CSIRO PUBLISHING

Reproduction, Fertility and Development, 2016, 28, 1873–1881 http://dx.doi.org/10.1071/RD14398

Interaction of the transforming growth factor-b and Notch signaling pathways in the regulation of granulosa cell proliferation Xiao-Feng Sun A,B,*, Xing-Hong Sun A,C,*, Shun-Feng Cheng A,C, Jun-Jie Wang A,C, Yan-Ni Feng A,C, Yong Zhao A,C, Shen Yin A,C, Zhu-Mei Hou A,D, Wei Shen A,C and Xi-Feng Zhang E,F A

Key Laboratory of Animal Reproduction and Germplasm Enhancement in Universities of Shandong, Qingdao 266109, China. B College of Life Science, Qingdao Agricultural University, Qingdao 266109, China. C College of Animal Science and Technology, Qingdao Agricultural University, Qingdao 266109, China. D College of Marine Science and Engineering, Qingdao Agricultural University, Qingdao 266109, China. E College of Biological and Pharmaceutical Engineering, Wuhan Polytechnic University, Wuhan 430023, China. F Corresponding author. Email: [email protected]

Abstract. The Notch and transforming growth factor (TGF)-b signalling pathways play an important role in granulosa cell proliferation. However, the mechanisms underlying the cross-talk between these two signalling pathways are unknown. Herein we demonstrated a functional synergism between Notch and TGF-b signalling in the regulation of preantral granulosa cell (PAGC) proliferation. Activation of TGF-b signalling increased hairy/enhancer-of-split related with YRPW motif 2 gene (Hey2) expression (one of the target genes of the Notch pathway) in PAGCs, and suppression of TGF-b signalling by Smad3 knockdown reduced Hey2 expression. Inhibition of the proliferation of PAGCs by N-[N-(3,5difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butylester (DAPT), an inhibitor of Notch signalling, was rescued by both the addition of ActA and overexpression of Smad3, indicating an interaction between the TGF-b and Notch signalling pathways. Co-immunoprecipitation (CoIP) and chromatin immunoprecipitation (ChIP) assays were performed to identify the point of interaction between the two signalling pathways. CoIP showed direct protein–protein interaction between Smad3 and Notch2 intracellular domain (NICD2), whereas ChIP showed that Smad3 could be recruited to the promoter regions of Notch target genes as a transcription factor. Therefore, the findings of the present study support the idea that nuclear Smad3 protein can integrate with NICD2 to form a complex that acts as a transcription factor to bind specific DNA motifs in Notch target genes, such as Hey1 and Hey2, and thus participates in the transcriptional regulation of Notch target genes, as well as regulation of the proliferation of PAGCs. Additional keywords: activin A, cross-talk. Received 21 October 2014, accepted 6 May 2015, published online 3 June 2015

Introduction Both the Notch and transforming growth factor (TGF)-b signalling pathways play important roles in the regulation of cellular proliferation, and they exhibit principal similarities in their mode of action (Artavanis-Tsakonas et al. 1999; Massague´ et al. 2000). The ligand-induced signal is transmitted via membrane proximal components, such as Notch intracellular domain (NICD) and *

Smads. In the TGF-b signalling pathway, two types of ligands, namely TGF-b and activin, bind to the Type II serine-threonine kinase receptor, resulting in the phosphorylation and dissociation of Smad3. Phosphorylated Smad3 associates with Smad4 and translocates to the nucleus (Derynck and Zhang 2003). In the nucleus, the Smad3–Smad4 complex regulates the transcription of target genes (Attisano and Wrana 2002). Activin A (ActA), a

These authors contributed equally to this work.

