinalis. Whereas CiFZD3/6, CiFZD4, CiFZD5/8, and CiFZD10 seem to be the orthologous proteins of corresponding vertebrate subfamilies, CiFZD1/2/7 also branches basally with vertebrate subfamily FZD3/6. In all other bilaterians, four of the five vertebrate FZD subfamilies (all except FZD3/6) appear to have representatives in the species included in this analysis (A. echinatior, B. floridae, C. elegans, C. gigantea, D. melanogaster, L. gigantea, P. lividus, S. kowalewski; Fig. 2). Moreover, only three FZDs were found in the Platyhelminth S. japonicum (SjFZD5, SjFZD7, and SjFZD9) and the annelid Capitella teleta (CtFZD2, CtFZD3, and CtFZD4). Nevertheless, whereas all analyses reveal the same four bilaterian groups (here designated as subfamilies FZDI to FZDIV), only ML analyses using the aLRT SHlikelihood method and Bayesian analysis well support each node (Supplemental data S5). As well, each bilaterian subfamily seems to have a cnidarian orthologous protein in the N. vectensis (Cnidaria, Hexacorallia), C. hemisphaerica (Cnidaria, Medusozoa) and C. rubrum (Cnidaria, Octocorallia). FZDA sequences from basally branching metazoans (A. queenslandica, E. muelleri, M. leidyi, O. carmela, O. lobularis, and T. adhaerens) cluster with FZDI subfamily. A second group, corresponding to OcFZDB and OlFZDB, branch with both FZDIII and FZDIV subfamilies. Finally, all other FZDB sequences (AqFZDB, AvFZDB, EmFZDB, OmFZDB, and TaFZDB) appear to group with long branches of the FZDIII subfamily. Concerning MlFZDB, its position is unclear depending on method of analysis. In some cases, it groups with the FZDIV subfamily (with ML þ aLRT) and sometimes it is clustered with FZDA within FZDI subfamily (with Bayesian method).
164
EVOLUTION & DEVELOPMENT
Vol. 17, No. 2, March–April 2015
Fig. 2. Bayesian phylogenetic unrooted tree of metazoan FZDs showing the four eumetazoan subfamilies and their respective FZD motifs (i.e., 1C-G-2C). Black triangles correspond to vertebrates subfamilies whereas white triangles correspond to non-vertebrate clusters. Black, grey, and white circles correspond to nodes supported (>0.75) by three, two, or only one method (ML þ aLRT support, ML þ Bootstrap support, and/or Bayesian). Asterisks correspond to non bilaterian species (Cnidaria, Porifera, Placozoa, and Ctenophora).
Characteristic amino acids The analysis of amino acid sequences allowed us to identify characteristic residues for each identified bilaterian subfamily. Amongst the most interesting, all proteins related to bilaterian FZDI subfamily (n ¼ 43) have a conserved glycine residue (G) at position 372 whereas 92% of the proteins corresponding to
other subfamilies (n ¼ 72) show an arginine residue (R) at the same position (Fig. 1 and Supplemental data S4). In addition, FZDII, FZDIII, and FZDIV subfamilies can be easily distinguished by different cysteine patterns (Fig. 1). Indeed, all bilaterian and cnidarian FZDII proteins (including vertebrate FZD5/8, n ¼ 24) have three adjacent cysteine residues within the poorly conserved region between the CRD and the first TM
Schenkelaars et al.
