Transgenic Res (2014) 23:729–742 DOI 10.1007/s11248-014-9812-1

ORIGINAL PAPER

Interaction of diet and the masou salmon D5-desaturase transgene on D6-desaturase and stearoyl-CoA desaturase gene expression and N-3 fatty acid level in common carp (Cyprinus carpio) Qi Cheng • Baofeng Su • Zhenkui Qin • Chia-Chen Weng • Fang Yin • Yangen Zhou • Michael Fobes • Dayan A. Perera • Mei Shang • Fabio Soller Zhiyi Shi • Allen Davis • Rex A. Dunham

•

Received: 28 November 2013 / Accepted: 30 June 2014 / Published online: 11 July 2014 Ó Springer International Publishing Switzerland 2014

Abstract The masou salmon D5-desaturase-like gene (D5D) driven by the common carp b-actin promoter was transferred into common carp (Cyprinus carpio) that were fed two diets. For P1 transgenic fish fed a commercial diet, D6-desaturase-like gene (D6D) and stearoyl-CoA desaturase (SCD) mRNA levels in muscle were up-regulated (P \ 0.05) 12.7- and 17.9fold, respectively, and the D6D mRNA level in the gonad of transgenic fish was up-regulated 6.9-fold (P \ 0.05) compared to that of non-transgenic fish. In contrast, D6D and SCD mRNA levels in transgenic fish were dramatically down-regulated (P \ 0.05), 50.2- and 16.7-fold in brain, and 5.4- and 2.4-fold in liver, respectively, in comparison with those of nontransgenic fish. When fed a specially formulated diet,

Qi Cheng and Baofeng Su are co-first authors. Q. Cheng  B. Su  Z. Qin  C.-C. Weng  Y. Zhou  M. Fobes  D. A. Perera  M. Shang  F. Soller  A. Davis  R. A. Dunham (&) School of Fisheries, Aquaculture, and Aquatic Sciences, Auburn University, Auburn, AL 36839, USA e-mail: [email protected] Q. Cheng  Z. Shi Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Shanghai Ocean University, Shanghai 201306, People’s Republic of China

D6D and SCD mRNA levels in muscle of transgenic fish were up-regulated (P \ 0.05) 41.5- and 8.9-fold, respectively, and in liver 6.0- and 3.3-fold, respectively, compared to those of non-transgenic fish. In contrast, D6D and SCD mRNA levels in the gonad of transgenic fish were down-regulated (P \ 0.05) 5.5and 12.4-fold, respectively, and D6D and SCD mRNA levels in the brain were down-regulated 14.9- and 1.4fold (P \ 0.05), respectively, compared to those of non-transgenic fish. The transgenic common carp fed the commercial diet had 1.07-fold EPA, 1.12-fold DPA, 1.07-fold DHA, and 1.07-fold higher observed total omega-3 fatty acid levels than non-transgenic common carp. Although these differences were not statistically different (P [ 0.05), there were significantly (P \ 0.10) higher omega-3 fatty acid levels when considering the differences for all of the individual omega-3 fatty acids. The genotype 9 diet Present Address: D. A. Perera Department of Biology, West Virginia State University, Institute, WV 25112-1000, USA Present Address: F. Soller Cargill Corn Milling North America, 1705 Kellie Dr, Blair, NE 68008, USA

F. Yin Department of Civil Engineering, Auburn University, Auburn, AL 36839, USA

123

730

interactions observed indicated that the potential of desaturase transgenesis cannot be realized without using a well-designed diet with the needed amount of substrates. Keywords Desaturase transgenic common carp  Omega-3 fatty acid  Gene expression  Genotype 9 diet 9 tissue interaction

Introduction Polyunsaturated fatty acids (PUFAs) are predominantly a combination of omega-3 (n-3) and omega-6 (n-6) fatty acids (FAs). Development of food resources with PUFAs is becoming a field of interest in functional food studies. Metabolism of the omega-3 and omega-6 fatty acids is competitive because both pathways use the same set of enzymes (Simopoulos 2002). The n-3 fatty acids, including a-linolenic acid (ALA, C18:3 n-3), eicosapentaenoic acid (EPA, C20:5 n-3), docosapentaenoic acid (DPA, C22:5 n-3), and docosahexaenoic acid (DHA, C22:6 n-3) and n-6 fatty acids are essential fatty acids (EFAs) that cannot be synthesized de novo in mammals and therefore must be obtained from the diet. Fatty acid desaturases are pivotal enzymes for the biosynthesis of PUFAs because they add double bonds into fatty acyl chains at specific sites (Meesapyodsuk et al. 2007). They are present in all groups of organisms and play a key role in the maintenance of the proper structure and function of biological membranes. The ability of tissues or organs to synthesize C20 and C22 PUFAs from C18 fatty acids depends on a complex of desaturase and elongase enzymes. Stearoyl-CoA desaturase (SCD, D9-desaturase) is a key rate-limiting enzyme involved in the biosynthesis of PUFAs, which affects cellular membrane fluidity, permeability and functionality (Ntambi 1999). A proper balance among C18 fatty acids in feed is necessary to ensure that optimal quantities of the essential C20 and C22 fatty acids of the omega-6 and omega-3 families will be synthesized. D6-desaturase (D6D) is one of the most important enzymes in these syntheses. Theoretically, ALA (C18:3 n-3) is converted to DHA (C22:6 n-3) by a pathway that combines the sequential action of D6- and D5desaturase (D5D) with chain-elongation reactions. D6 and D5 desaturases are membrane-bound

123

Transgenic Res (2014) 23:729–742

desaturases and fatty acid metabolic enzymes, which behave as important factors in EPA and DHA biosynthesis and prefer n-3 to n-6 fatty acids as substrate in the process of desaturation and elongation (Simopoulos 1996, 2002). Fatty acid desaturases have been sequenced from a variety of organisms, including microrganisms, plants and animals, such as insects, fishes, mammals and humans (Marquardt et al. 2000). In the case of animals, two primary families of desaturase exist, which include D5D/D6D and SCD. These enzymes have a typical structure of three histidine boxes and two membrane-spanning domains. The D5D/D6D enzyme family contains an additional N-terminal cytochrome b5-like domain (Marquardt et al. 2000; Seiliez et al. 2001). In general, freshwater, marine and anadromous fishes have similar levels of omega-3 fatty acids (Simopoulos 1996). The omega-3 fatty acid levels are quite variable among different freshwater and among different marine species, but are less variable among anadromous species. Coldwater fishes tend to have higher levels than warmwater species. Carp (species of carp was not indicated by the author), have a value of 0.6/100 g edible fish tissue of n-3 fatty acids, which is on the low side of the range for fish (Simopoulos 1996). PUFAs are necessary for important biological functions of humans, such as regulating lipid metabolism, stimulating growth development, anti-cancer properties, anti-aging properties, immunoregulation, promoting cardiovascular health, and aiding in weight loss (Garg et al. 2006). PUFAs in the diet also help to elevate serum peroxides and depleted antioxidant reserves, and lower plasma triglycerides and help cure cardiovascular disease (Calder and Yaqoob 2009). Bang et al. (1980) demonstrated that the rarity of ischemic heart disease in Eskimos could be explained partly by the antithrombotic effect of the long-chained PUFAs, especially EPA prevalent in diets rich in marine oils. Omega-3 PUFAs induced a marked stimulation of brown adipose tissue thermogenic activity that helps to prevent obesity in rats (Oudart et al. 1997). Omega-3 fatty acid is important in early human development, especially in neural and retinal development (Dubnov-Raz et al. 2007; Innis 2008; Mozurkewich et al. 2010; Muhlhausler et al. 2011; Klemens et al. 2012; Sable et al. 2012). The most important omega-3 fatty acid for early human