Ó The Authors 2015

www.publish.csiro.au/journals/rfd

1874

Reproduction, Fertility and Development

X.-F. Sun et al.

member of the TGF-b superfamily, is produced by granulosa cells in the ovary and expressed in granulosa cells from primary to tertiary follicles (Rabinovici et al. 1992). It plays important roles in regulating preantral follicle development by modulating the expression of some hormones and their receptors (Zhang et al. 2012). Notch signalling is an evolutionarily conserved signalling pathway in species. Notch receptors and ligands are widely expressed in adult tissues (Chen et al. 2014; Feng et al. 2014). Notch receptors are single transmembrane receptors that are activated by transmembrane ligands in the Delta/Serrate/ Lag2 (DSL) family on neighbouring cells. Whereas Drosophila only has one Notch receptor that is bound by two ligands, there are four Notch receptors (Notch1–4) and five ligands (Jagged1 and 2 and Delta-like 1, 3 and 4) in mammals (Logeat et al. 1998). Interaction of the Notch receptor with one of its ligands provides local cell communication between cells. Activation of Notch results in proteolytic cleavage of the Notch receptor in the presence of g-secretase and subsequent release of the Notch receptor intracellular domain (NICD) that translocates into the nucleus to activate target genes via the DNA-binding adaptor protein RBP-J/CSL (recombination signal binding protein Jk/ DNA-binding protein CBF-1, Su(H), Lag-1) (Bray 2006; Kovall 2008). In the mammalian ovary, Notch signalling has been suggested to be involved in folliculogenesis. In 2001, the expression pattern of some Notch signalling molecules was examined in the mammalian ovary by in situ hybridisation (Johnson et al. 2001). After that, Notch signalling was also found to be important in folliculogenesis (Trombly et al. 2009; Jovanovic et al. 2013; Xu and Gridley 2013). In many organs, both Notch and TGF-b signalling pathways are involved in the regulation of several developmental processes, including specification of cell fate, differentiation, proliferation and apoptosis, either in a positive or negative manner (Blokzijl et al. 2003). However, it remains unclear whether or how these two systems interact in the regulation of the proliferation of granulosa cells. A recent microarray study on transcriptional changes in human keratinocytes exposed to TGF-b identified several components of the Notch pathway, including transcription factor hairy and enhancer of split 1 (Hes-1), a direct target of Notch signalling (Zavadil et al. 2001). In the present study, we describe the interaction between the TGF-b and Notch signalling pathways in granulosa cells and propose a mechanistic model for TGF-b and Notch signalling pathways in granulosa cell proliferation.

Culture and transfection of granulosa cells Ovaries from 12–14 dpp mice were minced by a mechanical method before digestion with 12.5 mg mL
1 collagenase IV (C-5138; Sigma, St Louis, MO, USA). After digestion, follicles were picked up using a pipette and trypsinised at 378C for 10 min to separate the follicles into single cells. The cells (including granulosa cells and oocytes) were cultured with Dulbecco’s modified Eagle’s medium (DMEM)/F12 medium supplemented with 10% fetal bovine serum (FBS), 100 U mL
1 penicillin and 100 mg L
1 streptomycin in an incubator with 5% CO2 at 378C for 6 h. The adherent cells were granulosa cells. The suspended oocytes were removed after changing the medium. Then, granulosa cells were transfected with the pcDNA3.1-Smad3 construct or Smad3 short interference (si) RNA in a BTX (Harvard Apparatus, Holliston, MA, USA) electroporation 4-mm cuvette. Electroporation was performed at 700 V. Granulosa cells were kept on ice for 10 min before being transferred to 10-cm culture plates. Then, cells were cultured with DMEM/ F12 medium supplemented with 10% FBS, 100 U mL
1 penicillin and 100 mg L
1 streptomycin in an incubator with 5% CO2 at 378C. Negative controls transfected with empty vector and scrambled siRNA were treated the same way. After transfection, cells were cultured for 3 or 5 days. Cells in the ActA group were cultured in the presence of 100 ng mL
1 ActA (A5480; Sigma) for 3 or 5 days. Cells in the DATP group were cultured at a concentration of 20 mM DAPT (D5942, Sigma) for 3 or 5 days.

Materials and methods Animals and ovary collection CD-1 mice (Vital River, Beijing, China) were maintained on a 12-h light–dark cycle with food and water available ad libitum. Ovaries were collected from 12–14 day post partum (dpp) mice because most follicles at this age are preantral follicles with strong proliferative granulosa cells (Yao et al. 2010). Ovaries were either stored at
808C for the analysis of mRNAs and proteins or fixed immediately with 4% paraformaldehyde (PFA) for immunohistochemistry. All procedures involving animals in the present study were reviewed and approved by the Ethics Committee of Qingdao Agricultural University.