instead of the only one identified in all other subfamilies. In contrast, the absence of two cysteines in another poorly conserved region, between TM6 and TM7, seem to distinguish all FZDIV proteins (n ¼ 18). Finally, sequences from FZDIII subfamily (n ¼ 22 except NvFzd3) show exactly the same cysteine pattern than those of the FZDI subfamily (containing the G residue). Therefore, amino acids distribution tends to support the characterization of four FZD subfamilies. Hence, the FZDI subfamily is characterized by a 1C-G-2C pattern, the FZDII by a 1C-R-0C pattern, and the subfamily FZDIII by a 1C-R-2C pattern whereas FZDIV harbor a 3C-R-2C motif (Fig. 1). Regarding sequences of the basal lineages, FZDB sequences from O. carmela and O. lobularis contain a 1C-R-2C motif, which basically characterize the FZDIII clade where all other sponge sequences are found. As well, characteristic residues confirm the assignation of hexactinellid sequences to the FZDIII family. In contrast, other species show less conserved motifs preventing conclusions for these sequences using only the amino acids analysis: AqFZDB (1C-S-2C), EmFZDB (1C-A2C), MlFZDB (1C-S-2C), and TaFZDB (2C-R-1C). However, all FZDA proteins (except EmFZDA) show a 1C-G-2C motif like those found in the FZDI subfamilies.
DISCUSSION
Four ancestral FZD genes in bilaterians and cnidarians Our analyses show that vertebrate FZD sequences are clustered within five subfamilies: FZD1/2/7, FZD3/6, FZD5/8, FZD9/10, and FZD4 confirming previous results (Fredriksson et al. 2003; Adamska et al. 2010; Qian et al. 2013). Interestingly, the characterization of five orthologous FZDs in the vertebrate sister group, the Urochordata C. intestinalis, strongly suggests that all vertebrate sequences arise from the duplication of five ancestral FZDs that occurred after the Urochordata/vertebrate split (Fig. 3). More precisely, global organization of vertebrate paralogous genes reveals that most of them result from duplications during early evolution of vertebrates (Figs. 2 and 3) (Dehal and Boore 2005; Meyer and Van de Peer 2005 Kasahara 2007). Comparing other bilaterian species (except the Plathelminth S. japonicum and the annelid C. teleta) and cnidarians, we recovered orthologous genes of FZD1/2/7, FZD4, FZD5/8, and FZD9/10, whereas either in our phylogeny or in other publications, no FZD3/6 subfamily orthologs have been identified (Fig. 2; Adamska et al. 2010; Qian et al. 2013). Hence, this FZD subfamily appears as an innovation of both vertebrate and Urochordata derived from an ancestral sequence that gave rise to the FZD1/2/7 subfamily (Fig. 2). Consequently, we propose here to define four main subfamilies of FZD proteins at this phylogenetic scale: (i) subfamily I corresponding to
Evolution of Frizzled receptor
165
FZD1/2/7 subfamily; (ii) subfamily II containing vertebrate FDZ5, FZD8, and their orthologs; (iii) subfamily III with vertebrate FZD9, FZD10, and their orthologs; and (iv) subfamily IV containing FZD4. Concerning the fifth subfamily (previously called subfamily FZD3/6), it is likely an innovation that occurred in the last common ancestor of vertebrates and Urochordata and thus it can be included in subfamily I (Fig. 2). Taken together, phylogeny and amino acid characterization strongly supports that the last common ancestor of bilaterians and cnidarians already possessed four Fzd genes containing different motifs corresponding to each subfamily: (i) 1C-G-2C (subfamily I), (ii) 3C-R-2C (subfamily II), (iii) 1C-R-2C (subfamily III), and (iv) 1C-R-0C (subfamily IV) (Fig. 1).