Transgenic Res (2014) 23:729–742

development is DHA, which is now recognized as a physiologically essential nutrient for neural function of the brain and visual acuity for the retina (SanGiovanni and Chew 2005). Omega-3 fatty acid deficiency can result in neurological and behavioral disorders, including schizophrenia, Alzheimer’s disease, depression, and hyperactivity (Bourre 2005). PUFAs improve health, intelligence, and immunity in humans (Simopoulos 2002; Ruxton et al. 2004; Tur et al. 2012; Bradberry and Hilleman 2013). PUFAs also help promote ovarian maturation, hatch of embryos and larval survival in aquatic organisms. Wen et al. (2002) found that Chinese mitten-handed crabs (Eriocheir sinensis) fed PUFAenriched diets had a higher fecundity and egg hatchability than the control group. Koueta et al. (2002) reared juvenile cuttlefish (Sepia officinalis) and found that the groups fed a natural diet enriched in PUFAs showed faster growth and a higher rate of survival than the control group. Copeman et al. (2002) studied the role of DHA, EPA and arachidonic acid (AA, an n-6 fatty acid) on early growth, survival, lipid composition and pigmentation of yellowtail flounder (Limanda ferruginea), and found a strong positive relationship between the DHA/EPA ratio in the diet and larval size and survival. Asturiano et al. (2001) suggested that PUFAs can improve the survival rate of embryos of European sea bass (Dicentrarchus labrax). Gene transfer technology has the potential for introducing significant novel variation into the germline of a species by introduction of new or extra copies of cloned genes under novel regulation of gene expression. Most efforts in transgenic fish of importance for aquaculture have been devoted to growth enhancement or improvement of cold- or disease-resistance (Hobbs and Fletcher 2008; Dunham 2011). As aquaculture production grows, it becomes useful to apply modern biotechnologies to meet growing demand for aquaculture products in terms of both quality and quantity. Gene transfer has been used in several plants, such as tobacco (Hamada et al. 1998) and rapeseed (Knutzon et al. 1992), to increase linolenic acid level and modulate the rate of synthesis different fatty acids. The approach in rapeseed was to alter the enzyme systems for fatty acid desaturation and elongation to make omega-3 fatty acids. Reddy and Thomas (1996) cloned a cyanobacterial delta-6 desaturase gene, and expression of this gene in transgenic tobacco resulted in gamma-linolenic acid accumulation. Zhang et al.

731

(2009) transferred a D12 fatty acid desaturase (FAD2) gene from maize into yeast Saccharomyces cerevisiae, and cells expressing FAD2 had a linoleic acid (LA) content of 1.54 % of total fatty acid content, which was not present in control yeast cells. In the case of fishes, Alimuddin et al. (2005, 2007) transferred masou salmon (Oncorhynchus masou) D6desaturase-like (D6D) and D5-desaturase-like (D5D) genes into zebrafish (Danio rerio), resulting in increased EPA and DHA levels compared to the nontransgenic fish. Cai et al. (2012) studied the biological effects of the expression of a fatty acid desaturase gene in rabbit and explored the relationship between unsaturated fatty acids and the immune system. The transferred desaturase gene was effectively expressed, and improved the content of PUFAs that enhanced the innate and acquired immune function. The overall goal of the current study was to utilize dietary regulation and transgenic technology to elevate omega-3 fatty acid in common carp (Cyprinus carpio). Specific objectives were to transfer the masou salmon (O. masou) D5-desaturase-like gene to common carp to determine its effect on transcription levels of the masou salmon D5-desaturase-like gene/endogenous gene, endogenous common carp D6-desaturaselike gene, and stearoyl-CoA desaturase, to determine the effects of the transgene on fatty acid composition, and to evaluate the interactions between genotype (transgenic and non-transgenic) and diet (formulated and commercial feeds) on the gene expression profiles of D5D/D6D and SCD, and for fatty acid levels.

Materials and Methods Construction of transgene A backbone construct, FRM2bl (Gibbs and Schmale 2000) (NCBI accession#: AF170915.1), was provided by Pat Gibbs, University of Miami, and then modified. The coding sequence for green-fluorescent protein was excised from the backbone and substituted with a 1.4kb coding sequence for the O. masou delta5-desaturase-like gene (D5D, Accession ID: EU098126.1), which was provided by Goro Yoshizaki, Tokyo University of Marine Science and Technology. Expression of the D5D gene was driven by the common carp b-actin promoter. The synthetic desaturase construct (8.3 kb) also included a 50 upstream

123

732

Transgenic Res (2014) 23:729–742

insulator, the ocean pout (Macrozoarces americanus) antifreeze protein poly(A) signal, terminator, and putative boundary element (Gibbs and Schmale 2000).

of 3.6 mg kg-1 BW as the resolving dose 9 h later. Eggs from ovulating females were hand-stripped into metal pie pans coated with vegetable shortening.

Plasmid DNA preparation

Fertilization, electroporation and incubation

The plasmid was transformed into One ShotÒ Top10 chemically competent Escherichia coli cells (cat#: C4040-10, Invitrogen) following the procedures recommended by the manufacturer. After harvest and DNA extraction, the plasmid was linearized with SfiI (20,000 units/ml, New England Biolabs) following the product’s protocol with little modification. For plasmid digestion, a mixed 50.0-ll reaction solution containing 1.0 lg of plasmid DNA, NEBuffer 4 (109), and BSA (1009) was utilized, and the volume adjusted to 50.0 ll using water. DNA agarose gel electrophoresis was used to analyze the plasmid. Once the size of the construct was confirmed, a maxi-prep plasmid DNA extraction was performed using a Qiagen maxi-prep kit. A phenol–chloroform–ethanol method was used to inactivate the SfiI enzyme and purify the linearized plasmid DNA. The quantity of DNA was measured using UV-spectrophotometer. The plasmid was prepared separately in two tubes for the purpose of double electroporation. One was diluted in 2.0 ml (0.9 %) saline with a concentration of 50 lg ml-1 of the transgene. The purpose of the saline was to dehydrate the sperm once it was introduced to the solution; when rehydrated, transformation rates of the embryos can be improved (Kang et al. 1999; Collares et al. 2010). The other for the second electroporation was prepared in 9.0 ml TE buffer (5 mM Tris–HCl, 0.5 M EDTA, pH = 8.0) with a concentration 50 lg ml-1.

One or two drops of sperm were placed in the desaturase plasmid solution (1.0 ml) in saline and mixed. Sperm was kept in this solution a minimum of 5 min before use. Then DNA/sperm solution was poured into a 10-ml petri dish and completely filled with fresh water. The sperm then was electroporated with a Baekon 2000 macromolecule transfer system (Baekon, Inc., Saratoga, CA). Parameters were 6 kV, 27 pulses, 0.8s burst, 4 cycles, 160 ls (Powers et al. 1992). The common carp eggs were fertilized with the electroporated sperm and incubated in pond water for 10 min. Then the fertilized eggs were put back into the 10 ml petri dish and incubated in desaturase plasmid solution in TE buffer for 10 min followed by electroporation. The double electroporation procedure is a standard practice in our laboratory (Su 2012; Dunham and Winn 2014), and is a modification of the procedures of Kang et al. (1999). Embryos then were moved into 8.0–l tubs with 5.0 l Holtfreter’s solution (Bart and Dunham 1996) and incubated statically. The embryos were gently agitated with compressed air delivered through airstones. Dead embryos were removed daily before changing the Holtfreter’s solution.

