Humu-2014-0534 Research Article

Insights into severe 5,10-methylenetetrahydrofolate reductase deficiency: molecular genetic and enzymatic characterization of 76 patients Patricie Burda1*, Alexandra Schäfer1*, Terttu Suormala1, Till Rummel2, Céline Bürer1, Dorothea Heuberger1, Michele Frapolli1, Cecilia Giunta1, Jitka Sokolová3, Hana Vlášková3, Viktor Kožich3, Hans Georg Koch2,4, Brian Fowler1, D. Sean Froese1,5# and Matthias R. Baumgartner1,5,6# 1

Division of Metabolism and Children’s Research Center, University Children’s

Hospital, CH-8032 Zurich, Switzerland 2

Department of Pediatrics, University Hospital, D-48149 Münster, Germany

3

Institute of Inherited Metabolic Disorders, First Faculty of Medicine, Charles University in

Prague and General University Hospital in Prague, Prague, Czech Republic 4

Klinikum für Kinder- und Jugendmedizin, Klinikum Braunschweig, Holwedestrasse 16, D-

38118 Braunschweig, Germany 5

radiz – Rare Disease Initiative Zurich, Clinical Research Priority Program for Rare Diseases,

University of Zurich, Switzerland 6

Zurich Center for Integrative Human Physiology, University of Zurich, Switzerland

*These authors contributed equally to this work

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/humu.22779. This article is protected by copyright. All rights reserved.

1

#To whom correspondence may be addressed: Matthias R. Baumgartner Division of Metabolism and Children’s Research Center, University Children’s Hospital, Steinweisstrasse 75, CH-8032 Zurich, Switzerland Tel: +41 (0)44 266 7722 Fax: +41 (0)44 266 7167 Email: [email protected]

D. Sean Froese Tel: +41 (0)44 266 7156 Email: [email protected]

Contract grant sponsors: Swiss National Science Foundation (SNSF 31003A_138521)

Abstract 5,10-Methylenetetrahydrofolate reductase (MTHFR) deficiency is the most common inherited disorder of folate metabolism and causes severe hyperhomocysteinaemia. To better understand the relationship between mutation and function, we performed molecular genetic analysis of 76 MTHFR deficient patients, followed by extensive enzymatic characterisation of fibroblasts from 72 of these. A deleterious mutation was detected on each of the 152 patient alleles, with one allele harbouring 2 mutations. 65 different mutations (42 novel) were This article is protected by copyright. All rights reserved.

2

detected, including a common splicing mutation (c.1542G>A) found in 21 alleles. Using an enzyme assay in the physiological direction, we found residual activity (1.7-42% of control) in 42 cell lines, of which 28 showed reduced affinity for NADPH, 1 reduced affinity for methylenetetrahydrofolate, 5 FAD-responsiveness, and 24 abnormal kinetics of Sadenosylmethionine inhibition. Missense mutations causing virtually absent activity were found exclusively in the N-terminal catalytic domain while missense mutations in the Cterminal regulatory domain caused decreased NADPH binding and disturbed inhibition by Sadenosylmethionine. Characterization of patients in this way provides a basis for improved diagnosis using expanded enzymatic criteria, increases understanding of the molecular basis of MTHFR dysfunction, and points to the possible role of cofactor or substrate in the treatment of patients with specific mutations.

Key words: methylenetetrahydrofolate, MTHFR, homocystinuria, enzyme kinetics

Introduction 5,10-Methylenetetrahydrofolate reductase (MTHFR) deficiency (MIM# 607093), an autosomal recessive disorder, is the most common congenital defect of folate metabolism (see Watkins and Rosenblatt, 2014). Severe MTHFR deficiency, defined as residual activity of less than 20% of the mean control value, is biochemically characterized by hyperhomocysteinaemia, homocystinuria, increased plasma cystathionine and low plasma methionine. The clinical presentation is extremely variable ranging from early onset with

This article is protected by copyright. All rights reserved.

3

severe neurologic abnormalities to a later milder form with onset of psychiatric and gait disturbances in the second decade or later in adulthood. MTHFR (EC 1.5.1.20) catalyses a two step reaction in which reducing equivalents are transferred first from nicotinamide adenine dinucleotide phosphate (NADPH) to the cofactor flavin adenine dinucleotide (FAD) and then passed on to 5,10-methylenetetrahydrofolate (methyleneTHF) forming 5-methyltetrahydrofolate (methylTHF) (Guenther et al., 1999). MethylTHF is the most common form of folate in plasma and tissues, and serves as methyl group donor in the methylTHF-homocysteine S-methyltransferase (methionine synthase; EC 2.1.1.13) catalysed remethylation of homocysteine to methionine (Watkins and Rosenblatt, 2014). Methionine is in turn activated to S-adenosylmethionine (AdoMet), which is essential for methylation of a large number of cellular compounds including DNA, as well as an allosteric inhibitor of MTHFR. The initial description of human MTHFR defined a gene of 11 exons with a 2.2 kb cDNA sequence coding for a 656 residue (~70 kDa) protein (Goyette et al., 1998). However, longer isoforms have since been isolated, with transcript sizes ranging from 7.5-9.5 kb, and one splice variant coding for a novel N-terminal protein sequence increasing the size by 41 amino acids to ~77 kDa (Tran et al., 2002). Mammalian MTHFR protein is homodimeric, and both subunits are composed of an N-terminal catalytic domain, which includes binding sites for the substrates NADPH and methyleneTHF as well as the cofactor FAD, linked to a Cterminal regulatory domain (Matthews et al., 1984). Structural determination of an E. coli homologue, which is homotetrameric and contains only the catalytic domain, has shown that the residues crucial to FAD binding are scattered across this domain (Guenther et al., 1999). Functional studies have demonstrated allosteric inhibition of MTHFR from AdoMet binding to the regulatory domain (Sumner et al. 1986), however replacement of AdoMet with S-

This article is protected by copyright. All rights reserved.

4

adenosylhomocysteine can reverse this inhibitory effect (Daubner and Matthews, 1982; Yamada et al., 2001). The number of patients with MTHFR deficiency is estimated to be over 100 (Schiff et al., 2011; Watkins and Rosenblatt, 2012). Most harbour private mutations, with few occurring in more than 5 patients. One exception is c.1141C>T (p.Arg377Cys) found in the Amish and other populations (Goyette et al., 1996; Sibani et al., 2003; Tonetti et al., 2003; Strauss et al., 2007). In addition to disease causing mutations, 16 single nucleotide polymorphic (SNP) changes, and 1 two-nucleotide deletion/insertion, leading to an amino acid change, are known (Martin et al., 2006; Marini et al., 2008; Pavlikova et al., 2012). The most common and thoroughly investigated of these changes is c.677C>T (p.Ala222Val), which shows an allele frequency ranging from 24% to 40% (5% - 16% c.677TT individuals) depending on the population (Brattstrom et al., 1998; Hanson et al., 2001; Winkelmayer et al., 2004; Pavlikova et al., 2012). This SNP causes thermolability of MTHFR (Frosst et al., 1995), moderately reduced lymphocyte enzyme activity (Frosst et al., 1995; van der Put et al., 1996) and mild hyperhomocysteinaemia when folate intake is low. This variation may have clinical consequences in some patients with severe MTHFR deficiency since expression studies have shown that the residual activity of a deleterious mutation may be significantly lowered by the presence of the c.677T change in the same allele (Goyette and Rozen, 2000; Sibani et al., 2003). Two other SNPs, c.1298A>C (p.Glu429Ala) and c.1793G>A (p.Arg594Gln), present in allelic frequencies of approximately 32% and 5%, respectively (Hanson et al., 2001; Rady et al., 2002; Winkelmayer et al., 2004; Pavlikova et al., 2012), were found not to cause enzymatic thermolability or hyperhomocysteinaemia (van der Put et al., 1998; Hanson et al., 2001). In MTHFR deficiency, the time of onset and severity of illness show some degree of correlation with the level of residual enzyme activity (Watkins and Rosenblatt, 2014) and the This article is protected by copyright. All rights reserved.

5

genotype (Goyette et al., 1995). To better understand mechanisms underpinning this, as well as to expand the mutational and biochemical spectrum of MTHFR deficiency, we have identified the mutations in 76 patients, with extensive enzymatic investigation in fibroblasts from 72 of these. Our results suggest that the type and location of mutation is important for the manner of biochemical disruption, determines the level of residual activity, and may give a clue as to the disease severity/progression as well as potential therapies.