Two FZD genes in common ancestor of Porifera The publication of the first sponge genome revealed components of the molecular toolkit of this early branching phylum and more generally, the origin and evolution of key gene families and molecular pathways in Metazoa (Adamska et al. 2011; Riesgo et al. 2014). Notably, research on the Wnt pathway components in A. queenslandica genome showed that two Fzd genes are carried by this sponge (Adamska et al. 2010). As one species cannot be considered as representative of all sponge lineages (Ereskovsky et al. 2009), we have searched FZD members in E. muelleri transcriptome (another Demospongiae), in two Homoscleromorpha species, and in O. minuta (a Hexactinellida). Our results confirm that the last common ancestor of Demospongiae possessed two Fzd genes as we also found only two orthologous Fzd transcripts in E. muelleri. In contrast, analyses of both O. carmela genome and O. lobularis transcripts revealed three Fzd genes in these sponges proving the importance of phylum level comparisons. Remarkably, two of the three genes identified in Oscarella species are carried by the same chromosome. Therefore, Oscarella Fzda1 and Fzda2 represent the first description of a Fzd gene cluster at the metazoan scale. As it was proposed for T-box clusters in mouse genomes, a likely explanation for this Fzd gene placement along the chromosome is that an unequal crossing over occurred between homologous chromosomes (Agulnik et al. 1996). More than a simple gene duplication, in this case, it seems that this event may have also duplicated a part of the regulatory sequence since expression patterns of OlFzda1 and OlFzda2 are highly similar (data not shown). This leads us to propose that both O. lobularis Fzda copies may have the same and relatively recent origin. Hence, phylogenetic and sequence analysis of sponge sequences suggest that the last common ancestor of sponges may have possessed only two Fzd genes (Fzda with the 1C-G-2C motif and Fzdb with the 1C-R-2C motif) and that a more recent, lineage specific, tandem duplication of Fzda occurred in the Homoscleromorpha lineage (at least in the
166
EVOLUTION & DEVELOPMENT
Vol. 17, No. 2, March–April 2015
Fig. 3. Evolution in Fzd genes in Metazoa. White arrows represent gene duplications of Fzda-like while black ones correspond to duplications of Fzdb-like. The numbers above each arrow correspond to the number of duplications. The white arrow with two cross circles represents the tandem duplication observed in the Oscarella genus. White background corresponds to FZDA-like proteins containing a G residue at position 372 whereas light grey background corresponds to FZDB-like proteins containing the R residue. Dark grey background designates proteins that do not contain a specific 372th residue and black background corresponds to proteins that are not found in the given transcriptome or genome. LCAM abbreviation is the last common ancestor of metazoans.
Schenkelaars et al.
Oscarella lineage) leading to Fzda1 and Fzda2 establishment (Fig. 3). To date, only one Fzdb have been identified in our transcriptomic database of O. minuta and A. vastus (Hexactinellida). Nevertheless, acquisition of new data for O. minuta is in progress and it will be necessary to confirm the apparent loss of Fzda in this lineage (genome and transcriptome by Amidex project 2013). Concerning Calcarea, a recent study has identified four Fzd sequences (Leininger et al. 2014). This discovery could be consistent with the hypothesis of two ancestral Fzd genes as data shown in this paper strongly suggests the tetraploid state of the species (2 Dvl, 2 Tcf, 2 Pl10, etc. instead of one in other sponge species) (Adamska et al. 2010).
Two FZD genes in the last common ancestor of metazoans We previously assessed that the last common ancestor of bilaterians and cnidarians already carried four Fzd members with 1C-G-2C, 3C-R-2C, 1C-R-2C, and 1C-R-0C motifs respectively (Figs. 1 and 3; Supplemental data S4). Moreover, we concluded that the last common ancestor of Porifera likely possessed only two Fzd genes, one containing the 1C-G-2C motif (Fzda) and a second one with a 1C-R-2C motif (Fzdb). In addition, the recent acquisition of the Mnemiopsis leidyi genome (Ctenophora) also reveals only two Fzd genes (including MlFZDA containing a 1C-G-2C motif; Pang et al. 2010). Moreover, here we report two FZDs (TaFZDA: 1C-G-2C and TaFZDB: 1C-R-1C) in the Placozoan T. adhaerens. Together, these results raise the possibility of understanding the ancestral Fzd content of the last common ancestor of Metazoa. In this regard, a parsimonious scenario retracing the putative origin and evolution of FZDs in metazoans can be described (Figs. 1 and 3). In this scenario, the last common ancestor of Metazoa may have possessed two Fzd genes (Fzda-like: 1C-G-2C and Fzdb-like: 1C-R-2C). Then, two Fzdb duplications followed by mutations in FZD motif would have occurred in the last common ancestor of bilaterians þ cnidarians clade, giving rise to the four reported subfamilies (Fig. 1). Thus, the subfamily I would have resulted from a unique and ancestral Fzda-like sequence whereas an ancestral Fzdb-like sequence would have given rise to all other sequences (subfamily II, III, and IV).