Broodstock spawning Sexually mature male and female common carp were harvested from the Fisheries Genetics Unit, E.W. Shell Research Center (Auburn University, Auburn, AL) and acclimated to 25–27 °C for 1 week in indoor tanks. Males and females were separated, with females in the inlet side and males in the drainage side. Sperm was collected from three males, diluted with 9 ppt saline (0.9 % sodium chloride injection, Hospira, Inc., Lake Forest, IL), then refrigerated until use. Three females were artificially induced to ovulate with injection of carp pituitary extract at 0.4 mg kg-1 body weight (BW) for the priming dose, and with injection

123

Experimental feeds, diet treatment and sample collection Embryos were cultured for 3 days to hatch in tubs at 26 °C. The hatchlings were putative P1 generation (initial generation/founders produced by the electroporation) transgenic fish, and were the fish evaluated in this experiment. Larvae were first fed Artemia nauplii (San Francisco Bay Brand, Inc. Newark, CA), then Aquamax Fry Starter100 (Cat#: 000-5553, Purina Mills, St. Louis, MO) once daily. Fry were transferred into a recirculating aquaculture system and randomly separated into three tanks at 40 days. Fingerlings then were fed Aquamax Fingerling Starter 300 twice a day to satiation (Cat#: 000-5555, Purina Mills, St. Louis, MO) (Table 1). After eight months, 60 juvenile fish were randomly assigned to two groups of thirty fish and fed twice a day to satiation for 1 month with either

Transgenic Res (2014) 23:729–742

733

Table 1 Proximate analysis, phosphorous and vitamin content in commercial and formulated diets fed to the masou salmon (Oncorhynchus masou) 45-desaturase transgenic and nontransgenic common carp, Cyprinus carpio

Crude protein (%)

Table 2 Ingredient compositions (g 100 g-1 of feed) of a formulated diet fed to common carp, Cyprinus carpio, electroporated with the masou salmon 45-desaturase-like-gene from Oncorhynchus masou and non-transgenic common carp

Commercial diet

Formulated diet

Ingredient

Weight (g)

50

36

Poultry by-product meala b

8

Crude fat (%)

16

6

Corn starch

Phosphorus (P) (%)

1.5

0.74

Solvent extracted soybean mealc

Vitamin A (IU kg-1)

9,000

2,200

Canola oild

Vitamin D (IU kg )

2,400

1,100

Whole wheat floure

Vitamin E (IU kg-1) Vitamin C (mg kg-1)

110 200

30 250

Choline chloridee Trace mineral premixf

0.2 0.5

Vitamin premixg

0.8

Stay Ch

0.1

CaP-dibasici

0.5

Lecithin (53 % lipid)j

0.5

-1

a commercial diet (Aquamax Fingerling Starter 300) or a formulated diet (Table 1). The formulated diet was prepared at the Nutrition Laboratory (School of Fisheries, Aquaculture and Aquatic Sciences, Auburn University, Auburn, AL). The formulation contained 36 % protein using solventextracted soybean meal as the primary protein source and canola oil as the source of EFAs (Tables 1, 2). After one month feeding the two diets, all 60 juvenile common carp were sacrificed; body weight and length of each fish were recorded. Four different tissues from each fish, including brain, muscle, liver, and gonad, were collected. These samples were immediately frozen in liquid nitrogen and stored at -80 °C until DNA and RNA extraction. Transgene identification and gene quantification All the samples were ground into powder and approximately 0.3 ml powder was used as starting material to extract genomic DNA using proteinase K digestion followed by protein precipitation and DNA ethanol precipitation as described in the protocol of Kurita et al. (2004). Transgenic fish samples were screened by PCR with specific forward and reverse primers (Table 3). The PCR amplification procedure was as follows: initial denaturation for 4 min at 94 °C; followed by 35 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 70 s; and a final elongation for 10 min at 72 °C. Transgenic samples were identified by the presence of the specific amplicon (903 bp) after electrophoresis of the PCR product through 1.2 % agarose gels. The same amount of powder from each sample was used to extract RNA using TRIzolÒ Reagent (Ambion, cat #: 15596-018, NY) following the manufacturer’s

k

1.9 35.5 3.6 38.8

Lysto

8

DL-Methioninel

0.15

L-lysinel

0.45

Filler (alpha cell/non-nutritive filler)l

1

a

Griffin Industries, Inc., Reedville, VA, USA

b

Grain Processing Corporation, Muscatine, IA, USA

c

Faithway Feed Co., Guntersville, AL, USA

d

ConAgra Food Co., Omaha, NE, USA

e

MP Biochemicals, Inc., Solon, OH, USA

f

Trace mineral premix (g 100 g-1): cobalt chloride 0.004, cupric sulfate pentahydrate 0.250, ferrous sulfate 4.0, magnesium sulfate anhydrous 13.862, manganese sulfate monohydrate 0.650, potassium iodide 0.067, sodium selenite 0.010, zinc sulfate heptahydrate 13.193, alpha-cellulose 67.964

g

Vitamin premix (g kg-1): thiamin HCl, 0.44; riboflavin, 0.63; pyridoxine HCl, 0.91; D-pantothenic acid, 1.72; nicotinic acid, 4.58; biotin, 0.21; folic acid, 0.55; inositol, 21.05; menadione sodium bisulfite, 0.89; vitamin A acetate, 0.68; vitamin D3, 0.12; Dl-alpha-tocopheryl acetate, 12.63; alphacellulose, 955.59 Stay CÒ, (L-ascorbyl-2-polyphosphate 25 % Active C), Roche Vitamins, Inc., Parsippany, NJ, USA

h

i

Fisher Scientific, Fair Lawn, NJ, USA

j

Enhanced D-97, Solae Company, St. Louis, MO, USA

k

Cargill Corn Milling, Cargill, Inc., Blair, NE, USA

l

Sigma-Aldrich Co., St. Louis, MO, USA

instructions. The quality and quantity of RNA samples were confirmed using DNA agarose gels and an UVspectrophotometer. All extracted samples had an A260/ 280 ratio greater than 1.8, and were diluted to 500 ng ll-1. RNA was reverse-transcribed into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad, cat #:

123

734

Transgenic Res (2014) 23:729–742

Table 3 Primer sequences for identifying the masou salmon (Oncorhynchus masou) 45-desaturase-like gene and for quantification of gene expression of the masou salmon 45-

desaturase-like-gene/common carp 46-desaturase-like-gene, and the stearoyl-CoA desaturase gene for common carp (Cyprinus carpio) using quantitative reverse-transcriptase PCR

Gene

GID

Forward sequence

Reverse sequence

D5D

Construct

GCCTCTGCTAACTGGTGGAA

CAGCAAAGCCATGTAGCAAA

D6D

AF309557.1

GCACAGTCACAGGCTGAATGGT

GATGCTGGAAGTGGCGATGGTT

SCD

U31864.2

ATCCGGACGTCATTGAGAAG

AATACGCCACCCACAGAGAC

18S

FJ710827.1

CCTGCGGCTTAATTTGACTC

CCGGAGTCTCGTTCGTTATC

D5D: D5-desaturase-like gene from O. masou. D6D and SCD: D6 desaturase-like gene and stearoyl-CoA desaturase gene (SCD) from common carp (C. carpio), respectively 18s: 18s ribosome mRNA from common carp. GID: Genbank identification number. Construct: indicating D5D primers were designed based on the construct sequence

170-8891). Quantitative real-time PCR (qRT-PCR) was performed on a C1000 Thermal Cycler (Bio-Rad) using the SsoFastTM EvaGreenÒ Supermix (Bio-Rad, cat: #172-5201) following the manufacturer’s instructions with modification. The expression level of ribosomal 18 s mRNA was used as an internal control. Primers used for masou salmon D5D transgene detection and relative quantification of D6D and SCD expression are listed in Table 3. The mRNA sequences for masou salmon D5D and common carp D6D had high similarity. Therefore, the expression for measured D6D was actually a combination of endogenous common carp D6D expression and masou salmon D5D transgene expression. Lipid extraction and fatty acid analysis The muscle from all 6 and 7 transgenic fish fed the formulated and commercial diets, respectively, and 10 non-transgenic fish for each diet group was collected for FA analysis. Total lipids were extracted from muscle and the two diets and individually determined gravimetrically by homogenization in triplicate aliquots of choloroform/methanol (2:1; v: v) following Folch et al. (1957) with some modifications. Fatty acid methyl ester (FAME) was prepared by transesterification from FA with boron trifluoride and analyzed using a gas chromatograph equipped with a flame ionization detector (GC-17A, Shimadzu, Portland, OR). Separation and identification were achieved using an OMEGAWAXTM 530 capillary column (30 m 9 0.53 mm 9 0.5 lm, Supelco, Oslo, Norway) and by the comparison of retention time with the FAME standard (methyl nonadecanoate C 98 %, Sigma-Aldrich Co., St. Louis, MO), respectively. The