Materials and Methods Patient cell lines and mutation identification Cultured skin fibroblasts from 72 patients and EDTA blood samples from 4 additional patients (fibroblast cultures not available) with clinical and biochemical evidence of MTHFR deficiency, obtained for diagnostic studies with informed consent from the patients or their parents and referring clinicians, were included. Details of cell lines 1-25 and control fibroblasts, as well as cell culture conditions, have already been described (Suormala et al., 2002). Enzyme activities and mutations, but not extended enzymatic characterization have been previously reported for cell lines 16, 49 and 56 (Urreizti et al., 2010; termed patients 2, 4 and 5, respectively); 33 (Bathgate et al., 2012); 55 (Forges et al., 2010; younger sibling); 60 (Tsuji et al., 2011); and 71 (Crushell et al. 2012). Genomic DNA (gDNA) was extracted from cultured patient fibroblast samples using the QIAamp DNA Mini Kit or from EDTA blood using the DNEasy Blood and Tissue Kit (Qiagen). Total RNA was extracted using the RNeasy Mini Kit (Qiagen). To identify mutations, exons were amplified by PCR from gDNA using flanking intronic primers (Supp.

This article is protected by copyright. All rights reserved.

6

Table S1) and subsequent sequencing by the ABI BigDye method (Applied Biosystems). In cases where no or only one mutation was found, or to confirm splicing defects, cDNA was analyzed following synthesis from total RNA by RT-PCR using BD Power Script Reverse Transcriptase (BD Biosciences) and the primers listed in Supp. Table S1, with direct sequencing of RT-PCR products. Detected mutations were confirmed in all cell lines in a second independent gDNA sample isolated from fibroblast cultures started from the original cryo-preserved cell stock, or from sequencing parental gDNA when no fibroblasts were available. The allele refractory mutation system (ARMS) (Newton et al., 1989) was performed for cell line 7, where sequencing identified three different heterozygous mutations: c.1809_1810delinsGT, c.1820C>G and c.1895T>C. Briefly, a forward primer on intron 10 (MTHFR-IVS10F, all primers are listed in Supp. Table S1) and a reverse primer specific either for c.1895T (MTHFR-1895WT) or for c.1895C (MTHFR-1895ASO), which also contained an additional mismatch near the 3’ end to increase specificity, were used to amplify a 295bp fragment covering the region of exon 11 harbouring the c.1809_1810delinsGT variant. Further, a 268 bp region harbouring the variants c.1820C>G and c.1895T>C was amplified. For this a forward primer specific either for c.1809T (MTHFR-1809WT) or for c.1809G (MTHFR-1809ASO), the latter harbouring a second mismatch near the 3’ end, and a reverse primer on intron 11 (MTHFR-IVS11R) was used. All PCR products were directly sequenced as described above. Nucleotide numbers employed here correspond to the original sequence described by Goyette and co-workers (Goyette et al., 1994, 1998) using ENSEMBL sequence MTHFR-001 (ENST00000376592). This nomenclature adds 12 nucleotides to the A of the ATG initiation codon. Exons are numbered from 1 to 11 and introns from 1 to 10 according to Goyette and co-workers (Goyette et al., 1998). The original numbering of nucleotides, exons and introns This article is protected by copyright. All rights reserved.

7

was preferred since the majority of the literature including a large number of publications reporting effects of the MTHFR SNPs follow this nomenclature. All variants discovered have been deposited in the clinical variant database found at http://www.ncbi.nlm.nih.gov/clinvar/. MTHFR assay All enzymatic assays were performed using the physiological forward assay as described earlier (Suormala et al., 2002; Rummel et al., 2007), with minor modifications. Briefly, specific activity was measured in 50 mM potassium phosphate buffer, pH 6.6, under saturating substrate concentrations (100 µM methyleneTHF, Eprova AG; 200 µM NADPH, Sigma-Aldrich) with and without the addition of FAD (75 μM, Sigma-Aldrich) to detect cofactor responsiveness. Since the description of the original method we have used a more sensitive HPLC system to increase reliable detection of residual activities from about 2-3% of the mean control value to less than 1%. Thermolability was estimated by incubation of the assay mixture with cell extract and assay buffer but without the substrates and FAD for 5 min at 46°C, followed by the assay of activity with and without 75 μM FAD. The Km for methyleneTHF was determined by varying its concentration between 2.5 µM and 200 µM in the presence of 200 µM NADPH and 75 µM FAD. The Km for NADPH was determined by varying its concentration between 10 µM and 250 µM in the presence of 100 µM methyleneTHF and 75 µM FAD. All Km values were derived using Eadie-Hofstee plots . To estimate the Ki for AdoMet inhibition, fibroblast extracts were pre-incubated for 5 min at 37°C with variable concentrations of purified AdoMet (2-1000 µM, Sigma-Aldrich) in the presence of assay buffer and 75 µM FAD, with reactions initiated by adding both substrates (100 µM methyleneTHF, 200 µM NADPH). The Ki was estimated from the linear range (slope = -1/Ki) of the plot in which activity without AdoMet divided by activity with AdoMet was plotted against the concentration of AdoMet.

This article is protected by copyright. All rights reserved.

8

Results Mutation identification Mutations which are certain or likely to be pathogenic were detected in each of the 152 alleles of our 76 unrelated patients, all of whom had been referred due to elevated homocyst(e)ine and low to normal methionine suggesting MTHFR deficiency. Two mutations were detected in 75 patients and 3 in one patient. These mutations, together with the genotype of the c.677C>T polymorphic change for each patient, are presented in Tables 1 and 2. In total, 65 different mutations, 42 of which are novel, were identified in our patient cohort. Of the 23 previously published mutations that we reported in this study, 7 have been found only in our cohort (Forges et al., 2010; Urreizti et al., 2010; Tsuji et al., 2011; Bathgate et al., 2012; Crushell et al., 2012). Only 19 mutations were detected in more than one cell line, indicating that most patients carry private mutations. The most common mutation was c.1542G>A, a splicing mutation (for details see text below) found in 21 alleles. Analysis of SNPs in the MTHFR gene revealed the same haplotype in patients carrying this mutation, suggesting it arose from a single founder. All other mutations were found in maximally 8 alleles. The distribution of mutations is as follows: 43 missense mutations (67%; 28 novel); 4 nonsense mutations (6%; 2 novel); 5 deletions or duplications (8%; 4 novel); 11 primarily affect splicing (16%; 7 novel); and 2 no-stop mutations predicting a C-terminal extension of the protein (3%; 1 novel). Unusually, we found 1 small deletion in the 5’ untranslated region (cell line 30). Clinical data for many of the unpublished patients will be reported in a separate publication. Sequencing of RT-PCR products from cell lines harbouring three of the novel splice site mutations revealed exon skipping in each: c.1179-2delA resulted in skipping of exon 7 (r.1179_1359del), causing a frameshift ending in a premature stop codon (p.Trp389Trpfs*1);

This article is protected by copyright. All rights reserved.

9

while c.1644+2T>G and c.1764+1G>T resulted in skipping of exons 9 (r.1543_1644del) and 10 (r.1645_1764del), resulting in a loss of 34 (p.Ala511_Lys544) and 40 (p.Gly545_Lys584) amino acid residues, respectively. A fourth novel splice site mutation, c.1542+2T>C, causes incorporation of the first 5 nucleotides of intron 8 into the transcript, thereby resulting in a frame-shift (p.Tyr512Trpfs*3). A fifth novel splice site mutation, c.792+1G>T, found in intron 4, was not investigated in detail, but resembles the mutation c.792+1G>A described previously (Goyette et al. 1995) which showed an in-frame deletion of 57 nucleotides from exon 4 (r.736_792del) due to activation of a cryptic splice site within this exon. We also found splicing variations from mutations remote from exon-intron boundaries. RTPCR analysis of the novel intronic c.1765-18G>A mutation demonstrated generation of a cryptic 3' acceptor splice site, resulting in retention of 16 nucleotides from the 3’ end of intron 10 (r.1764_1765ins16), causing a frameshift followed by a premature termination codon (p.Asp585Glyfs*14). Analysis of c.1332G>A, a novel mutation causing a synonymous change for p.Ser440= in exon 7, revealed retention of 137 nucleotides from the 5’ end of intron 7 (r.1359_1360ins137), followed by activation of a cryptic donor splice site within intron 7. This change is predicted to integrate 16 amino acid residues C-terminally to p.Lys449, followed by premature termination of translation. Finally, the most common mutation found in our cohort (c.1542G>A) codes for a synonymous change of p.Lys510= on the last nucleotide of exon 8. Amplification of the mutated region using RNA from cell lines homozygous for this mutation revealed two different splicing abnormalities. In combination with agarose electrophoresis (Figure 1), sequencing of RT-PCR products identified skipping of exon 8 (r.1360_1542del), producing a protein product lacking the 61 amino acids encoded by this exon, and insertion of 5 nucleotides from the 5’ end of intron 8 (r.1542_1543ins5), resulting in a frameshift and premature termination of the protein. This mutation has been

This article is protected by copyright. All rights reserved.