Characteristics of ancestral FZD proteins The finding that the last common ancestor of Metazoa likely possessed two Fzd genes raises questions concerning their appearance and their molecular interactions. In order to retrace the Fzd origin, several clues can be collected from the amino acid sequences. Domain analyses of FZDs revealed putative features of the two paralogous ancestral proteins. Indeed, all sequences show the succession of seven trans-membrane domains (7TMs) indicating that these ancestral FZD proteins
Evolution of Frizzled receptor
167
were anchored in the cell surface and thus probably already able to mediate information between extra-cellular environment and the cytoplasm. The systematic occurrence of the cysteine rich domain at the N-terminal end of current sequences, even in basal species, reinforces the notion that the early proteins may have interacted with extracellular proteins such as WNTs or LRPs (Dann et al. 2001; Povelones and Nusse 2005; Rao and K€uhl 2010; Niehrs 2012). The KTXXXW motif, described as a crucial motif to transduce Wnt signal to disheveled (DSH) (Umbhauer et al. 2000; Huang and Klein 2004; Punchihewa et al. 2009; Tauriello et al. 2012), was also probably present in the last common FZD proteins as these residues are found in most sequences (Supplemental data S4). Consequently, we suggest that the ancestral FZD protein sequences already functioned as bridges between extra- and intra-cellular environments and were able to transduce the signal of ancestral WNTs to a cytoplasmic DVL-like protein.
Evolution of FZD subfamilies and FZD functions The high conservation of both G and R residues (respectively in FZA-like and FZB-like clades) at the 372th position indicates that these amino acids are likely essential for protein function (Supplemental data S4). Furthermore, because of their localization inside the second TM of the protein (Fig. 1), it is unlikely that this conserved amino acid distribution within subfamilies is due to convergence. Although cysteine residues are one of the least abundant amino acids, they often occur in functional sites of proteins (Marino and Gladyshev 2010). Moreover, as cysteines play an important role in protein conformation and protein–protein interactions, this residue is subjected to a high selection pressure, and thus tends to be either completely degenerated or deeply conserved. Thus, changes in cysteine patterns that have occurred in subfamilies II and IV and their strict conservation within their respective subfamily indicate that these changes in residues are required for a specific subfamily function such as a particular protein–protein interaction or a particular FDZ conformation. This is highlighted as differences in cysteine patterns were localized outside of the TMs (between CRD and the first TM or between TM6 and TM7; Fig. 1) where they are thus accessible for different kinds of interactions. Thus, each duplication of Fzdb-like genes in the last common ancestor of bilaterians and cnidarians could have been followed by the acquisition of a new cysteine motif in one of the two daughter sequences (Fig. 1). In contrast, the second one has conserved the ancestral residues (1C-R-2C) and thus an ancestral function (Fig. 1). Therefore, the presence of three cysteines within subfamily II (instead of one) and the absence of cysteine in subfamily IV (instead of two) are likely derived characters which led to the acquisition of new function. Hence, our investigation of cysteine patterns within the different
168
EVOLUTION & DEVELOPMENT
Vol. 17, No. 2, March–April 2015