123

initial oven temperature was 140 °C, then ramped to 260 °C and held for 5 min. The temperatures of injector and detector were set at 260 and 270 °C, respectively. A sample of 2 ll was injected under splitless mode. FAs were expressed as mg g-1 wet weight and as percent of the total identified FAME. Statistical analysis Crossing-point (Ct) values were exported into a Microsoft Excel sheet from Bio-Rad CRX Manager (Version 1.6.541.1028, 2008). Relative gene expression levels were expressed as fold-change of expression in different tissues (brain, muscle, and gonad) compared to liver in transgenic tissues. Relative gene expression levels also were expressed as fold-change of different tissues (liver, gonad, brain, and muscle) in transgenic samples compared to those of non-transgenic samples fed the commercial diet or formulated diet. The level of expression of 18 s ribosomal mRNA was used as an internal control. The relative expression ratio of a target gene was analyzed for significance using a randomization test in the REST (Pfaffl et al. 2002) software on the assumption that PCR had 100 % efficiency, and randomization was performed 2,000 times to capture significance at the level of P \ 0.05. Statistical analyses of fatty acid results were conducted using SAS statistical software (version 9.1, SAS Institute, Inc., Cary, NC). Analysis of variance (ANOVA) of fatty acid composition within and among different treatments was performed by a one-way ANOVA, followed by Duncan’s Multiple Range Test (P \ 0.05). A one-sample t test was used to evaluate trends among means of the various n-3

Transgenic Res (2014) 23:729–742

fatty acids utilizing the differences between the transgenic mean and the control mean for all individual omega-3 fatty acids as replicates. Body weightgain comparisons were conducted using paired t tests (P \ 0.05).

735 Table 4 Fatty acid (FA) compositions (mg g-1 diet and percent of fatty acid methyl ester, FAME) of the formulated and commercial diets fed to common carp (Cyprinus carpio), electroporated with the masou salmon (Oncorhynchus masou) 45-desaturase-like gene and to non-transgenic control (N = 3 for each diet) Fatty acid

Results

Total lipid (%)

Formulated dieta

Commercial dieta

6.29

13.62

16:0

7.22

11.68

18:0

1.86

2.36

18:1n-9

25.59

6.55

18:2n-6

18.28

4.55

18:3n-3

3.97

0.69

20:4n-6

0.00

0.08

20:5n-3

0.18

5.63

22:5n-3

0.38

1.04

22:6n-3

0.13

3.42

Saturatesb

15.77

22.84

Monounsaturatesc

26.95

14.98

PUFAd

22.49

8.40

HUFAe

0.69

11.23

Total n-3f

4.80

12.54

Total n-6g

18.30

4.81

16:0

10.95

20.34

18:0

2.83

4.10

18:1n-9

38.83

11.44

18:2n-6

27.75

7.92

18:3n-3

6.02

1.20

20:4n-6

0.00

0.13

20:5n-3

0.28

9.78

22:5n-3

0.53

1.81

22:6n-3

0.20

5.96

Saturatesb

23.97

39.78

Monounsaturatesc

40.90

26.11

PUFAd

34.13

14.61

HUFAe

1.01

19.50

Total n-3f

7.23

21.79

Total n-6g

27.78

8.38

mg g-1 wet weight

The interactions of genotype and diet were examined for D5 desaturase transgenic and non-transgenic common carp fed commercial and formulated diets. Results of the diet differences, gene expression, body composition changes and weight gain follow. Total lipid content of experimental diets The total lipid content of the commercial diet was twice that of the formulated diet (Table 4). The substrates LA (C18:2 n-6) and ALA (C18:3 n-3) were 4- and 5.8-fold higher in the formulated diet than in the commercial diet. The ratios of AA (C18:2 n-6)/ALA (C18:3 n-3) in formulated and commercial diets were 4.6 and 6.6, respectively. The EPA, DHA and total n-3 levels in the commercial diet were 31.3-, 26.3- and 2.6-fold higher than in the formulated diet, respectively. The content of PUFA in the formulated diet was 2.7-fold higher than in the commercial diet, and HUFA in the commercial diet was 16.3-fold higher than in the formulated diet.

FAME %

Relative gene expression of D6D and SCD mRNAs in transgenic fish fed the commercial diet Levels of expression of salmon D5D/carp D6D and SCD in muscle and expression of SCD in gonad were not different (P [ 0.05) from those of liver in transgenic common carp fed the commercial diet (Fig. 1). Expression of salmon D5D/carp D6D was 4.1-fold higher in gonad than in liver. Levels of expression of salmon D5D/carp D6D and SCD were 9.2- and 14.9fold lower in brain than in liver, respectively. Comparison of D6D and SCD mRNA levels between transgenic and non-transgenic fish fed the commercial diet The mRNA levels of the salmon D5D/carp D6D and SCD genes varied (P \ 0.05) in muscle, liver, brain and

a

Values represent averages of triplicates samples. Total lipid was calculated as percent of wet tissue

b

Saturates: 14:0, 15:0, 16:0, 18:0, 20:0, 22:0. Internal standard, 19:0, was not considered

c

Monounsaturates: 15:1, 16:1 18:1, 20:1

d

PUFA: 16:2, 16:3, 18:2, 18:3, 20:2, 20:3, 22:2

e

HUFA: 18:4, 20:4, 20:5, 22:4, 22:5, 22:6

f

Total n-3: 18:3n-3, 20:3n-3, 20:4n-3, 20:5n-3, 22:5n-3, 22:6n-3

g

Total n-6: 18:2n-6, 20:3n-6, 20:4n-6

123

736

Transgenic Res (2014) 23:729–742 Gonad 5.00

Muscle

Brain

*

1.00 -1.00 -3.00 -5.00 -7.00 -9.00

D6D SCD

-11.00

*

-13.00 -15.00

*

Fig. 1 Tissue-specific relative expression of the masou salmon D5-desaturase/common carp D6-desaturase (D6D) and stearoylCoA desaturase (SCD) genes in 9-month old transgenic common carp (Cyprinus carpio) fed a commercial diet for 8 months. Relative gene expression levels were expressed as fold-change within different tissues (brain, muscle, and gonad) relative to liver as normalized to the expression of common carp 18 s ribosomal mRNA control. Relative fold-changes were expressed as mean ± SE. The * on the bar indicates that the relative expression between the individual tissue and liver differed significantly at P \ 0.05 using the Pairwise Fixed Reallocation Randomization test (PFRR)

MT vs MC 25.00

Relative gene expression

15.00

BT vs BC

GT vs GC

MT vs MC

LT vs LC

50.00

*

-5.00

*

*

-15.00

* -25.00 D6D SCD

-35.00

BT vs BC

GT vs GC

LT vs LC

*

40.00

*

D6D SCD

30.00 20.00 10.00

* *

*

Fig. 2 Relative levels of expression of the masou salmon D5desaturase/common carp D6-desaturase (D6D) and stearoylCoA desaturase (SCD) genes in transgenic and non-transgenic common carp (Cyprinus carpio) fed a commercial diet. Relative gene expression was expressed as fold-change of different tissues (liver, gonad, brain, muscle) in transgenic common carp compared to non-transgenic samples as normalized to the expression of common carp (C. carpio) 18s ribosomal mRNA. Relative fold-changes were expressed as mean ± SE. The asterisk on the error bar indicates that the relative expression between transgenic fish and non-transgenic fish fed the commercial diet differed significantly at P \ 0.05 using the Pairwise Fixed Reallocation Randomization test (PFRR). MT: muscle tissue of transgenic fish. MC: muscle tissue of nontransgenic fish. BT: brain tissue of transgenic fish. BC: brain tissue of non-transgenic fish. GT: gonad tissue of transgenic fish. GC: gonad tissue of non-transgenic fish. LT: liver tissue of transgenic fish. LC: liver tissue of non-transgenic fish

*

0.00

* -10.00

-45.00

123

The mRNA level of salmon D5D/carp D6D and SCD gene varied (P \ 0.05) in muscle, liver, brain and

*

5.00

-55.00

Comparison of D6D and SCD mRNA levels between transgenic and non-transgenic fish fed the formulated diet

Relative gene expression

Relative gene expression

3.00

gonad between transgenic and non-transgenic fish fed the commercial diet (Fig. 2). The salmon D5D/carp D6D and SCD mRNA levels in muscle of transgenic fish were up-regulated (P \ 0.05) 12.7- and 17.9-fold, respectively, compared to those of non-transgenic fish. The salmon D5D/carp D6D mRNA level in the gonad of transgenic fish was up-regulated 6.9-fold (P \ 0.05) compared to that of non-transgenic fish. In contrast, the salmon D5D/carp D6D and SCD mRNA levels in the brain of transgenic fish were dramatically downregulated, 50.2- and 16.7-fold (P \ 0.05), respectively, compared to non-transgenic fish. The salmon D5D/carp D6D and SCD mRNA levels in liver of transgenic fish were down-regulated (P \ 0.05) 5.4- and 2.4-fold, respectively, compared to non-transgenic fish.