RNA isolation and real-time reverse transcription– polymerase chain reaction Total RNA was isolated from 12–14 dpp mouse ovaries using an RNAprep pure Micro Kit (RN07; Aidlab, Beijing, China) and dissolved in RNase-free water. Total RNA was reverse transcribed using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (AT311-03; Transgen, Beijing, China) according to the manufacturer’s instructions. The reaction conditions were 428C for 30 min followed by 858C for 5 min using anchored oligo(dT)18 primer. The real-time polymerase chain reaction (PCR) was performed on a Light Cycler 480II (Roche, Mannheim, Germany) using a SYBR Premix Ex Taq II

Cell proliferation analysis Granulosa cells were labelled with 10 mg mL
1 bromodeoxyuridine (BrdU) for 24 h. Then, cells were fixed with 70% ethanol for 30 min, incubated with dilution buffer (with RNase) at 378C for 30 min and 2 M HCl for 20 min at room temperature. The cells were then incubated with anti-BrdU mouse monoclonal antibody (B2531; Sigma) overnight at 48C and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG for 1 h at room temperature. Propidium iodide (PI) was used to label nuclei. The percentage of BrdU-positive cells was calculated to analyse the proliferation of preantral granulosa cells (PAGCs). Cell proliferation was also examined by counting cell numbers. Granulosa cells were counted using a blood counting chamber and the same number of cells was seeded in a 6-well plate. After 3 or 5 days culture in an incubator with 5% CO2 at 378C, PAGCs were trypsinised thoroughly and counted again.

TGF-b Notch granulosa cell proliferation

Reproduction, Fertility and Development

1875

Table 1. Primers used for quantitative polymerase chain reaction and chromatin immunoprecipitation Genes

Primer sequence (50 –30 )

b-Actin

Forward: TCGTGGGCCGCTCTAGGCAC Reverse: TGGCCTTAGGGTTCAGGGGGG Forward: CCACCAGATGAACCACAGCA Reverse: GCTGTGAGGCGTGGAATGT Forward: GCTGTCAATAATGTGGAGGCG Reverse: TTGGCCGCTTCATAACTTCC Forward: GCCCTTGTGAGGAAACGACC Reverse: GAGAGGTAGTTGTCGGTGAATTGG Forward: GGGAAAAGAGCCTGATGCC Reverse: CTTTTATGAGGTCTGGGGACG Forward: CCCGAGGCTGTGAGTTCAG Reverse: TCTTTCTGACCGTCTACCCAGT Forward: CACAGTACCACATGCCCACC Reverse: GCAGCAGATTGGCTGGTAAA Forward: TTCTCTTGTCCTTTCCCGCT Reverse: GACCCTCCACCTTACACAGATA Forward: AACACCACACCTGGAGTTTAC Reverse: GCCACGGAGTTCTTTAGCAT