subfamilies may have revealed neo-functionalization of both subfamilies II and IV by changes in cysteine motifs while the subfamily IV may have conserved a more “ancestral function”. Consequently, functional studies targeting these residues may help to better understand the precise mechanisms that control the affinity of the different FZD members for different ligands, different co-receptors and thus for different pathways. To conclude, in this study, we demonstrate that the last common ancestor of Metazoa already possessed two functional Fzd genes (Fzda-like and Fzdb-like). These two ancestral genes were conserved in Cnidaria, Placozoa, Ctenophora, and Porifera with a tandem duplication that occurred in the Oscarella genus, giving rise to the first descrition of a Fzd cluster (Fzda1 and Fzda2). In contrast, two duplications of Fzdb-like gene took place in the last common ancestor of bilaterians and cnidarians explaining the four paralogous members (belonging to subfamilies I, II, III, and IV) found in most species of this clade. Finally, several duplications during early evolution of vertebrates led to the high number of paralogs in vertebrates. Amino acid sequence analyses revealed that the 372th residue and the cysteine motif are diagnostic for a new classification of FZD proteins in four subfamilies. Indeed, while the 1C-G-2C is characteristic of the subfamily I; subfamilies II, III, and IV can be easily and quickly discriminated by their cysteine motif (3C-R-2C, 1C-R-2C and 1C-R-0C motifs, respectively). Furthermore, the deviation in cysteine motifs within subfamilies II and IV maybe considered as an essential and sufficient explanation for the neo-functionalization or the sub-functionalization of FZD families in eumetazoan species. Hence, the duplication of FZD members in bilaterians and cnidarians followed by potential neo-functionalization (due to modifications in cysteine pattern) provides us a new framework for further research in order to better understand the precise mechanisms that have driven FZD evolution and the diversity of eumetazoan body plans. Acknowledgments This work has been carried out thanks to the support of the A*MIDEX project (n°ANR-11-IDEX-0001-02) funded by the “Investissements d’Avenir” French Government program, managed by the French National Research Agency (ANT). This university foundation A*MIDEX supports the “Spongex” project in order to develop the poriferan models Oscarella lobularis and Oopsacas minuta. We also gratefully acknowledge M. Pratlong, A. Haguenauer, P. Pontarotti, and D. Aurelle for helping us and giving us the opportunity to use their Corallium rubrum data and the ECCOREV Research foundation (FR 3098) that financed the production of C. rubrum transcriptome. We also thank S.P. Leys for providing us sequences from Ephydatia muelleri transcriptomic database.
REFERENCES Adamska, M., Degnan, B. M., Green, K., and Zwafink, C. 2011. What sponges can tell us about the evolution of developmental processes. Zoology 114: 1–10.
Adamska, M., et al. 2010. Structure and expression of conserved Wnt pathway components in the demosponge Amphimedon queenslandica: Wnt pathway components in Amphimedon queenslandica. Evol. Dev. 12: 494–518. Adler, P. N. 2002. Planar signaling and morphogenesis in drosophila. Dev Cell 2: 525–535. Agulnik, S. I., et al. 1996. Evolution of mouse T-box genes by tandem duplication and cluster dispersion. Genetics 144: 249–254. Altschul, S. F., et al. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389–3402. van Amerongen, R., and Nusse, R. 2009. Towards an integrated view of Wnt signaling in development. Development 136: 3205–3214. Anisimova, M., and Gascuel, O. 2006. Approximate likelihood-ratio test for branches: a fast, accurate, and powerful alternative. Syst. Biol. 55: 539– 552. Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 17: 540–552. Dann, C. E., Hsieh, J. C., Rattner, A., Sharma, D., Nathans, J., and Leahy, D. J. 2001. Insights into Wnt binding and signalling from the structures of two Frizzled cysteine-rich domains. Nature 412: 86–90. Dehal, P., and Boore, J. L. 2005. Two rounds of whole genome duplication in the ancestral vertebrate. PLoS Biol. 3: e314. Dohrmann, M., Janussen, D., Reitner, J., Collins, A., and Worheide, G. 2008. Phylogeny and evolution of glass sponges (Porifera, Hexactinellida). Syst. Biol. 57: 388–405. Ereskovsky, A. V., et al. 2009. The Homoscleromorph sponge Oscarella lobularis, a promising sponge model in evolutionary and developmental biology: model sponge Oscarella lobularis. BioEssays News Rev. Mol. Cell. Dev. Biol. 31: 89–97. Fredriksson, R., Lagerstr€ om, M. C., Lundin, L-G., and Schi€ oth, H. B. 2003. The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Mol. Pharmacol. 63: 1256–1272. Gazave, E., et al. 2009. Origin and evolution of the Notch signalling pathway: an overview from eukaryotic genomes. BMC Evol. Biol. 9: 249. Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41: 95–98. Huang, H-C., and Klein, P. S. 2004. The frizzled family: receptors for multiple signal transduction pathways. Genome Biol. 5: 234. Karako-Lampert, S., et al. 2014. Transcriptome analysis of the scleractinian coral stylophora pistillata. PLoS ONE 9: e88615. Kasahara, M. 2007. The 2R hypothesis: an update. Curr. Opin. Immunol. 19: 547–552. Larroux, C., Luke, G. N., Koopman, P., Rokhsar, D. S., Shimeld, S. M., and Degnan, B. M. 2008. Genesis and expansion of metazoan transcription factor gene classes. Mol. Biol. Evol. 25: 980–996. Leininger, S., et al. 2014. Developmental gene expression provides clues to relationships between sponge and eumetazoan body plans. Nat. Commun. 5, doi: 10.1038/ncomms4905. Marino, S. M., and Gladyshev, V. N. 2010. Cysteine function governs its conservation and degeneration and restricts its utilization on protein surfaces. J. Mol. Biol. 404: 902–916. McNeill, H. 2009. Planar cell polarity: keeping hairs straight is not so simple. Cold Spring Harb. Perspect. Biol. 2: a003376–a003376. Meyer, A., and Van de Peer, Y. 2005. From 2R to 3R: evidence for a fishspecific genome duplication (FSGD). BioEssays 27, 937–945. Nichols, S. A., Dirks, W., Pearse, J. S., and King, N. 2006. Early evolution of animal cell signaling and adhesion genes. Proc. Natl. Acad. Sci. 103: 12451–12456. Niehrs, C. 2012. The complex world of WNT receptor signalling. Nat. Rev. Mol. Cell. Biol. 13: 767–779. Nosenko, T., et al. 2013. Deep metazoan phylogeny: when different genes tell different stories. Mol. Phylogenet. Evol. 67: 223–233. Nusse, R., and Varmus, H. 2012. Three decades of Wnts: a personal perspective on how a scientific field developed. EMBO J. 31: 2670–2684. Pang, K., Ryan, J. F., Mullikin, J. C., Baxevanis, A. D., and Martindale, M. Q. 2010. Genomic insights into Wnt signaling in an early diverging metazoan, the ctenophore Mnemiopsis leidyi. EvoDevo 1: 10–10.
Schenkelaars et al.
Pei, J., and Grishin, N. V. 2012. Cysteine-rich domains related to Frizzled receptors and Hedgehog-interacting proteins. Protein Sci. 21: 1172– 1184. Peterson, K. J., and Sperling, E. A. 2007. Poriferan ANTP genes: primitively simple or secondarily reduced. Evol. Dev. 9: 405–408. Philippe, H., et al. 2009. Phylogenomics revives traditional views on deep animal relationships. Curr. Biol. 19: 706–712. Pick, K. S., et al. 2010. Improved phylogenomic taxon sampling noticeably affects nonbilaterian relationships. Mol. Biol. Evol. 27: 1983–1987. Povelones, M., and Nusse, R. 2005. The role of the cysteine-rich domain of Frizzled in Wingless-Armadillo signaling. EMBO J. 24: 3493–3503. Pratlong, M., Haguenauer, A., Chabrol, O., Klopp, C., Pontarotti, P., and Aurelle, D. 2015. The red coral (Corallium rubrum) transcriptome: a new resource for population genetics and local adaptation studies. Mol. Ecol. Resour. In press. Punchihewa, C., Ferreira, A. M., Cassell, R., Rodrigues, P., and Fujii, N. 2009. Sequence requirement and subtype specificity in the high-affinity interaction between human