-20.00

*

* *

Fig. 3 Relative levels of expression of the masou salmon D5desaturase/common carp D6-desaturase (D6D) and stearoylCoA desaturase (SCD) genes in transgenic and non-transgenic common carp (Cyprinus carpio) fed a formulated diet. Relative gene expression was expressed as fold-change of different tissues (liver, gonad, brain, muscle) in transgenic common carp compared to non-transgenic samples as normalized to the expression of common carp (C. carpio) 18s ribosomal mRNA. Relative fold-changes were expressed as mean ± SE. The asterisk on the error bar indicates that the relative expression between transgenic fish and non-transgenic fish differed significantly at P \ 0.05 using the Pairwise Fixed Reallocation Randomization test (PFRR). MT: muscle tissue of transgenic fish. MC: muscle tissue of non-transgenic fish. BT: brain tissue of transgenic fish. BC: brain tissue of non-transgenic fish. GT: gonad tissue of transgenic fish. GC: gonad tissue of nontransgenic fish. LT: liver tissue of transgenic fish. LC: liver tissue of non-transgenic fish

Transgenic Res (2014) 23:729–742

gonad between transgenic and non-transgenic fish fed the formulated diet (Fig. 3). The salmon D5D/carp D6D and SCD mRNA levels in muscle of transgenic fish were up-regulated (P \ 0.05) 41.5- and 8.9-fold, respectively, compared to those of non-transgenic fish. The salmon D5D/carp D6D and SCD were also upregulated (P \ 0.05) in liver of transgenic fish, 6.0and 3.3-fold, respectively, compared to non-transgenic fish. The salmon D5D/carp D6D and SCD mRNA levels in the gonad of transgenic fish were downregulated (P \ 0.05), 5.5- and 12.4-fold, respectively, compared to those of non-transgenic fish. Additionally, the salmon D5D/carp D6D and SCD mRNA levels in the brain of transgenic fish were down-regulated (P \ 0.05), 14.9- and 1.4-fold respectively, compared to non-transgenic fish.

Fatty acid profile of muscle from transgenic and control common carp fed two different diets For the fish fed the formulated diet, there was no difference between the transgenic and control fish for any fatty acid variable measured (P = 0.05, Table 5). In the case of fish fed the commercial diet, there was a trend for levels of specific FAs in muscle of the transgenic common carp to have a higher observed content, with EPA being 1.07-fold higher (3.60 mg g-1 wet tissue vs. 3.37 mg g-1 wet tissue), DPA 1.12-fold higher (1.26 mg g-1 wet tissue vs. 1.13 mg g-1 wet tissue), DHA 1.07-fold higher (5.52 mg g-1 wet tissue vs. 5.15 mg g-1 wet tissue) and total n-3 FA 1.07-fold higher (12.65 mg g-1 wet tissue vs. 11.80 mg g-1 wet tissue) than corresponding fatty acids levels in nontransgenic fish, although differences were not significantly different (P [ 0.05). Results of a one-sample ttest demonstrated a trend (P \ 0.10) that the difference between the means for the four n-3 FAs (mean of transgenic minus mean of non-transgenic) was greater than zero. However, the results were more pronounced for fish fed the formulated diet. Total n-3 FA in fish muscle was higher than n-6 FA, 2-fold greater (11.24 mg g-1 wet tissue vs. 5.63 mg g-1 wet tissue) in control fish fed the formulated diet, 1.9-fold greater (10.87 mg g-1 wet tissue vs. 5.73 mg g-1 wet tissue) in transgenic fish fed the formulated diet, 2.4-fold greater (11.80 mg g-1 wet tissue vs. 4.93 mg g-1 wet tissue) in control fish fed the commercial diet, and 2.5-fold greater (12.65 mg g-1 wet tissue vs. 5.05 mg g-1 wet tissue) in

737

transgenic fish fed the commercial diet. FA in the muscle of non-transgenic common carp fed the commercial diet had a higher content of EPA, 1.18-fold greater (3.37 mg g-1 wet tissue vs. 2.86 mg g-1 wet tissue), for DPA 1.11-fold greater (1.13 mg g-1 wet tissue vs. 1.02 mg g-1 wet tissue), and for total n-3 1.05-fold greater (11.80 mg g-1 wet tissue vs. 11.24 mg g-1 wet tissue) than those in fish fed the formulated diet (Table 5).

Growth of transgenic and non-transgenic common carp There was no difference (P [ 0.05) in body weight between transgenic and non-transgenic fish; fish transgenic in the muscle weighed 38.8 g and nontransgenic fish weighed 38.7 g. When comparing common carp transgenic for any of the four tissues with those of fish not transgenic for any tissue, body weights were not different (P [ 0.05), (38.6 g) for transgenic females and (37.1 g) control females or between transgenic males (39.1 g) and control males (40.6 g).

Discussion Diet composition and transgene expression were evaluated in an attempt to biotechnologically enhance n-3 fatty acids production in a freshwater fish, common carp. The n-3 fatty acids, primarily EPA and DHA, have gained worldwide attention because their beneficial functions on membrane fluidity and cell signaling (Skrzypski et al. 2009), organ development (Sargent et al. 2002), treatment of cardiovascular disease (Calder and Yaqoob 2009), as well as resistance to arthritis, nephritis and multiple sclerosis (Kremer et al. 1987; Bates et al. 1989). Marine fish products play an important role for nutritional uptake in human and animals (Sargent and Tacon 1999; Simopoulos 1999) as the primary dietary source for EPA and DHA. However, with the decline in total capture of marine fish, harvest from the wild can no longer satisfy the need for EPA and DHA without aquaculture production and innovative biotechnological applications. Hence, the interest in producing freshwater fish expressing high levels of essential fatty acids, which if successful, would provide alternative sources of EPA and DHA.

123

738

Transgenic Res (2014) 23:729–742

Table 5 Total lipid (%) and fatty acid compositions (mg g-1 diet and percent of fatty acid methyl ester, FAME) of muscle of P1 masou salmon (Oncorhynchus masou) 45-desaturase-like transgenic and control common carp, Cyprinus carpio, fed on a Selected Fatty Acid

Formulated diet control

formulated diet and a commercial diet (N = 10 for the formulated diet control; N = 6 for the formulated diet transgenic; N = 10 for the commercial diet control; N = 7 for the commercial diet transgenic)1