Smad3 Notch2 Hey2 Hey1F1 Hey1F2 Hey1F3 Hey2F1 Hey2F2

(DDR081A; TaKaRa, Dalian, China) to quantitatively measure mRNA levels b-actin (Actb), Smad3, Notch2 and hairy/ enhancer-of-split related with YRPW motif 2 gene (Hey2). Specific primers were designed according to the complete mouse cDNA sequences. Real-time PCR was performed at 958C for 10 min, followed by 45 cycles of 958C for 10 s, 608C for 10 s and 728C for 10 s. The specificity of all PCR reactions was confirmed by a single peak in the melting curves and a single band of the predicted size after agarose gel electrophoresis. All primers are listed in Table 1. To exclude contamination of genomic DNA, the Actb primers were designed to cover an intron. Western blot analysis Whole cell proteins were extracted from PAGCs with RIPA lysis buffer (P0013C; Beyotime, Nantong, China) containing protease and phosphatase inhibitors. Cytoplasmic and nuclear proteins were extracted using a Nuclear and Cytoplasmic Extraction Kit (CW0199; CWBIO, Beijing, China). Total proteins (30 mg) were electrophoresed under reducing conditions by sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis (4% stacking gel and 10% separating gel) for 1 h at 100 V and for 2.5 h at 120 V, then transferred to polyvinylidene difluoride (PVDF) membranes using BIO-RAD Trans-Blot SD Semi-dry Transfer Cells (Bio-Rad, Hercules, CA, USA) at 15 V for 180 min. Membranes were blocked with 10% bovine serum albumin (BSA) for 4 h at 48C and then incubated overnight at 48C with primary antibodies (1 : 1000 dilution; anti-b-actin mouse antibody (ab8226; Abcam, Cambridge, MA, USA); antiSmad3 rabbit antibody (ab28379; Abcam); anti-phosphorylated (p-) Smad3 (Ser423/425) rabbit antibody (#9520; Cell Signaling Technology, Danvers, MA, USA); anti-HEY2 rabbit antibody (ab25404; Abcam); and anti-Notch2 rabbit antibody (ab8926; Abcam)). After three washes in Tris-buffered saline Tween-20 (TBST), membranes were incubated with horseradish

Product size (bp)

Accession no.

255

NM_007393

179

NM_016769

125

NM_010928

125

NM_013904

142

AC132225

127

AC132225

119

AC132225

112

AC_000032

135

AC_000032

peroxidase-labelled goat anti-rabbit or mouse IgG secondary antibody (1 : 2000 dilution; Beyotime) for 2 h at room temperature. Proteins were then visualised by chemiluminescence using a BeyoECL plus Kit (Beyotime). PWIN software (Blairstown, NJ, USA) was used for densitometric analyses. For detection of b-actin, Smad3, Hey2 and Notch2, experiments were repeated three to four times. Immunohistochemistry Ovaries were fixed in 4% PFA overnight at 48C, dehydrated through a graded series of ethanol and embedded in paraffin. Serial sections (5 mm) were dewaxed and rehydrated. Antigen retrieval was performed in 0.01 M sodium citrate by boiling at 968C for 10 min. Sections were blocked in Tris-buffered saline (TBS) with 3% (w/v) BSA and 10% (v/v) normal goat serum for 30 min at room temperature and then incubated with primary Smad3, Hey2 or Notch2 antibodies at a dilution of 1 : 200 overnight at 48C. Sections were incubated with secondary antibodies (1 : 50 dilution) at 378C for 1 h and then counterstained with PI. Negative controls were performed by omitting the primary antibody. No fluorescent signal was detected in the negative controls, which indicates the specificity of the assay. Co-immunoprecipitation PAGCs were harvested after 3 days culture, digested with 200 mL membrane extraction buffer (containing protease and phosphatase inhibitors) and centrifuged at 9000g for 3 min at 48C to obtain nuclei. Nuclei were digested with 100 mL nuclear extraction buffer (containing protease and phosphatase inhibitors) and treated with 1 mL DNA enzyme. Then, 10 mL of digested solution was collected as input samples. As a negative control, 10 mL of digested solution was mixed with 1 mL normal rabbit IgG and 15 mL protein A/G agarose beads. The remaining 80 mL of digested solution was incubated with anti-Notch2

Reproduction, Fertility and Development

ActA

(b)

Control

ActA

BrdU

Control

(c) PI

Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) was performed using a Pierce Agarose ChIP Kit (Thermo Scientific, Rockford, IL, USA). Briefly, PAGCs were cultured for 3 days with DMEM/ F12 medium supplemented with 10% fetal bovine serum (FBS), 100 U mL
1 penicillin and 100 mg L
1 streptomycin in an incubator with 5% CO2 at 378C and treated with formaldehyde for 10 min at room temperature before being harvested. After lysis, the formaldehyde-cross-linked protein–DNA complexes in the protein lysates were digested by Micrococcal Nuclease (ChIP grade; Pierce Biotechnology, Rockford, IL, USA). Protein–DNA complexes were precleared and immunoprecipitated using antip-Smads (Ser423/425) rabbit monoclonal antibody and protein A/G agarose beads, and then reverse cross-linked by proteinase K treatment at 658C for 30 min with shaking. The enrichment of specific promoter DNA contents was amplified by PCR (all primers are listed in Table 1). To confirm the binding sites of Smad3 protein on the promoter region of Hey1 and Hey2, the PCR products of Hey1–3 and Hey2–1 were purified and subcloned into pMD19-T vector (TaKaRa) for sequencing.