10

previously reported in the homozygous state in one patient, but the molecular and functional consequences were not studied (Richard et al., 2013). To explore the underlying mechanisms of the novel splicing defects in the MTHFR gene we performed in silico analyses of the changes in consensual splice sites as well as in exon splicing enhancers and silencers, respectively (Supp. Table S2). Evaluation of splice sites detected either destruction of canonical sites or creation of novel sites that were all consistent with the changes observed in patient mRNAs. Analysis of exon splicing enhancers and silencers indicated that some mutations altered these regulatory elements and may have contributed to the splicing defect. In cell line 7, three mutations were detected, c.1809_1810delinsGT (p.Tyr599*), c.1820C>G (p.Ser603Cys) and c.1895T>C (p.Leu628Pro). To determine which mutations came from the same allele, we applied ARMS (see Materials and Methods). Sequencing of the ARMS-PCR products revealed that the c.1895T wild-type allele co-segregated with the mutant variants c.1809_1810delinsGT and c.1820C>G, while the mutant variant c.1895C co-segregated with the wild-type variants of c.1809_1810 and c.1820. Therefore we conclude that the patient is compound heterozygous for c.[1809_1810delinsGT; 1820C>G] and c.1895T>C. MTHFR activity and kinetics in patient primary fibroblasts We characterized the MTHFR activity of primary skin fibroblasts from 72 patients, using the physiological forward assay (Suormala et al., 2002). Detailed results are presented in Supp. Tables S3 and S4 and are summarized in Tables 1 and 2 compared with the mean values obtained in control cell lines. Activity was found to be very low (< 1.5% of the mean control value) in 30 cell lines (Table 1), whereas the other 42 cell lines retained residual activity ranging from 1.7 – 42% (Table 2). The 4 further patients from whom no fibroblast cultures were available are also shown in Table 1. They were homozygous for the same mutations This article is protected by copyright. All rights reserved.

11

already detected in the homozygous state in cell lines of the very low activity group. In addition to mutation type, activity was influenced by a number of features related to cell culture conditions such as growth rate, cell morphology, passage number and degree of confluence on harvesting. Therefore, whenever possible, cultures with a low passage number (90% below 10, maximum 17) were used and cells were harvested at least 3 days postconfluence. Additionally, all assays were performed in at least two separate experiments using fibroblasts from independent cultures (Supp. Table S3). Every cell line was tested for FAD responsiveness, i.e. comparison of activity without (FAD) and with (+FAD) supplementation of 75 μM FAD to the activity assay. In 5 cell lines, activity +FAD was reproducibly markedly higher than without (mean ratio +FAD/–FAD: 1.73 – 6.09), indicating in vitro FAD responsiveness (Table 2A). In the other 67 cell lines no such responsiveness was observed (mean ratio +FAD/-FAD: 0.53 – 1.17), consistent with previously published values in 75 control cell lines (0.96 – 1.08) (Suormala et al., 2002). The apparent Km of MTHFR for FAD, in the FAD responsive cell lines ranged from 50 – 340 nM (data not shown). We were unable to measure the Km for FAD in control cells since the level of riboflavin, the precursor of FAD, in normal MEM media (~0.3 μM) was sufficient to saturate this enzyme with cofactor. Each FAD-responsive cell line carried at least one missense mutation corresponding to a residue involved in FAD-binding in the E. coli MTHFR crystal structure (Guenther et al., 1999), including p.Thr129, p.Arg157, p.Ala175 and p.Ala195 (Table 2A). Only one cell line (No. 39) was identified as not FAD-responsive even though it carried a mutation on a residue described in the E. coli enzyme to be important for FAD binding (p.His127Tyr). This cell line additionally harboured a deletion (p.Lys215del) and had virtually absent activity (0.1% of mean control; Supp. Table S3), preventing accurate assessment of FAD-responsiveness.

This article is protected by copyright. All rights reserved.

12

For those 42 cell lines with sufficient residual activity (> 1.5%), we determined the apparent Km for methyleneTHF and NADPH as well as the Ki for AdoMet (for detailed results see Supp. Table S4). The mean Km for methyleneTHF was virtually normal for every patient cell line (15.0 – 37.5 μM; control range: 17.7 – 42.2 μM) except for cell line 71 (mean of 3 determinations: 107.9 µM) (Supp. Table S4). This cell line also had low residual activity (1.7%), increased in vitro FAD responsiveness (ratio +FAD/–FAD: 1.73), slightly increased affinity for NADPH (mean Km 0.37 times mean control) and reduced response to AdoMet (mean Ki 6.9 times mean control) (Table 2). Therefore, the importance of the increased methyleneTHF Km is unclear. We found reduced NADPH affinity in 28 cell lines, including 3 with in vitro FAD responsiveness (Table 2), with Km values 2-7 times the mean control value of 27.8 μM (Supp. Table S4). These cell lines had widely varying activity (1.7 – 42% of mean control) in routine assay conditions with 200 µM NADPH, and many had abnormal kinetics for AdoMet inhibition. 13 cell lines had virtually absent inhibition (Ki > 18-times the mean control value of 55.6 μM; Supp. Table S4), 4 cell lines had reduced inhibition (Ki 4 – 11 times mean control), while 7 cell lines had high normal or increased sensitivity to inhibition (Ki 0.22 – 0.58 times mean control) (Table 2). The Km for NADPH was normal in the remaining 13 cell lines (range: 0.80 – 1.52 times control; Table 2). One of these was FAD-responsive (No. 33), and two (Nos. 35 and 72) showed reduced inhibition by AdoMet, while the remainder exhibited normal kinetic characteristics.

This article is protected by copyright. All rights reserved.

13

SNPs and thermolability In addition to mutational analysis, we genotyped each of our cells lines for the c.677C>T (p.Ala222Val) polymorphism. From our 76 mutant cell lines, genotyping revealed 58% CC, 21% CT and 21% TT, giving a minor allele frequency of 32%. Following heat treatment of those mutant cells with detectable MTHFR activity (42 cell lines), those with the CC genotype had 42 ± 11% activity remaining compared to parallel cell lysates without heat treatment, those with CT had 29 ± 14% activity remaining, and TT had 21 ± 9%. In control cells we previously (Suormala et al., 2002) found that cells with the CC genotype had 62 ± 3% activity remaining, CT had 40 ± 4% and TT 18 ± 2%. Our mutant cells show the same trend, with CC > CT > TT, however, the absolute residual activity was lower than expected for the CC and CT genotypes, but not TT. This may be due to protein thermolability caused by the mutations themselves.

Discussion Severely disrupting mutations All missense mutations detected in the 30 cell lines leading to severely reduced (< 1.5% of mean control) MTHFR activity (Table 1) were located within the N-terminal catalytic domain, whereas all mutations in the C-terminal regulatory domain were nonsense, splicesite/splicing, or no-stop mutations (Figure 2). These results clearly reinforce the concept of segregation of the N- and C-terminal domains in the function of MTHFR, whereby substitutions in the first ~340 residues may result in almost complete loss of catalytic activity, while in the regulatory domain only truncating mutations have such a severe effect. In accordance with this severely reduced MTHFR activity, all published reports on our patients This article is protected by copyright. All rights reserved.