Formulated diet transgenic

Commercial diet control

Commercial diet transgenic

3.25a

3.26a

3.32a

2.90a

16:0

10.36b

10.28b

11.42a

11.58a

18:0

2.65

a

a

2.69

a

2.73a

11.97

a

11.92

a

11.93a

5.25

a

4.57

b

4.63b

Total lipid (%) -1

mg g

wet weight

18:1n-9 18:2n-6

2.70

a

11.67 5.34

ab

a

18:3n-3 20:4n-6

0.59 0.06b

0.60 0.06b

0.52 0.06b

0.52b 0.07a

20:5n-3

2.86b

2.80b

3.37a

3.60a

22:5n-3

1.02

c

1.00

c

1.13

b

1.26a

5.15

a

4.82

a

5.15

a

5.52a

21.91

a

22.74

a

23.88a

19.57

a

20.93

a

21.25a

7.67a

7.93a

22:6n-3 Saturates

2

Monounsaturates

3

a

b

a

22.39

a

19.27

PUFA4

8.28a

8.43a

5

9.65

b

b

11.24

b

5.63

a

HUFA

Total n-3

6

Total n-6

7

9.22

b

10.87 5.73

a

10.33

ab

11.07a

11.80

ab

12.65a

4.93

b

5.05b

FAME % 16:0

17.41c

17.32c

18.54a

18.10b

18:0

4.46

a

a

4.36

a

4.26a

20.09

a

19.36

a

18.65a

b

18:1n-9

4.60

a

19.44

a

18:2n-6 18:3n-3

8.81 1.00a

8.96 1.01a

7.42 0.83b

7.22b 0.80b

20:4n-6

0.10b

0.11ab

0.10b

0.12a

20:5n-3

4.82

b

5.46

a

5.59a

1.74

c

1.88

b

1.97a

8.68

a

8.35

a

8.59a

36.98

a

36.85

a

37.23a

32.87

a

32.14

33.96

a

33.20a

14.19a

12.44b

12.34b

b

16.75

a

17.23a

19.14

a

19.70a

8.01

b

7.87b

22:5n-3 22:6n-3 Saturates

2

Monounsaturates PUFA4 HUFA

3

13.92a

5

Total n-3

6

Total n-6

7

16.23

ab

18.92

a

9.46

a

a

4.72

b

1.69

c

8.21

a a

38.03

a

15.64

a

18.44 9.62

a

1

Values represent the average of triplicates samples per individual. Means within rows with the same letter are not significantly different (Duncan’s Multiple Range Test, P = 0.05) 2

Saturates: 14:0, 15:0, 16:0, 18:0, 20:0, 22:0. Internal standard, 19:0, was not considered

3

Monounsaturates: 15:1, 16:1 18:1, 20:1

4

PUFA: 16:2, 16:3, 18:2, 18:3, 20:2, 20:3, 22:2

5

HUFA: 18:4, 20:4, 20:5, 22:4, 22:5, 22:6

6

Total n-3: 18:3n-3, 20:3n-3, 20:4n-3, 20:5n-3, 22:5n-3, 22:6n-3

7

Total n-6: 18:2n-6, 20:3n-6, 20:4n-6

123

Transgenic Res (2014) 23:729–742

Effect of the transgene on salmon D5D/common carp D6D and SCD expression Either salmon D5D was expressed in a variety of tissues, or endogenous common carp D6D was upregulated as a result of the expression of the transgene, or both, as the mRNA of the salmon D5D could not be distinguished from the common carp D6D. The mRNA levels of salmon D5D/common carp D6D and SCD in muscle, liver, brain and gonad varied between transgenic and non-transgenic fish fed the commercial diet. The salmon D5D/common carp D6D and SCD mRNA levels in muscle of transgenic fish were up-regulated 12.7-fold and 17.9-fold, respectively, compared to those of non-transgenic fish. The fact that SCD was up-regulated indicates that the transgene could affect the expression of one or more endogenous desaturases. The up-regulation in muscle was even more dramatic for salmon D5D/common carp D6D, 41.5-fold, but not SCD, 8.9-fold, when the fish were fed the formulated diet and compared to nontransgenic common carp. The salmon D5D/common carp D6D and SCD mRNA levels in the brain of transgenic fish were down-regulated, 14.9- and 1.4fold, respectively, when fed the formulated diet, but were much more dramatically down-regulated, 50.2and 16.7-fold, respectively, when fed the commercial diet. In this case, the down-regulation must be completely attributed to the decreased output of endogenous D6D, as the non-transgenic controls could not produce salmon D5D mRNA. There were additional genotype 9 tissue 9 diet interactions. The salmon D5D/common carp D6D and SCD mRNA levels in liver of transgenic fish were down-regulated, 5.4- and 2.4-fold, respectively, compared to those in non-transgenic fish when fed the commercial diet. However, the salmon D5D/common carp D6D and SCD were up-regulated in liver of transgenic fish, 6.0- and 3.3-fold, respectively, compared to non-transgenic fish when fed the formulated diet. Also, the salmon D5D/common carp D6D mRNA levels in the gonad of transgenic fish were upregulated 6.9-fold compared to non-transgenic common carp when fed the commercial diet, while the salmon D5D/common carp D6D and SCD mRNA levels in the gonad of transgenic fish were downregulated 5.5- and 12.4-fold when fed the formulated diet. The desaturase/elongase activities involved in the early desaturation/elongation pathway have a

739

remarkable effect for the later production of EPA and DHA (Ghioni et al. 1999). The tissue environment affects the expression of the transgene, and differential expression of other genes could be affecting transgene expression via epistasis. The reaction of different species to the same or similar transgenes may vary. In the case of salmon D6D transgenic zebrafish, the expression of the transgene was highest in the gill [ liver [ intestine and brain [ eye [ muscle and fin (Alimuddin et al. 2005). The results of the current study are not in total agreement with the zebrafish data, as the D5D transgenic common carp had the highest and similar expression of salmon D5D/common carp D6D in the gonad, liver and muscle, and expression in the brain was lowest. This observation shows that model organisms do not necessarily give results that are 100 % congruent with species of primary interest. Alternative explanations could be that the zebrafish were F1/F2 generation, while the common carp were mosaics of the P1 generation or differences in results could be attributable to the promoter, medaka b-actin for zebrafish and carp b-actin for common carp. If all tissues are mosaic in comparison to all tissues being non-mosaic for the transgene, relative levels of expression might rank the same, although the magnitude of the expression could be different between the mosaic and non-mosaic case. Analysis of additional generations will be needed to test these explanations. Growth of D5D transgenic common carp The transgenic and non-transgenic common carp did not differ in body weight for either diet. Thus, the masou salmon D5D transgene had no pleiotropic effect on growth in the P1 generation of transgenic common carp. This outcome is important for any future commercial application of desaturase transgenic fish as adverse effects on other important production traits would decrease economic value of the fish. The tissue that was found transgenic had no discernible effect on body weight, which suggests that no adverse effects would be predicted for growth in F1 desaturase transgenic common carp that would have the transgene in every cell and tissue. In contrast to our results, Alimuddin et al. (2007) found that F2 transgenic zebrafish males containing the masou salmon D5D construct grew 6–18 % faster than controls, a positive pleiotropic effect. Perhaps the

123

740

same positive impact on growth will be found in the F1 generation of transgenic common carp. The interaction between the transgene and the diet was important, as diet and fatty acid content affected the magnitude of the growth difference in the masou salmon D5D transgenic zebrafish males. The results from the current study support this observation. The observed body weight of transgenic common carp was 25.8 % larger for the commercial diet compared to the formulated diet, which approached statistical significance (data not shown). In both the zebrafish and common carp studies, the D5D transgenic fish grew faster on the diets with higher n-3 fatty acids, although in both cases other nutrient components cannot be ruled out as effectors. In the case of the common carp experiment, the commercial diet had higher protein, and total fat as well as higher n-3 fatty acids; thus, several nutritional factors likely contributed to the faster growth from the commercial diet. Effect of diet and transgene on n-3 fatty acid level The observed EPA, DPA, DHA and n-3 FA levels in muscle of transgenic common carp fed the commercial diet were higher than those of non-transgenic fish. Thus the strategy of utilizing genetically engineered fish has the potential to increase valuable FA content in farmed freshwater fishes that are normally low in n-3 FA. However, the content of EPA, DPA, DHA and total n-3 FA of transgenic fish fed the formulated diet tended to decrease, although not significantly. Thus, the genetic engineering must be coupled with the appropriate nutritional input in order to achieve the goal of increasing n-3 FA in the edible muscle. F2 transgenic zebrafish containing D5D expressed D5D in their caudal fin, but variably from one individual to another (Alimuddin et al. 2005). In many cases, the level of expression varied more than tenfold from one individual to another. The transgenic individuals had 13–21 % increase in n-3 fatty acids in their whole body compared to controls. Although not statistically significant, the P1 D5D transgenic common carp had observed means 7.2 % higher for n-3 fatty acids in their muscle compared to the control. These P1 fish were mosaic, and likely only had the transgene in 10–50 % of their cells in the muscle based up previous gene transfer experiments with fishes (Powers et al.1990; Hayat et al. 1991; Dunham et al. 1992; Powers et al. 1992). If the n-3 fatty acids in