(a)

∗∗

100 80 60

Merge

(NICD2) and 15 mL protein A/G agarose beads. After centrifugation at 9000g for 3 min at 48C and three washes in nuclear extraction buffer, the pellet was resuspended in 2 SDS solution. Immunoblots were probed with anti-p-Smad3 (Ser423/425) rabbit monoclonal antibody, as described above.

X.-F. Sun et al.

Percentage of cell proliferation

1876

40 20 0 Control

ActA

Fig. 1. Activin A (ActA) promotes the proliferation of preantral granulosa cells (PAGCs). (a) Cell morphology of preantral granulosa cells (PAGCs) cultured with or without 100 ng mL
1 ActA for 3 days. (b) Immunocytochemical staining for bromodeoxyuridine (BrdU) in PAGCs. (c) Percentage of BrdU-positive cells. **P , 0.01. PI, propidium iodide.

Results Effects of ActA on PAGC proliferation in vitro To determine the effect of ActA on granulosa cell proliferation, granulosa cells from 12–14 dpp mouse ovaries were cultured with 100 ng mL
1 ActA for 3 days. Cell proliferation was examined by BrdU staining. As shown in Fig. 1a–c, the percentage of BrdU-positive cells increased significantly after ActA treatment compared with control cells, suggesting that ActA can promote the proliferation of granulosa cells.

Interaction of TGF-b and Notch signalling pathways in granulosa cell proliferation We also examined the expression of two key molecules, namely Notch2 (the receptor of the Notch signalling pathway) and Hey2 (the target gene of the Notch signalling pathway), in granulosa cells of 12–14 dpp mouse ovaries and found that both Notch2 and Hey2 were highly expressed in the granulosa cells (Fig. 3a). Moreover, ActA treatment significantly increased the expression of Notch2 and Hey2 protein (Fig. 3b). Furthermore, Smad3 overexpression in granulosa cells significantly increased mRNA expression of Notch2 and Hey2 (Fig. 3c). N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine tbutylester (DAPT) is widely used to inhibit Notch signalling; it inhibits the cleavage of the transmembrane protein Notch receptor into the Notch intracellular domain mediated by gsecretase (Feng et al. 2014). As shown in Fig. 4, the proliferation of PAGCs was significantly inhibited by DAPT and the inhibitory effect of DAPT was rescued by ActA or Smad3 overexpression after 3 and 5 days culture (Fig. 4). The results showed that the trend of granulosa cell proliferation is consistent with the expression of Hey2 protein (Figs 4, 5a, b).

Role of TGF-b signalling pathway in granulosa cell proliferation ActA is a member of the TGF-b superfamily. To verify the effect of ActA on granulosa cell proliferation, we examined the expression of Smad3, a key regulator in the TGF-b pathway, in granulosa cells. Using fluorescent immunohistochemistry, we found that Smad3 was highly expressed in granulosa cells of 12–14 dpp mouse ovaries (Fig. 2a). Both ActA and Smad3 overexpression promoted granulosa cell proliferation (Fig. 2b) and increased the expression of Smad3 at both the mRNA and protein levels (Fig. 2c, d).

Interaction point between TGF-b and Notch signalling pathways Co-immunoprecipitation (CoIP) and ChIP were performed to explore the point of interaction between the TGF-b and Notch signalling pathways. We observed that p-Smad3 was precipitated by anti-Notch2 (NICD2) antibody (Fig. 5c), indicating direct interaction between Smad3 and NICD2. Moreover, the ChIP results showed that clear bands (see Fig. 5d) could be obtained by PCR by using DNA template from anti-p-Smad3 (Ser423/425) antibody precipitation. The PCR products of Hey1–3 and Hey2–1 were purified and subcloned into pMD19-T vector

Statistical analysis Independent experiments were repeated at least three times. Data are expressed as the mean  s.e.m. The significance of differences was analysed by unpaired Student’s t-test with twotailed distribution of three samples of unequal variance in GraphPad Prism (GraphPad Software, San Diego, CA, USA). P , 0.05 was considered as significantly different.