14

belonging to this group (Nos. 16, 19, 20, 22, 25 and 60) describe severe clinical presentation with early onset of symptoms and/or death before 2 years of age (Suormala et al., 2002; Tsuji et al., 2011). Similarly, a severe course has been reported for other patients that are homozygous for mutations detected in this low activity group, i.e. for the nonsense mutation p.Arg183* (Goyette et al., 1994), the missense mutations p.Gly149Val (Goyette et al., 1996) and p.Trp339Gly (Kluijtmans et al., 1998; Sibani et al., 2003), as well as the no-stop mutation p.*657Serextfs*50 (Tonetti et al., 2003) that closely resembles the p.*657Argextfs*50 described in cell line No. 34. The most common mutation in our cohort is a synonymous change, c.1542G>A (p.Lys510=), that was shown to cause defective splicing and very low enzyme activity (Figure 1; Table 1). A further synonymous mutation causing defective splicing, c.1332G>A (p.Ser440=), was detected heterozygously in 2 of our cell lines (Nos. 65 and 72) with very low enzyme activity. These findings, in conjunction with c.486A>T (p.Gly158=), a previously described mutation in Bukharian Jews associated with severe clinical presentation and very low enzyme activity (Ben-Shachar et al., 2012), stresses the importance of investigating synonymous changes at the cDNA level to detect splicing abnormalities in this gene. Mutations conferring residual activity Our use of a sensitive assay in the physiological forward direction allowed detailed enzymatic investigations of the 42 cell lines with residual activity above 1.5% of the mean control value. Based on enzyme characteristics we divided these cell lines into three subgroups (Table 2): (A) 5 cell lines with FAD responsiveness; (B) 25 cell lines with reduced affinity for NADPH; and (C) 12 cell lines with normal affinity for the substrates. The 5 FAD-responsive cell lines all had at least one missense mutation in the N-terminal catalytic domain on a residue corresponding to an amino acid involved in FAD binding in the This article is protected by copyright. All rights reserved.

15

E. coli MTHFR structure (p.Thr129Asn, p.Arg157Gln, p.Ala175Thr, p.Ala195Val) (Figure 2). This suggests that the FAD binding function of these residues is conserved in humans. These cell lines, 2 with homozygous and 3 with heterozygous mutations (Table 2A), demonstrated diverse enzyme characteristics, including variation of MTHFR activity from 1.7 – 17% of the mean control value. One other cell line (No. 39) had a missense change on an FAD-binding residue equivalent (p.His127Tyr), in conjunction with a deletion (p.Lys215del), resulting in nearly complete inactivation of the enzyme. This very low activity prevented proper assessment of FAD-responsiveness, but supports the notion that some FAD binding residues are more critical than others for catalytic function. Loss of FAD as a mechanism of instability is in accordance with studies of the common SNP p.Ala222Val, which have shown that its thermolability is caused by an increased propensity to lose FAD, resulting in dissociation of the holoenzyme into inactive monomers (Guenther et al., 1999; Yamada et al., 2001). Our fibroblast results suggest that patients harbouring FAD-responsive changes might be responsive to therapy including supplementation with riboflavin, the precursor to FAD. Current treatment for MTHFR deficiency includes betaine in combination with B vitamins, i.e. foli(ni)c acid, cobalamin, pyridoxine, and in some cases riboflavin (Watkins and Rosenblatt, 2014). Therefore, the value of riboflavin as a treatment is difficult to judge, since it has been little reported and then only in combination with other agents. On the other hand, the relation of riboflavin to homocysteine in common diseases has been widely reported, for example, the influence of riboflavin status on the relationship between MTHFR polymorphisms and homocysteine (Hustad et al., 2000). Also Wilson et al. (2013) reported a positive effect of riboflavin supplementation on blood pressure in subjects with the c.677TT genotype. Further support for the idea of using riboflavin in the treatment of severe MTHFR deficiency is provided by the finding of increased stability of a particular expressed mutant

This article is protected by copyright. All rights reserved.

16

enzyme to the coenzyme FAD (Sibani et al. 2003). Therefore, there is not yet any conclusive data in which to evaluate the effectiveness of riboflavin on FAD-responsive patients, however, we suggest that it might be beneficial to test its efficacy in those patients with specific FAD-responsive mutations, due to its stabilizing effect in the cell. Kinetic studies revealed that reduced affinity of MTHFR for methyleneTHF was scarce and detected only together with FAD responsiveness. Thus, the Km for methyleneTHF was clearly elevated in one cell line (No. 71) heterozygous for p.Thr129Asn, a mutation associated with FAD-binding, and p.Val253Phe (Crushell et al., 2012). MethyleneTHF binding residues have been described in structures of E. coli MTHFR (Pejchal et al., 2006; Lee et al., 2009); however, none correspond to human residues p.Thr129 or p.Val253. One folate binding amino acid found in these E. coli structures, p.Arg279 (Pejchal et al., 2005), corresponding to p.Arg335 in humans, was found to be mutated in one allele of a cell line studied (No. 73). However, this cell line showed no disturbances in methyleneTHF binding. Together, these results do not support the possibility that residues that bind methyleneTHF in E. coli perform the same function in human MTHFR. A major finding in this study is reduced affinity for NADPH together with normal affinity for methyleneTHF and FAD (25 cell lines, Table 2B). Unexpectedly, all but 1 cell line had at least 1 allele with a mutation in the C-terminal regulatory domain, and all 14 different missense mutations detected within the regulatory domain were found in this cell line group (Table 2B; Figure 2). These data suggest that the regulatory domain at least partially mediates NADPH binding. It is of note that in E. coli the NADH binding site is in the catalytic domain (Pejchal et al., 2005; Lee et al., 2009). Studies with pig liver MTHFR revealed that tryptic cleavage of the linker between the catalytic and regulatory domains did not result in loss of NAPDH mediated activity (Matthews et al., 1984), implying binding of NADPH to the catalytic domain. However, if mammalian MTHFR exists as a head-to-tail dimer, where the This article is protected by copyright. All rights reserved.

17

regulatory region of one subunit interacts with the catalytic region of the other, as has been proposed (Yamada et al., 2001), cleavage of the intra-subunit link between the catalytic and regulatory domains would not be expected to affect activity. This would be consistent with our results, as well as the planar rosette structure observed for porcine dimeric MTHFR by scanning electron microscopy (Matthews et al., 1984). In 19 of the 25 cell lines with reduced affinity for NADPH, MTHFR activity was clearly reduced to 1.7 – 11% of the mean control value. Consequently, patients from this subgroup from whom clinical data has been reported, presented with moderate to severe illness (Nos. 7, 10, 12-15; Suormala et al., 2002), or in the first months of life with mainly neurological abnormalities and developmental delay (Nos. 49, 56; Urreizti et al., 2010). These relationships reinforce the correlation between residual enzyme activity and disease severity (Suormala et al., 2002). MTHFR activity in the remaining 6 cell lines varied between 19% and 42% of mean control, i.e. levels that would be considered borderline or not causative of MTHFR deficiency by the current definition (Watkins and Rosenblatt, 2014). However, the Km for NADPH in 5 of these cell lines was elevated 4-6 times above control, and 2-times in the 6th cell line (Table 2B). The clinical presentation of patient 01, the only published report of these 6 cell lines, was mild (Suormala et al., 2002). A recent report on a pair of siblings homozygous for p.Arg377His has been published (Lossos et al., 2014). In these patients, fibroblast enzyme activity varied between 18% and 52% of control, similar to our findings of 35% and 30% enzyme activity in cells homozygous for the same mutation (Nos. 31, 47). The patients described by Lossos and co-workers presented between 29 and 50 years of age with progressive spastic paraparesis and polyneuropathy associated with behavioural changes and cognitive impairment, and were responsive to therapy. Therefore, even in individuals with high levels of enzyme activity, kinetic abnormalities may well lead to functional deficiency causing clinical abnormalities - reinforcing the need for kinetic characterization beyond

This article is protected by copyright. All rights reserved.