123

Transgenic Res (2014) 23:729–742

the P1 transgenics were being diluted proportionately, one might predict that the increase in n-3 fatty acids in the F1 would be higher than that found in the P1 compared to the controls. The F2 desaturase transgenic zebrafish had approximately 15 mg g-1 of n-3 fatty acids in their whole body, while the P1 transgenic common carp contained approximately 9 mg g-1 in their muscle. Alimuddin et al. (2005) also produced D6D transgenic zebrafish. Again, large variation existed from one transgenic line to another, resulting in a 40–110 % increase in n-3 fatty acids. Alimuddin et al. (2007) increased the n-3 fatty acid levels approximately 30 % in zebrafish by transferring the masou salmon elongase-like gene. It is typical to observe phenotypic variation in response to transgene insertion differences among species and families (Dunham and Liu 2006). Rahman et al. (1998) reported that F1 Nile tilapia transgenic for a construct consisting of a sockeye salmon metallothionein promoter spliced to a sockeye salmon growth hormone gene exhibited no growth enhancement, although Atlantic salmon transgenic for this construct showed greatly enhanced growth (Du et al. 1992). Variation may be related to position effect, copy numbers, and genetic background. Theoretically, selection of the best-performing transgenic lines should maximize genetic enhancement for the trait of interest. Although the percent improvement (40–100 %) in n-3 fatty acids using D6D transgenesis in zebrafish (Alimuddin et al. 2005) was more impressive than for D5D transgenesis (13–21 %) (Alimuddin et al. 2007), the level of n-3 fatty acids in the whole body of D6D transgenics,7 mg g-1, was less than that for D5D transgenics, 15 mg g-1. The large influence of diet on n-3 fatty acids deposition in the flesh must be considered when evaluating the effectiveness and application of desaturase transgenesis. In the case of the P1 masou salmon D5D transgenic common carp, the n-3 fatty acid level was 12.7 mg g-1 in the muscle, but exact comparison cannot be made to the zebrafish, as we do not have the whole-body levels. Of course, for the purpose of human consumption, values in the muscle are more meaningful than values for the whole body. Genetic improvement and dietary regulation can generate fish that can synthesize increased amounts of EPA/DHA. Additionally, construct design with more effective promoters should be explored to further

Transgenic Res (2014) 23:729–742

improve upon the results of the current study. F1 desaturase-transgenic common carp need to be evaluated to determine the D5D desaturase transgene expression and its effect upon fatty acid composition when every cell in the organism has the capacity to produce more D6D and SCD. The potential of the gene transfer of desaturase cannot be realized without using the proper diet with the needed amount of substrates. Acknowledgments The authors thank Dr. Goro Yoshizaki of the Department of Marine Biosciences, Tokyo University of Marine Science and Technology, Tokyo, Japan for providing the masou salmon D5-desaturase sequence and Dr. Pat Gibbs of Marine Biology and Fisheries, University of Miami, Miami, Florida, USA for providing the backbone plasmid, FRM2bl, for the construct in the current study.

References Alimuddin Yoshizaki G, Kiron V, Satoh S, Takeuchi T (2005) Enhancement of EPA and DHA biosynthesis by overexpression of masu salmon delta6-desaturase-like gene in zebrafish. Transgenic Res 14:159–165 Alimuddin Yoshizaki G, Kiron V, Satoh S, Takeuchi T (2007) Expression of masu salmon delta5-desaturase-like gene elevated EPA and DHA biosynthesis in zebrafish. Mar Biotechnol (NY) 9:92–100 Asturiano JF, Sorbera LA, Carrillo M, Zanuy S, Ramos J, Navarro JC, Bromage N (2001) Reproductive performance in male European sea bass (Dicentrarchus labrax, L.) fed two PUFA-enriched experimental diets: a comparison with males fed a wet diet. Aquaculture 194:173–190 Bang HO, Dyerberg J, Sinclair HM (1980) The composition of the Eskimo food in north western Greenland. Am J Clin Nutr 33:2657–2661 Bart AN, Dunham RA (1996) Effects of sperm concentration and egg number on fertilization efficiency with channel catfish (Ictalurus punctatus) eggs and blue catfish (I. furcatus) spermatozoa. Theriogenology 45:673–682 Bates D, Cartlidge NE, French JM, Jackson MJ, Nightingale S, Shaw DA, Smith S, Woo E, Hawkins SA, Millar JH, Belin J, Conroy DM, Gill SK, Sidey M, Smith AD, Thompson RHS, Zilkha K, Gale M, Sinclair HM (1989) A doubleblind controlled trial of long-chain n-3 poly-unsaturated fatty acids in the treatment of multiple sclerosis. J Neurol Neurosurg Psychiatry 52:18–22 Bourre JM (2005) Dietary omega-3 fatty acids and psychiatry: mood, behaviour, stress, depression, dementia and aging. J Nutr Health Aging 9:31–38 Bradberry JC, Hilleman DE (2013) Overview of omega-3 fatty acid therapies. Pharm Ther 38:681–689 Cai L, Guo Z, He H, Peng R, Yang X, Li Y, Lei M, Xie X, Gao R (2012) Studies of biological effects of the expression of fatty acid desaturase gene on rabbits. Sichuan J Zool 31:212–218 Calder PC, Yaqoob P (2009) Omega-3 polyunsaturated fatty acids and human health outcomes. BioFactors 35:266–272

741 Collares T, Campos VF, Seixas FK, Cavalcanti PV, Dellagostin OA, Moreira HL, Deschamps JC (2010) Transgene transmission in South American catfish (Rhamdia quelen) larvae by sperm-mediated gene transfer. J Biosci 35:39–47 Copeman LA, Parrish CC, Brown JA, Harel M (2002) Effects of docosahexaenoic, eicosapentaenoic, and arachidonic acids on the early growth, survival, lipid composition and pigmentation of yellowtail flounder (Limanda ferruginea): a live food enrichment experiment. Aquaculture 210:285–304 Du SJ, Gong ZY, Fletcher GL, Shears MA, King MJ, Idler DR, Hew CL (1992) Growth enhancement in transgenic Atlantic salmon by the use of an ‘‘all fish’’ chimeric growth-hormone gene construct. Biotechnology (NY) 10:176–181 Dubnov-Raz G, Finkelstein Y, Koren G (2007) Omega-3 fatty acid supplementation during pregnancy: for mother, baby, or neither? Can Fam Physician 53:817–818 Dunham RA (2011) Aquaculture and fisheries biotechnology: genetic approaches, 2nd edn. CABI Publishing, Cambridge, pp 240–277 Dunham RA, Liu ZJ (2006) Transgenic fish—where we are and where do we go? Isr J Aquac Bamidgeh 58:297–319 Dunham RA, Winn RN (2014) Production of transgenic fish. In: Pinkert CA (ed) Transgenic animal technology: a laboratory handbook, 3rd edn. Elsevier B.V., Amsterdam, pp 308–336 Dunham RA, Ramboux AC, Duncan PL, Hayat M, Chen TT, Lin CM, Kight K, Gonzalez-Villasenor I, Powers DA (1992) Transfer, expression, and inheritance of salmonid growth hormone genes in channel catfish, Ictalurus punctatus, and effects on performance traits. Mol Mar Biol Biotechnol 1:380–389 Folch J, Lees M, Sloane Stanley GH (1957) A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497–509 Garg ML, Leitch J, Blake RJ, Garg R (2006) Long-chain n-3 polyunsaturated fatty acid incorporation into human atrium following fish oil supplementation. Lipids 41:1127–1132 Ghioni C, Tocher DR, Bell MV, Dick JR, Sargent JR (1999) Low C18 to C20 fatty acid elongase activity and limited conversion of stearidonic acid, 18:4(n-3), to eicosapentaenoic acid, 20:5(n-3), in a cell line from the turbot, Scophthalmus maximus. Biochim Biophys Acta 1437:170–181 Gibbs PD, Schmale MC (2000) GFP as a genetic marker scorable throughout the life cycle of transgenic zebra fish. Mar Biotechnol 2:107–125 Hamada T, Kodama H, Takeshita K, Utsumi H, Iba K (1998) Characterization of transgenic tobacco with an increased alpha-linolenic acid level. Plant Physiol 118:591–598 Hayat M, Joyce CP, Townes TM, Chen TT, Powers DA, Dunham RA (1991) Survival and integration rate of channel catfish and common carp embryos microinjected with DNA at various developmental stages. Aquaculture 99:249–255 Hobbs RS, Fletcher GL (2008) Tissue specific expression of antifreeze protein and growth hormone transgenes driven by the ocean pout (Macrozoarces americanus) antifreeze protein OP5a gene promoter in Atlantic salmon (Salmo salar). Transgenic Res 17:33–45