TGF-b Notch granulosa cell proliferation

Reproduction, Fertility and Development

1877

(a) Merge

Smad3

15

10 ∗∗∗

3 ad Sm

Actin

42 kD

0 E O

∗ ∗

1.6 1.2 0.8 0.4 0.0

E O

l

Sm

ad

3

Ac

tro on

Sm

tA

3

tro

2.0

C

5

on

1000

48 kD

The ratio of protein level

∗∗

l

∗∗ ∗∗

∗

Smad3 20

tA

∗

3000

2000

(d )

ad

Control ActA Smad3 OE

(c) Smad3 OE

C

The number of cells

4000

ActA

Ac

Control

Relative mRNA level of smad3

(b)

C on tro l Ac tA

O

E

PI

0 3 days

5 days

Fig. 2. Smad3 overexpression (OE) promotes proliferation of preantral granulosa cells (PAGCs). (a) Immunohistochemical staining of Smad3 in granulosa cells of 12–14 day post partum (dpp) mouse ovaries. (b) Activin A (ActA) treatment and Smad3 OE promote PAGC proliferation. Cells were cultured for 3 or 5 days and then cell numbers were counted. (c, d ) ActA treatment and Smad3 OE increase both mRNA (c) and protein (d) expression of Smad3. Data are the mean  s.d. of three to five experiments. *P , 0.05, **P , 0.01. PI, propidium iodide.

for sequencing. The sequencing results showed that the amplified DNA fragments were identical to the expected promoter regions of Hey1 and Hey2, indicating that p-Smad3 was recruited to the promoter regions of Notch target genes as a transcription factor. Discussion ActA was originally identified and purified from porcine follicular fluid in 1986 (Vale et al. 1986), and it is now know to be involved in proliferation, differentiation and apoptosis as a member of the TGF-b superfamily (Roberts and Sporn 1990; Andrieux et al. 2014). In the ovary, ActA is expressed primarily by granulosa cells of follicles and acts not only as an endocrine factor acting on the pituitary gland to regulate FSH secretion, but also as a paracrine and autocrine factor acting on granulosa cells to regulate folliculogenesis and follicular development (Nomura et al. 2013). Previously, we reported that ActA can promote the proliferation of PAGCs during the growth of mouse oocytes to maturity from premeiotic germ cells in vitro (Zhang et al. 2012).

In the present study, the increased proliferation of PAGCs induced by ActA was confirmed by culturing PAGCs from 12–14 dpp mice in the presence of ActA in vitro (Fig. 1). ActA is considered an important signalling molecular in the TGF-b pathway; so we detected the expression of Smad3, which is a key gene in the TGF-b signalling pathway. Smad3 expression was increased significantly at both the mRNA and protein levels in the presence of ActA. Moreover, PAGC proliferation was promoted by Smad3 overexpression. Coincidentally, the TGF-b signalling pathway has been reported to play a significant role in the regulation of cell proliferation of many cell types, such as cutaneous stem cells (Rognoni et al. 2014). Interestingly, both ActA treatment and Smad3 overexpression promoted the expression of Hey2, which implies cross-talk between the TGF-b and Notch signalling pathways. Meanwhile, the expression of Hey2 was decreased in PAGCs after Smad3 knockdown. Most of the target genes in the Notch signalling pathways are oncogenes, such as HES, HEY and myelocytomatosis oncogene (MYC). Activation of these oncogenes can lead to

1878

Reproduction, Fertility and Development

X.-F. Sun et al.