18

measurement of specific activity. Whether high-dose substrate (precursor) therapy with (e.g. nicotinamide) would be of further benefit to these patients remains to be determined. Many of the cell lines with disturbed NADPH binding also showed disturbed AdoMet inhibition. This may be either due to the antagonistic effect previously reported for these ligands (Jencks and Mathews, 1987), or due to direct affinity changes from mutation of potential binding residues within the regulatory domain known to bind AdoMet (Sumner et al., 1986). In support of the latter explanation, all 7 cell lines with high-normal or increased sensitivity to AdoMet inhibition had at least one missense mutation clustered around the putative linker region in exon 6, while 10 out of the 12 cell lines with virtually no inhibition had at least one mutation clustering around the exon 10 to 11 boundary (Table 2). Although the mutational pattern is intriguing, the physiological significance of AdoMet binding disturbance remains unclear. Twelve cell lines, with 16 different mutations, had residual activity but no disturbances in affinity for the substrates or FAD. The decreased activity in combination with unperturbed binding kinetics in these cell lines points to alternative mechanisms of dysfunction. Conclusion We have performed an extensive biochemical and molecular genetic investigation into severe MTHFR deficiency. We found a good correlation between mutation the type and location of mutation and enzyme level and kinetic characteristics. Our results suggest that patients that have high residual activity, e.g. > 30%, may remain undetected if only specific activity is assayed, indicating the importance of performing enzyme kinetics, especially in vitro FAD responsiveness and affinity values for the natural substrates to detect functional abnormalities. However, this requires utilization of the physiological forward assay. This study reinforces the notion of distinct domains responsible for specific substrate and cofactor This article is protected by copyright. All rights reserved.

19

binding and suggests that reduced NADPH binding may be the cause of MTHFR deficiency in some patients, and that it’s binding is governed by the regulatory domain. Further, our findings point to the possible employment of cofactor (riboflavin) or substrate (nicotinamide) as therapy for patients with specific mutations in this difficult to treat disorder. The correlation of clinical data with the thorough experimental approach described here will help further clarify genotype-phenotype relationships as well as their underlying mechanisms.

Acknowledgments This work was supported by the Rare Disease Initiative Zurich (radiz), a clinical research priority program for rare diseases of the University of Zurich, Switzerland and the Swiss National Science Foundation (SNSF 31003A_138521). Institutional support for J.S., H.V. and V.K. was provided by research program RVO VFN 64165 and PRVOUK-P24/LF1/3.

References Bathgate D, Yu-Wai-Man P, Webb B, Taylor RW, Fowler B, Chinnery PF. 2012. Recessive spastic paraparesis associated with complex I deficiency due to MTHFR mutations. J Neurol Neurosurg Psychiatry 83:115 Ben-Shachar S, Zvi T, Rolfs A, Breda Klobus A, Yaron Y, Bar-Shira A, Orr-Urtreger A. 2012. A founder mutation causing a severe methylenetetrahydrofolate reductase (MTHFR) deficiency in Bukharian Jews. Mol Genet Metab 107:608-10 Brattstrom L, Wilcken DE, Ohrvik J, Brudin L. 1998. Common methylenetetrahydrofolate reductase gene mutation leads to hyperhomocysteinemia but not to vascular disease: the result of a meta-analysis. Circulation 98:2520-6 This article is protected by copyright. All rights reserved.

20

Coelho D, Kim JC, Miousse IR, Fung S, du Moulin M, Buers I, Suormala T, Burda P, Frapolli M, Stucki M, Nurnberg P, Thiele H et al. 2012. Mutations in ABCD4 cause a new inborn error of vitamin B12 metabolism. Nat Genet 44:1152-5 Crushell E, O'Leary D, Irvine AD, O'Shea A, Mayne PD, Reardon W. 2012. Methylenetetrahydrofolate reductase (MTHFR) deficiency presenting as a rash. Am J Med Genet A 158A:2254-7 Daubner SC, Matthews RG. 1982. Purification and properties of methylenetetrahydrofolate reductase from pig liver. J Biol Chem 257:140-5 Forges T, Chery C, Audonnet S, Feillet F, Gueant JL. 2010. Life-threatening methylenetetrahydrofolate reductase (MTHFR) deficiency with extremely early onset: characterization of two novel mutations in compound heterozygous patients. Mol Genet Metab 100:143-8 Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, Boers GJ, den Heijer M, Kluijtmans LA, van den Heuvel LP, Rozen R. 1995. A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet 10:111-3 Giunta C, Superti-Furga A, Spranger S, Cole WG, Steinmann B. 1999. Ehlers-Danlos syndrome type VII: clinical features and molecular defects. J Bone Joint Surg Am 81:225-38 Goyette P, Christensen B, Rosenblatt DS, Rozen R. 1996. Severe and mild mutations in cis for the methylenetetrahydrofolate reductase (MTHFR) gene, and description of five novel mutations in MTHFR. Am J Hum Genet 59:1268-75 Goyette P, Frosst P, Rosenblatt DS, Rozen R. 1995. Seven novel mutations in the methylenetetrahydrofolate reductase gene and genotype/phenotype correlations in severe methylenetetrahydrofolate reductase deficiency. Am J Hum Genet 56:1052-9

This article is protected by copyright. All rights reserved.

21

Goyette P, Pai A, Milos R, Frosst P, Tran P, Chen Z, Chan M, Rozen R. 1998. Gene structure of human and mouse methylenetetrahydrofolate reductase (MTHFR). Mamm Genome 9:652-6 Goyette P, Rozen R. 2000. The thermolabile variant 677C-->T can further reduce activity when expressed in cis with severe mutations for human methylenetetrahydrofolate reductase. Hum Mutat 16:132-8 Goyette P, Sumner JS, Milos R, Duncan AM, Rosenblatt DS, Matthews RG, Rozen R. 1994. Human methylenetetrahydrofolate reductase: isolation of cDNA, mapping and mutation identification. Nat Genet 7:195-200 Guenther BD, Sheppard CA, Tran P, Rozen R, Matthews RG, Ludwig ML. 1999. The structure and properties of methylenetetrahydrofolate reductase from Escherichia coli suggest how folate ameliorates human hyperhomocysteinemia. Nat Struct Biol 6:35965 Hanson NQ, Aras O, Yang F, Tsai MY. 2001. C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase gene: incidence and effect of combined genotypes on plasma fasting and post-methionine load homocysteine in vascular disease. Clin Chem 47:661-6 Hustad S, Ueland PM, Vollset SE, Zhang Y, Bjorke-Monsen AL, Schneede J. 2000. Riboflavin as a determinant of plasma total homocysteine: effect modification by the methylenetetrahydrofolate reductase C677T polymorphism. Clin Chem 46:1065-71 Jencks DA, Mathews RG. 1987. Allosteric inhibition of methylenetetrahydrofolate reductase by adenosylmethionine. Effects of adenosylmethionine and NADPH on the equilibrium between active and inactive forms of the enzyme and on the kinetics of approach to equilibrium. J Biol Chem 262:2485-93

This article is protected by copyright. All rights reserved.

22

Kluijtmans LA, Wendel U, Stevens EM, van den Heuvel LP, Trijbels FJ, Blom HJ. 1998. Identification of four novel mutations in severe methylenetetrahydrofolate reductase deficiency. Eur J Hum Genet 6:257-65 Lee MN, Takawira D, Nikolova AP, Ballou DP, Furtado VC, Phung NL, Still BR, Thorstad MK, Tanner JJ, Trimmer EE. 2009. Functional role for the conformationally mobile phenylalanine 223 in the reaction of methylenetetrahydrofolate reductase from Escherichia coli. Biochemistry 48:7673-85 Litzkas P, Jha KK, Ozer HL. 1984. Efficient transfer of cloned DNA into human diploid cells: protoplast fusion in suspension. Mol Cell Biol 4:2549-52 Lossos A, Teltsh O, Milman T, Meiner V, Rozen R, Leclerc D, Schwahn BC, Karp N, Rosenblatt DS, Watkins D, Shaag A, Korman SH, Heyman SN, Gal A, Newman JP, Steiner-Birmanns B, Abramsky O, Kohn Y. 2014. Severe methylenetetrahydrofolate reductase deficiency: clinical clues to a potentially treatable cause of adult-onset hereditary spastic paraplegia. JAMA Neurol 71:901-4 Marini NJ, Gin J, Ziegle J, Keho KH, Ginzinger D, Gilbert DA, Rine J. 2008. The prevalence of folate-remedial MTHFR enzyme variants in humans. Proc Natl Acad Sci U S A 105:8055-60 Martin YN, Salavaggione OE, Eckloff BW, Wieben ED, Schaid DJ, Weinshilboum RM. 2006. Human methylenetetrahydrofolate reductase pharmacogenomics: gene resequencing and functional genomics. Pharmacogenet Genomics 16:265-77 Matthews RG, Vanoni MA, Hainfeld JF, Wall J. 1984. Methylenetetrahydrofolate reductase. Evidence for spatially distinct subunit domains obtained by scanning transmission electron microscopy and limited proteolysis. J Biol Chem 259:11647-50 Markham AF. 1989. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 17:2503-16

This article is protected by copyright. All rights reserved.