frizzled and dishevelled proteins. Protein Sci. 18: 994–1002. Qian, G., Li, G., Chen, X., and Wang, Y. 2013. Characterization and embryonic expression of four amphioxus Frizzled genes with important functions during early embryogenesis. Gene Expr. Patterns 13: 445–453. Rao, T. P., and K€ uhl, M. 2010. An updated overview on Wnt signaling pathways: a prelude for more. Circ. Res. 106: 1798–1806. Richards, G. S., and Degnan, B. M. 2009. The dawn of developmental signaling in the Metazoa. Cold Spring Harb. Symp. Quant. Biol. 74: 81–90. Riesgo, A., Farrar, N., Windsor, P. J., Giribet, G., and Leys, S. P. 2014. The analysis of eight transcriptomes from all Porifera classes reveals surprising genetic complexity in sponges. Mol. Biol. Evol. doi: 10.1093/molbev/msu057 Ryan, J. F., et al. 2013. The genome of the ctenophore mnemiopsis leidyi and its implications for cell type evolution. Science 342: 1242592. Schulte, G. 2010. International union of basic and clinical pharmacology. LXXX. The class Frizzled receptors. Pharmacol. Rev. 62: 632–667. Simons, M., and Mlodzik, M. 2008. Planar cell polarity signaling: from fly development to human disease. Annu. Rev. Genet. 42: 517–540. Van Soest, R. W. M., et al. 2012. Global diversity of sponges (Porifera). PLoS ONE 7(4): e35105 doi: 10.1371/journal.pone.0035105. Sperling, E. A., Pisani, D., and Peterson, K. J. 2007. Poriferan paraphyly and its implications for Precambrian palaeobiology. Geol. Soc. Lond. Spec. Publ. 286: 355–368. Srivastava, M., et al. 2008. The Trichoplax genome and the nature of placozoans. Nature 454: 955–960. Srivastava, M., et al. 2010. The Amphimedon queenslandica genome and the evolution of animal complexity. Nature 466: 720–726. Stathopoulos, A., and Levine, M. 2005. Genomic regulatory networks and animal development. Dev. Cell 9: 449–462. Strutt, D., Madder, D., Chaudhary, V., and Artymiuk, P. J. 2012. Structurefunction dissection of the frizzled receptor in drosophila melanogaster suggests different mechanisms of action in planar polarity and canonical Wnt signaling. Genetics 192: 1295–1313.
Evolution of Frizzled receptor
169
Tauriello, D. V. F., et al. 2012. Wnt/ -catenin signaling requires interaction of the Dishevelled DEP domain and C terminus with a discontinuous motif in Frizzled. Proc. Natl. Acad. Sci. USA 109, E812–E820. Umbhauer, M., et al. 2000. The C-terminal cytoplasmic Lys-thr-X-X-X-Trp motif in frizzled receptors mediates Wnt/beta-catenin signalling. EMBO J. 19: 4944–4954. Vinson, C. R., Conover, S., and Adler, P. N. 1989. A Drosophila tissue polarity locus encodes a protein containing seven potential transmembrane domains. Nature 338: 263–264.
SUPPORTING INFORMATION Additional supporting information may be found in the online version of this article at the publisher’s web-site. Fig. S1. Accession numbers of sequences used for phylogeny and amino acid analyses. Fig. S2. Venn diagrams comparing Oscarella lobularis (Porifera, Homoscleromorpha), Oopsacas minuta (Porifera, Hexactinellida), and Corallium rubrum (Cnidaria, Octocorallia) transcritomes to the referenced genomes, Amphimedon queenslandica (Porifera, Demospongiae) and Nematostella vectensis (Cnidaria, Hexacorallia). Fig. S3. Information on newly discovered Fzd genes: name, accession number, and NCBI tblastx score (top hit and e-value). Fig. S4. Frizzled alignment highlighting the 10 cysteine residues composing the Cysteine Rich Domain (purple), the KTXXXW motif (green), and the diagnostic residues for four bilaterian and cnidarian FZD subfamilies: cysteine amino acids (red) and the 372th residue (yellow or blue). Fig. S5. Phylogenetic trees using Bayesian methodology with 100.000.000 generations (A), Maximum Likelihood and the aLRT SH-like method (B) and Maximum Likelihood method with 1000 bootstrap re-sampling. Black triangles correspond to vertebrate subfamilies.