(a)

(b) Notch 2

PI

Merge Control

ActA

Notch2

Hey2

Hey2

36 kD

Actin

42 kD

Merge

4

∗∗

∗∗

4 3 3 2 2 1

1

0

∗∗ 2

1

3

N ot ch 2

O E

l tro Sm ad

on

3

∗∗

0

O E

l tro Sm ad

on C

Control ActA

3

0 C

Relative mRNA level

4

Hey2

5

The ratio of protein level

Notch2

(c)

He y2

PI

110 kD

Fig. 3. Activin A (ActA) and Smad3 overexpression (OE) increase the expression of target genes in the Notch signalling pathway. (a) Expression of Hey2 and Notch2 in 12–14 day post partum (dpp) mouse ovaries. (b) ActA treatment significantly increased the expression of Hey2 and Notch2 proteins. (c) Smad3 OE increased expression of Hey2 and Notch2 mRNA. Data are the mean  s.d. of three to five experiments. **P , 0.01. PI, propidium iodide. ∗∗

(a)

Control

DAPT

(b) ∗∗

∗∗

DAPT⫹ActA

DAPT⫹Smad3 OE

The number of cells

3000

Control DAPT DAPT⫹ActA DAPT⫹Smad3 OE

∗

2000

∗∗∗ ∗∗

1000

0 3 days

5 days

Fig. 4. Inhibitory effects of N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butylester (DAPT) on the proliferation of preantral granulosa cells (PAGCs) can be rescued by both activin A (ActA) and Smad3 overexpression (OE). (a) PAGCs cultured for 3 days in vitro in the presence of DAPT, ActA and Smad3 OE. (b) Number of granulosa cells after treatment with DAPT, ActA and Smad3 OE for 3 or 5 days. Data are the mean  s.d. of three to five experiments. *P , 0.05, **P , 0.01, ***P , 0.0001.

aberrant proliferation of target cells and tumour progression (Hopfer et al. 2005; Choi et al. 2008). In the present study, the trend for granulosa cell proliferation was consistent with the expression of Hey2. So, Notch target genes may influence the proliferation of PAGCs. The proliferation of PAGCs was

inhibited by DAPT, an inhibitor of Notch signalling. This is consistent the report of Zhang et al. (2011). We also found that ActA and Smad overexpression could rescue the inhibitory effect of DAPT on PAGC proliferation, which further suggests an interaction between the TGF-b and Notch signalling pathways.

TGF-b Notch granulosa cell proliferation

Reproduction, Fertility and Development

∗ ∗ ∗

0.5 0.0 36 kD

ACTIN

42 kD

5 ∗∗∗ ∗

0

AP D G

1 ey 1-

3 ey 1-

PC

52 kD

H

IB : pSmad3

H

ey 2-

110 kD

H

IB : Notch2

2

H

(d )

NC

1

Input

2

IP : Notch2

ey 2-

(c)

H

C

on

C

tro Ac l Ac tA tA DA ⫹ P Sm Sm DA T ad 3 ad PT O 3 E O Sm ⫹D E A S Sm m ad P ad ad 3 N T 3 3 siR siR C NA N ⫹ A Ac tA

on

tro

HEY2

∗∗∗

D AP Ac T tA ⫹ D A Sm PT Sm a d3 ad 3 O O E E⫹ D AP T

∗

10

ey 1-

1.0

∗∗

H

1.5

15

(b)

∗

Relative mRNA level of Hey2

The ratio of protein level

∗

∗∗∗

l Ac tA

2.0

(a)

1879

Fig. 5. The point of interaction between the transforming growth factor (TGF)-b and Notch signalling pathways. (a) Protein expression of Hey2 under different conditions, as determined by western blotting. ActA, activin A; OE, overexpression; DAPT, N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butylester. NC, negative control; siRNA, short interference RNA. (b) Expression of Hey2 mRNA under different conditions, as determined by quantitative polymerase chain reaction (PCR). (c) Immunoblot analyses of phosphorylated Smad3 (pSmad3) after precipitation with anti-Notch2 (NICD2) antibody. IB, immunoblotting; IP, immunoprecipitation. (d ) Chromatin immunoprecipitation (ChIP) PCR amplification using DNA contents precipitated by anti-p-Smad3 (Ser423/425) antibody as a template. Data are the mean  s.d. of three to five experiments. *P , 0.05, **P , 0.01, *** P , 0.0001.