23

Pavlikova M, Sokolova J, Janosikova B, Melenovska P, Krupkova L, Zvarova J, Kozich V. 2012. Rare allelic variants determine folate status in an unsupplemented European population. J Nutr 142:1403-9 Pejchal R, Campbell E, Guenther BD, Lennon BW, Matthews RG, Ludwig ML. 2006. Structural perturbations in the Ala --> Val polymorphism of methylenetetrahydrofolate reductase: how binding of folates may protect against inactivation. Biochemistry 45:4808-18 Pejchal R, Sargeant R, Ludwig ML. 2005. Structures of NADH and CH3-H4folate complexes of Escherichia coli methylenetetrahydrofolate reductase reveal a spartan strategy for a ping-pong reaction. Biochemistry 44:11447-57 Rady PL, Szucs S, Grady J, Hudnall SD, Kellner LH, Nitowsky H, Tyring SK, Matalon RK. 2002. Genetic polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) in ethnic populations in Texas; a report of a novel MTHFR polymorphic site, G1793A. Am J Med Genet 107:162-8 Richard E, Desviat LR, Ugarte M, Perez B. 2013. Oxidative stress and apoptosis in homocystinuria patients with genetic remethylation defects. J Cell Biochem 114:18391 Rummel T, Suormala T, Haberle J, Koch HG, Berning C, Perrett D, Fowler B. 2007. Intermediate hyperhomocysteinaemia and compound heterozygosity for the common variant c.677C>T and a MTHFR gene mutation. J Inherit Metab Dis 30:401 Schiff M, Benoist JF, Tilea B, Royer N, Giraudier S, Ogier de Baulny H. 2011. Isolated remethylation disorders: do our treatments benefit patients? J Inherit Metab Dis 34:137-45

This article is protected by copyright. All rights reserved.

24

Shan X, Wang L, Hoffmaster R, Kruger WD. 1999. Functional characterization of human methylenetetrahydrofolate reductase in Saccharomyces cerevisiae. J Biol Chem 274:32613-8 Sibani S, Leclerc D, Weisberg IS, O'Ferrall E, Watkins D, Artigas C, Rosenblatt DS, Rozen R. 2003. Characterization of mutations in severe methylenetetrahydrofolate reductase deficiency reveals an FAD-responsive mutation. Hum Mutat 21:509-20 Strauss KA, Morton DH, Puffenberger EG, Hendrickson C, Robinson DL, Wagner C, Stabler SP, Allen RH, Chwatko G, Jakubowski H, Niculescu MD, Mudd SH. 2007. Prevention of brain disease from severe 5,10-methylenetetrahydrofolate reductase deficiency. Mol Genet Metab 91:165-75 Sumner J, Jencks DA, Khani S, Matthews RG. 1986. Photoaffinity labeling of methylenetetrahydrofolate reductase with 8-azido-S-adenosylmethionine. J Biol Chem 261:7697-700 Suormala T, Gamse G, Fowler B. 2002. 5,10-Methylenetetrahydrofolate reductase (MTHFR) assay in the forward direction: residual activity in MTHFR deficiency. Clin Chem 48:835-43 Tonetti C, Saudubray JM, Echenne B, Landrieu P, Giraudier S, Zittoun J. 2003. Relations between molecular and biological abnormalities in 11 families from siblings affected with methylenetetrahydrofolate reductase deficiency. Eur J Pediatr 162:466-75 Tran P, Leclerc D, Chan M, Pai A, Hiou-Tim F, Wu Q, Goyette P, Artigas C, Milos R, Rozen R. 2002. Multiple transcription start sites and alternative splicing in the methylenetetrahydrofolate reductase gene result in two enzyme isoforms. Mamm Genome 13:483-92

This article is protected by copyright. All rights reserved.

25

Tsuji M, Takagi A, Sameshima K, Iai M, Yamashita S, Shinbo H, Furuya N, Kurosawa K, Osaka H. 2011. 5,10-Methylenetetrahydrofolate reductase deficiency with progressive polyneuropathy in an infant. Brain Dev 33:521-4 Urreizti R, Moya-Garcia AA, Pino-Angeles A, Cozar M, Langkilde A, Fanhoe U, Esteves C, Arribas J, Vilaseca MA, Perez-Duenas B, Pineda M, Gonzalez V et al. 2010. Molecular characterization of five patients with homocystinuria due to severe methylenetetrahydrofolate reductase deficiency. Clin Genet 78:441-8 van der Put NM, Gabreels F, Stevens EM, Smeitink JA, Trijbels FJ, Eskes TK, van den Heuvel LP, Blom HJ. 1998. A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for neural-tube defects? Am J Hum Genet 62:1044-51 van der Put NM, van den Heuvel LP, Steegers-Theunissen RP, Trijbels FJ, Eskes TK, Mariman EC, den Heyer M, Blom HJ. 1996. Decreased methylene tetrahydrofolate reductase activity due to the 677C-->T mutation in families with spina bifida offspring. J Mol Med (Berl) 74:691-4 Watkins D, Rosenblatt DS. 2012. Update and new concepts in vitamin responsive disorders of folate transport and metabolism. J Inherit Metab Dis 35:665-70 Watkins D, Rosenblatt DS. 2014. Inherited Disorders of Folate and Cobalamin Transport and Metabolism. In: Valle D, Beaudet AL, Vogelstein B, Kinzler KW, Antonarakis SE, Ballabio A, Gibson M, Mitchell G, editors. The Online Metabolic and Molecular Bases of Inherited Disease, vol online edition. New York: McGraw-Hill Wilkemeyer MF, Crane AM, Ledley FD. 1991. Differential diagnosis of mut and cbl methylmalonic aciduria by DNA-mediated gene transfer in primary fibroblasts. J Clin Invest 87:915-8

This article is protected by copyright. All rights reserved.

26

Wilson CP, McNulty H, Ward M, Strain JJ, Trouton TG, Hoeft BA, Weber P, Roos FF Horigan G, McAnena L, Scott JM. 2013. Blood pressure in treated hypertensive individuals with the MTHFR 677TT genotype is responsive to intervention with riboflavin: findings of a targeted randomized trial. Hypertension 61:1302-8 Winkelmayer WC, Sunder-Plassmann G, Huber A, Fodinger M. 2004. Patterns of cooccurrence of three single nucleotide polymorphisms of the 5,10methylenetetrahydrofolate reductase gene in kidney transplant recipients. Eur J Clin Invest 34:613-8 Yamada K, Chen Z, Rozen R, Matthews RG. 2001. Effects of common polymorphisms on the properties of recombinant human methylenetetrahydrofolate reductase. Proc Natl Acad Sci U S A 98:14853-8

This article is protected by copyright. All rights reserved.

27

Figure 1. Identification of an MTHFR splicing defect in patients homozygous for c.1542G>A (p.Lys510=). A. Electropherogram of RT-PCR products. RNA extracted from three patient (No. 17, No. 69, No. 51) and one control fibroblast cell line was amplified using RT-PCR across a region spanning exons 7-9 (primers, forward: TCTACCTGAAGAGCAAGTC; reverse: CTTCCAGAACATGAAGCTGAC). Bands were resolved using agarose gel (1.5 %) electrophoresis, with molecular mass marker and selected band sizes (in bp) on the left. Black arrow: cDNA lacking exon 8. Expected size with exon 8: 536 bp; without: 353 bp. Open arrows: heteroduplex expected to contain normal cDNA and cDNA with a 5bp addition (GTGTG) from intron 8. B. Scheme of missplicing due to c.1542G>A. The exons 7-9 are depicted as boxes, the sequences of exon/intron junctions are shown by letters. The upper part indicated the wild type allele with normal splicing pattern. The lower part shows the abnormal splicing of the mutant allele producing the r.1360_1542del and the r.1542_1543ins5 variant transcripts.