123

742 Innis SM (2008) Dietary omega 3 fatty acids and the developing brain. Brain Res 1237:35–43 Kang J, Yoshizaki G, Homma O, Stru¨ssmann CA, Takashima F (1999) Effect of an osmotic differential on the efficiency of gene transfer by electroporation of fish spermatozoa. Aquaculture 173:297–307 Klemens CM, Salari K, Mozurkewich EL (2012) Assessing omega-3 fatty acid supplementation during pregnancy and lactation to optimize maternal mental health and childhood cognitive development. Clin Lipidol 7:93–109 Knutzon DS, Thompson GA, Radke SE, Johnson WB, Knauf VC, Kridl JC (1992) Modification of Brassica seed oil by antisense expression of a stearoyl-acyl carrier protein desaturase gene. Proc Natl Acad Sci USA 89:2624–2628 Koueta N, Boucaud-Camou E, Noel B (2002) Effect of enriched natural diet on survival and growth of juvenile cuttlefish Sepia officinalis L. Aquaculture 203:293–310 Kremer JM, Jubiz W, Michalek A, Rynes RI, Bartholomew LE, Bigaouette J, Timchalk M, Beeler D, Lininger L (1987) Fish-oil fatty acid supplementation in active rheumatoid arthritis: a double-blinded, controlled, crossover study. Ann Intern Med 106:497–503 Kurita K, Burgess S, Sakai N (2004) Transgenic zebrafish produced by retroviral infection of in vitro-cultured sperm. Proc Natl Acad Sci USA 101:1263–1267 Marquardt WC, Demaree RS, Grieve RB (2000) Parasitology and vector biology, 2nd edn. Harcourt Academic Press, San Diego 702 pp Meesapyodsuk D, Reed DW, Covello PS, Qiu X (2007) Primary structure, regioselectivity, and evolution of the membranebound fatty acid desaturases of Claviceps purpurea. J Biol Chem 282:20191–20199 Mozurkewich E, Berman DR, Chilimigras J (2010) Role of omega-3 fatty acids in maternal, fetal, infant and child wellbeing. Expert Rev Obstet Gynecol 5:125–138 Muhlhausler BS, Gibson RA, Makrides M (2011) The effect of maternal omega-3 long-chain polyunsaturated fatty acid (n-3 LCPUFA) supplementation during pregnancy and/or lactation on body fat mass in the offspring: a systematic review of animal studies. Prostaglandins Leukot Essent Fatty Acids 85:83–88 Ntambi JM (1999) Regulation of stearoyl-CoA desaturase by polyunsaturated fatty acids and cholesterol. J Lipid Res 40:1549–1558 Oudart H, Groscolas R, Calgari C, Nibbelink M, Leray C, Le Maho Y, Malan A (1997) Brown fat thermogenesis in rats fed high-fat diets enriched with n-3 polyunsaturated fatty acids. Int J Obes Relat Metab Disord 21:955–962 Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (RESTÓ) for group-wise comparison and statistical analysis of relative expression results in realtime PCR. Nucleic Acids Res 30:e36 Powers DA, Gonzalez-Villasenor LI, Zhang P, Chen TT, Dunham RA (1990) Studies on transgenic fish: gene transfer, expression and inheritance. In: First NL, Haseltine FP (eds) Transgenic animals. Butterworth-Heinemann, Boston, pp 307–324 Powers DA, Hereford L, Cole T, Chen TT, Lin C, Kight K, Creech K, Dunham RA (1992) Electroporation: a method for transferring genes into the gametes of zebrafish (Brachydanio rerio), channel catfish (Ictalurus punctatus),

123

Transgenic Res (2014) 23:729–742 and common carp (Cyprinus carpio). Mol Mar Biol Biotechnol 1:301–308 Rahman MA, Mak R, Ayad H, Smith A, Maclean N (1998) Expression of a novel piscine growth hormone gene results in growth enhancement in transgenic tilapia (Oreochromis niloticus). Transgenic Res 7:357–369 Reddy AS, Thomas TL (1996) Expression of a cyanobacterial delta 6-desaturase gene results in gamma-linolenic acid production in transgenic plants. Nat Biotechnol 14:639–642 Ruxton CHS, Reed SC, Simpson MJA, Millington KJ (2004) The health benefits of omega-3 polyunsatureased fatty acids: a review of the evidence. J Hum Nutr Diet 17:449–459 Sable PS, Dangat KD, Joshi AA, Joshi SR (2012) Maternal omega 3 fatty acid supplementation during pregnancy to a micronutrient-imbalanced diet protects postnatal reduction of brain neurotrophins in the rat offspring. Neuroscience 217:46–55 SanGiovanni JP, Chew EY (2005) The role of omega-3 longchain polyunsaturated fatty acids in health and disease of the retina. Prog Retin Eye Res 24:87–138 Sargent JR, Tacon AGJ (1999) Development of farmed fish: a nutritionally necessary alternative to meat. Proc Nutr Soc 58:377–383 Sargent JR, Tocher DR, Bell JG (2002) The lipids. In: Halver JE, Hardy RW (eds) Fish nutrition, 3rd edn. Academic Press, New York, pp 181–257 Seiliez I, Panserat S, Kaushik S, Bergot P (2001) Cloning, tissue distribution and nutritional regulation of a D6-desaturaselike enzyme in rainbow trout. Comp Biochem Physiol B Biochem Mol Biol 130:83–93 Simopoulos AP (1996) Omega-3 fatty acids part I: metabolic effects of omega-3 fatty acids and essentiality. In: Spiller GA (ed) Handbook of lipids in human nutrition. CRS Press, Boca Raton, pp 51–73 Simopoulos AP (1999) Evolutionary aspects of omega-3 fatty acids in the food supply. Prostaglandins Leukot Essent Fatty Acids 60:421–429 Simopoulos AP (2002) Omega-3 fatty acids in inflammation and autoimmune diseases. J Am Coll Nutr 21:495–505 Skrzypski J, Bellenger S, Bellenger J, Sinclair A, Poisson JP, Tessier C, Rialland M, Narce M (2009) Revisiting delta-6 desaturase regulation by C18 unsaturated fatty acids, depending on the nutritional status. Biochimie 91:1443–1449 Su B (2012) Reproductive confinement of common carp Cyprinus carpio, and channel catfish, Ictalurus punctatus, via transgenic sterilization. Doctoral dissertation, Auburn University, AL Tur JA, Bibiloni MM, Sureda A, Pons A (2012) Dietary sources of omega 3 fatty acids: public health risks and benefits. Br J Nutr 107:S23–S52 Wen XB, Chen LQ, Zhou ZL, Ai CX, Deng GY (2002) Reproduction response of Chinese mitten-handed crab (Eriocheir sinensis) fed different sources of dietary lipid. Comp Biochem Physiol A Mol Integr Physiol 131:675–681 Zhang D, Pirtle IL, Park SJ, Nampaisansuk M, Neogi P, Wanjie SW, Pirtle RM, Chapman KD (2009) Identification and expression of a new delta-12 fatty acid desaturase (FAD24) gene in upland cotton and its functional expression in yeast and Arabidopsis thaliana plants. Plant Physiol Biochem 47:462–471