This article is protected by copyright. All rights reserved.

28

Figure 2. Schematic representation of the MTHFR gene and protein showing type location of all mutations identified in our cell cohort. The MTHFR coding sequence is schematized as a horizontal bar in the middle, with exons, cDNA sequence, and amino acid numbers at exon boundaries identified. The position of the three domains, catalytic, linker and regulatory, are shown on a line above. NADPH, methyleneTHF, FAD and AdoMet binding domains are shown for easy visualization, but do not represent exact binding sites. NADPH is shown with a question mark over the regulatory domain as a possible interpretation of our results.

This article is protected by copyright. All rights reserved.

29

Table 1. Mutations detected in patient cell lines with < 1.5% residual MTHFR activity and 4 additional patients listed according to the location of the mutations from 5’ to 3’ end Nucleotide changea Cell Line No. 20 66 82 59 39 36 41 43 60c 42 64 74 44 19 23 40 48 21 65 16d 18 25 84e 17 22 50 51 67

Allele 1 Allele 2 c.188G>C c.188G>C c.249-1G>T c.781T>G c.349G>A c.792+1G>T c.349G>A c.1025T>C c.391C>T c.655_657del c.452A>C c.452A>C c.452A>C c.452A>C c.452A>C c.452A>C c.458_459delinsTT c.458_459delinsTT c.559C>T c.559C>T c.559C>T c.1179-2delA c.776G>T c.1179-2delA c.779T>A c.1025T>C c.1027T>G c.1027T>G c.1027T>G c.1027T>G c.1027T>G c.1027T>G c.1027T>G c.1027T>G c.1179-2delA c.1179-2delA c.1332G>A c.1695G>A c.1420G>T c.1420G>T c.1420G>T c.1420G>T c.1420G>T c.1420G>T c.1420G>T c.1420G>T c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A

Exon/ Intron

exon 1 exon 1 intron 1 exon 4 exon 2 intron 4 exon 2 exon 5 exon 2 exon 4 exon 2 exon 2 exon 2 exon 2 exon 2 exon 2 exon 2 exon 2 exon 3 exon 3 exon 3 intron 6 exon 4 intron 6 exon 4 exon 5 exon 5 exon 5 exon 5 exon 5 exon 5 exon 5 exon 5 exon 5 intron 6 intron 6 exon 7 exon 10 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8

Predicted amino acid change Allele 1 Allele 2 p.Trp59Ser p.Trp59Ser splice site p.Phe257Val p.Ala113Thr splice site p.Ala113Thr p.M338Thr p.His127Tyr p.Lys215del p.Gln147Pro p.Gln147Pro p.Gln147Pro p.Gln147Pro p.Gln147Pro p.Gln147Pro p.Gly149Val p.Gly149Val p.Arg183* p.Arg183* p.Arg183* p.Trp389Trpfs*1 p.Gly255Val p.Trp389Trpfs*1 p.Ile256Asn p.Met338Thr p.Trp339Gly p.Trp339Gly p.Trp339Gly p.Trp339Gly p.Trp339Gly p.Trp339Gly p.Trp339Gly p.Trp339Gly p.Trp389Trpfs*1 p.Trp389Trpfs*1 (p.Ser440=)/splicing p.Trp561* p.Glu470* p.Glu470* p.Glu470* p.Glu470* p.Glu470* p.Glu470* p.Glu470* p.Glu470* (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing

This article is protected by copyright. All rights reserved.

Domain

catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic regulatory catalytic regulatory catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory

Type of mutation Allele 1 Allele 2 missense missense splice site missense missense splice site missense missense missense small deletion missense missense missense missense missense missense missense missense nonsense nonsense nonsense splice site missense splice site missense missense missense/splicing missense/splicing missense/splicing missense/splicing missense/splicing missense/splicing missense/splicing missense/splicing splice site splice site splicing nonsense nonsense nonsense nonsense nonsense nonsense nonsense nonsense nonsense splicing splicing splicing splicing splicing splicing splicing splicing splicing splicing

c.677 status

MTHFR activityb +FAD ,%

+FAD/ –FAD

CC

0.6

1.00

CT

0.7

0.89

TT

0.3

0.92

TT

0.5

1.20

CT

0.1

0.53

CC

1.2

1.08

CC

0.5

0.80

CC

0.5

0.80

CC

0.8

1.14

CC

0.5

0.87

CC

0.5

1.03

CC

0.7

0.89

CT

0.8

1.12

TT

0.6

0.82

TT

0.5

1.03

TT

0.5

1.03

TT

0.2

1.50

CC

0.5

0.84

CT

1.1

1.07

CC

0.6

0.95

CC

0.5

0.84

CC

0.6

0.95

CC

-

-

CC

0.6

0.82

CC

0.6

1.02

CC

0.6

0.89

CC

0.3

1.08

CC

0.6

0.83 30

69 70 83e 85e 86e 34

c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1542G>A c.1981T>C c.1981T>C

exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 8 exon 11 exon 11

(p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing (p.Lys510=)/splicing p.*657Argextfs*50 p.*657Argextfs*50

regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory

splicing splicing splicing splicing splicing splicing splicing splicing splicing splicing no-stop no-stop

CC

0.7

1.08

CC

0.8

1.17

CC

-

-

CC

-

-

CC

-

-

CC

0.9

1.06

a. Numbering of the nucleotide changes and exons and introns follows the original nomenclature of Goyette et al., 1998 with +13 as the number of the A of the ATG initiation codon; novel mutations are presented in bold. b. Summary of fibroblast MTHFR activities are included for comparison, and include mean specific activity assayed in the presence of 75 µM FAD (+FAD) and expressed as % of the mean activity in control cells, and mean ratio of activity assayed +FAD divided by activity assayed without added FAD. In patient cells a mean ratio higher than 1.6 indicates in vitro FAD responsiveness. Details of enzyme data are presented in Supp. Table S3. c. Our patient 60 is the patient presented in Tsuji et al., 2011. d. Our patient 16 is patient 2 presented in Urreizti et al., 2010. e. Patient with only mutation analysis done (mutations confirmed by heterozygosity in the parents) no enzyme activities measured in fibroblasts.

This article is protected by copyright. All rights reserved.

31

Table 2. Mutations detected in patient cell lines with > 1.5% residual MTHFR activity grouped according to enzyme characteristics and summary of enzymatic data

Nucleotide changea Cell Line No.

Allele 1 Allele 2

Exon/ Intron

Molecular genetic data Predicted amino Domain acid change Allele 1 Allele 2

Type of mutation

c.677 status

Allele 1 Allele 2

A. Cell lines with in vitro FAD responsiveness c.249-1G>T intron 1 splice site 09 c.482G>A exon 2 p.Arg157Gln c.398C>A exon 2 p.Thr129Asn 71e c.769G>T exon 4 p.Val253Phe c.482G>A exon 2 p.Arg157Gln 32 c.482G>A exon 2 p.Arg157Gln c.535G>A exon 3 p.Ala175Thr c.1178G>A exon 6 (p.Trp389*) / 55f splicing c.596C>T exon 3 p.Ala195Val 33g c.596C>T exon 3 p.Ala195Val

catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic/ regulatory catalytic catalytic

splice site missense missense missense missense missense missense (nonsense) / splicing missense missense

B. Cell lines with reduced affinity for NADPH 5’ UTR c.-40_-41delTC 30 c.1727C>T exon 10 p.Pro572Leu c.167G>A exon 1 p.Arg52Gln 01 exon 7 p.Trp421Ser c.1274G>C exon 1 p.Arg68Gly c.214C>G 61 intron 9 splice site c.1644+2T>G exon 2 p.Leu89_Pro101dup c.276_314dup 29 exon 8 p.Tyr506Asp c.1528T>G exon 4 p.Gly196Asp c.599G>A 58 c.1172G>A exon 6 p.Gly387Asp exon 4 p.Ile226del c.689_691del 15 intron10 p.Asp585Glyfs*14 c.1765-18G>A exon 6 p.Pro348Ser c.1054C>T 76 exon 9 p.Val536Phe c.1618G>T exon 6 p.His354Tyr c.1072C>T 57 exon 6 p.His354Tyr c.1072C>T exon 6 p.Arg363His c.1100G>A 28 exon 6 p.Arg363His c.1100G>A exon 6 p.Lys372Glu c.1126A>G 52 intron 8 p.Tyr512Trpfs*3 c.1542+2T>C c.1141C>T exon 6 p.Arg377Cys 54 c.1359+1G>A intron 7 splice site c.1142G>A exon 6 p.Arg377His 47 c.1142G>A exon 6 p.Arg377His c.1142G>A exon 6 p.Arg377His 31 c.1142G>A exon 6 p.Arg377His exon 7 p.Trp421Ser c.1274G>C 10 c.1420G>T exon 8 p.Glu470* intron 9 splice site c.1644+2T>G 37 intron 9 splice site c.1644+2T>G c.1733T>G exon 10 p.Val574Gly 56h c.1733T>G exon 10 p.Val574Gly exon 10 p.Val575Gly c.1736T>G 75 exon 10 p.Val575Gly c.1736T>G intron10 splice site c.1764+1G>T 12 intron10 splice site c.1764+1G>T intron10 splice site c.1764+1G>T 14 intron10 splice site c.1764+1G>T intron10 p.Asp585Glyfs*14 c.1765-18G>A 13 intron10 p.Asp585Glyfs*14 c.1765-18G>A

5’ UTR regulatory catalytic regulatory catalytic regulatory catalytic regulatory catalytic regulatory catalytic regulatory catalytic regulatory catalytic catalytic regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory

small deletion missense missense missense missense splice site duplication missense missense missense small deletion splicing missense missense missense missense missense missense missense splice site missense splice site missense missense missense missense missense nonsense splice site splice site missense missense missense missense splice site splice site splice site splice site splicing splicing

This article is protected by copyright. All rights reserved.

Summary of enzymatic data Ratio of values, MTHFR activityb patient / control +FAD heat Kid, Kmc, +FAD –FAD stable, NADPH AdoMet % ratio %

CC

9.3

2.28

44.8

4.04

2.5

CT

1.7

1.73

31.4

0.36

6.9

TT

10.4

3.05

16.8

2.94

2.8

CT

1.7

1.96

51.3

2.29

>18

CC

17.0

6.09

36.8

0.55

2.0

CT

9.9

1.10

22.5

3.84

>18

CT

25.5

1.02

18.1

2.10

1.8

CT

5.1

1.14

29.8

5.90

2.9

CC

8.1

1.09

37.3

5.08

6.3

CC

11.3

1.02

37.9

3.78

>18

CT

1.7

1.02

51.1

7.03

>18

CT

19.5

1.04

17.0

4.07

0.47

CC

42.2

1.06

46.2

5.64

0.22

TT

19.2

1.11

16.0

5.99

0.25

CT

6.3

1.07

11.1

5.19

0.47

CC

7.4

0.98

47.8

4.85

0.57

CC

30.4

1.08

47.2

5.75

0.41

CC

34.8

1.05

42.4

5.74

0.32

CT

3.8

1.13

29.0

4.04

10.7

CC

1.8

1.02

52.9

3.56

>18

TT

10.3

1.07

10.7

3.80

3.9

CC

6.5

1.02

38.8

2.89

>18

TT

3.7

1.02

31.5

5.57

>18

TT

3.0

1.10

29.7

4.36

>18

TT

2.5

1.06

29.5

4.44

>18

32

p.Asp585Glyfs*14 p.Asp585Glyfs*14 p.Asp585Glyfs*14 p.Asp585Glyfs*14 p.Leu590Cysfs*72 p.Leu590Cysfs*72 p.Leu598Pro p.Leu598Pro p.[Tyr599*; Ser603Cys] p.Leu628Pro

regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory regulatory

splicing splicing splicing splicing small deletion small deletion missense missense nonsense; missense missense

C. Cell lines with normal affinity for NADPH exon 1 p.Arg46Trp c.148C>T 04 c.167G>A exon 1 p.Arg52Gln exon 1 p.Arg46Trp c.148C>T 35 c.1982G>C exon 11 p.*657Serextfs*50 exon 1 p.Arg46Gln c.149G>A 06 c.559C>T exon 3 p.Arg183* exon 2 p.Arg82Trp c.256C>T 11 exon 2 p.Cys130Arg c.400T>C exon 2 p.Ala113Thr c.349G>A 78 exon 2 p.Ala113Thr c.349G>A c.471C>G exon 2 p.Ile153Met 03 c.1542G>A exon 8 p.Lys510=/splicing exon 3 c.560G>A p.Arg183Gln exon 3 53 c.560G>A p.Arg183Gln exon 3 c.560G>A p.Arg183Gln 68 c.560G>A exon 3 p.Arg183Gln exon 4 c.685A>C p.Ile225Leu c.685A>C exon 4 77 p.Ile225Leu exon 4 p.Pro254Ser c.772C>T 62 exon 4 p.Pro254Ser c.772C>T exon 5 p.Arg335His c.1016G>A 73 intron 6 p.Trp389Trpfs*1 c.1179-2delA exon 7 p.Ser440=/splicing c.1332G>A 72 intron 9 splice site c.1644+2T>G

catalytic catalytic catalytic regulatory catalytic catalytic catalytic catalytic catalytic catalytic catalytic regulatory catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic catalytic regulatory regulatory regulatory

missense missense missense no-stop missense nonsense missense missense missense missense missense splicing missense missense missense missense missense missense missense missense missense splice site splicing splice site

26 79 49h 38

07

c.1765-18G>A c.1765-18G>A c.1765-18G>A c.1765-18G>A c.1780delC c.1780delC c.1805T>C c.1805T>C c.[1809_1810deli nsGT; 1820C>G] c.1895T>C

intron10 intron10 intron10 intron10 exon 11 exon 11 exon 11 exon 11 exon 11 exon 11 exon 11

CC

3.5

1.10

44.9

6.29

>18

CC

3.7

1.05

43.7

4.18

>18

CC

2.0

1.04

51.4

4.18

>18

CC

3.1

1.09

43.4

2.25

>18

CT

5.9

1.07

43.1

2.35

9.3

TT

9.7

1.08

10.2

1.13

1.6

TT

2.3

1.06

30.8

1.28

5.9

CT

7.3

1.14

15.2

0.90

2.4

TT

3.4

1.15

16.4

1.51

2.6

CC

3.6

1.06

16.4

1.52

1.3

CC

14.8

1.01

25.1

1.11

1.7

CC

20.6

1.02

27.1

1.36

0.83

CC

21.8

0.99

27.4

1.23

0.59

TT

4.2

1.06

13.9

1.15

2.4

CC

2.0

0.98

54.3

0.57

2.1

CT

5.3

0.98

27.6

0.80

1.9

CC

2.2

0.94

66.1

1.17

11.3

a. Numbering of the nucleotide changes, as well as of exons and introns, follows the original nomeclature of Goyette et al.,1998 with +13 as the number of the A of the ATG initiation codon, except for the c.-40_-41delTC change within 5’ UTR for which the A of the ATG initiation codon is +1; novel mutations are presented in bold. Summary of enzymatic data are given in the table for comparison and include: b. Mean MTHFR activity in fibroblasts assayed with 75 µM FAD and expressed as % of the mean control value (+FAD, %), the mean +FAD/–FAD activity ratio (a ratio higher than 1.6 indicates in vitro FAD responsiveness) as well as the mean percentage of thermo-stable activity remaining after heat-treatment (46°C for 5 min) (for details see Supp. Table S3). c. The relative Km for NADPH expressed as the ratio of mean Km in patient cells divided by mean control Km (for details see Supp. Table S4). d. The relative Ki for AdoMet inhibition expressed as the ratio of mean Ki in patient cells divided by mean control Ki (for details see Supp. Table S4); >18 represents Ki values higher than 1 mM interpreted as absence of inhibition. e. Our patient 71 is the one reported in Crushell et al., 2011. f .Our patient 55 is the younger sibling in Forges et al., 2010. g .Our patient 33 is the proband in Bathgate et al., 2012. h. Our patient 49 is patient 4, and our patient 56 is patient 5 in Urreizti et al., 2010.

This article is protected by copyright. All rights reserved.

33