The CoIP experiment demonstrated that the Notch2 antibody could precipitate p-Smad3 in the nucleus, indicating that Smad3 directly interacts with NICD2 to form a complex. Previous CoIP experiments mostly used a polypeptide protein tag with sequence motif DYKXXD or other tags (Zavadil et al. 2004; Li et al. 2010; Chu et al. 2012), whereas the CoIP assay in the present study explored the natural interaction between two proteins in primary PAGCs. Moreover, using bioinformatics technology (http://www.cbil.upenn.edu/tess) we verified that there are several Smad3 binding sites in the promoter regions of both the Hey1 and Hey2 genes. ChIP PCR was performed to examine whether p-Smad3 protein acts as a transcription factor by binding directly to the promoter region of target genes of the Notch signalling pathway in the nucleus. The results showed that in normal PAGCs there were at least two binding sites for Smad3 protein (Hey1–1 and Hey1–3; Fig. 5d) in the promoter region of the Hey1 gene and at least one Smad3 protein binding site (Hey2–1; Fig. 5d) in the promoter region of the Hey2 gene. Thus, these data further support that Smad3 can be recruited to the promoter regions of Notch target genes via a direct interaction with NICD. The TGF-b and Notch signalling pathways are

known to collaboratively regulate some developmental events, including the development of chicken embryos (Blokzijl et al. 2003; Li et al. 2010; Chu et al. 2012), epithelial to mesenchymal transition (Zavadil et al. 2004), transformation of neural cells (Amarir et al. 2010) and the aggressiveness of clear cell renal cell carcinoma (Sjo¨lund et al. 2011). Based on our results, we can predict that ActA can bind and activate serine/threonine receptor kinase (TbR-II), and the latter can recruit and phosphorylate serine/threonine receptor kinase (TbR-I) (Attisano and Wrana 2002). The Type I TGFb receptor (TbR-I), a serine/threonine receptor kinase, phosphorylates Smad3 (Heldin et al. 1997) and then the p-Smad3 translocates to the nucleus where it integrates with NICD to form a complex. As a transcription factor, the complex binds to the specific DNA sequence motifs of Notch target genes such as Hey1 and Hey2 and regulates the expression of target genes (Fig. 6). From the interaction model of the TGF-b and Notch signalling pathways, it is easy to understand that ActA and Smad3 can regulate Hey2 expression. However, why do ActA and Smad3 regulate the Notch receptor (Notch2)? Whether there are feedback mechanisms in the Notch signalling pathway

1880

Reproduction, Fertility and Development

X.-F. Sun et al.

Oocyte Granulosa cell Paracrine

in ti v Ac

Ligands such as: Jagged 1 Jagged 2

Autocrine

TβR-II

Cell Membrane

TβR-I

Smad3

pSmad3

γ-secretase

Smad44 pSm

Nucleus d ma pS

Smad 4

NICD

ad 4

3

Sm

ad 3

Notch N receptor I C D Granulosa cell

NICD CSL

Target Genes Hey2

Fig. 6. Interaction model for the transforming growth factor (TGF)-b and Notch signalling pathways. Activin A (ActA) produced primarily by granulosa cells in a paracrine or autocrine manner binds to Type II receptor, then recruits and phosphorylates Type I receptor. As a serine/threonine receptor kinase, the Type I receptor phosphorylates Smad3, which translocates to the nucleus, where phosphorylated Smad3 (pSmad3) protein integrates with Notch2 intracellular domain (NICD) to form a complex. This complex binds to the specific DNA sequence motifs of Notch target genes, such as hairy/enhancer-of-split related with YRPW motif 1 (Hey1) and Hey2, as a transcription factor, the target genes mediate the proliferation of preantral granulosa cells (PAGCs). Conversely, the binding of transmembrane ligand Jagged1 in the oocytes of developing follicles to receptors such as Notch2 in granulosa cells leads to activation of Notch signalling. Activation of Notch signalling then triggers proteolytic cleavage of the Notch receptor in the presence of g-secretase and subsequent release of NICD, which translocates to the nucleus to initiate transcription of target genes (e.g. Hey2), resulting in granulosa cell proliferation. NICD, Notch intracellular domain; CSL, DNA-binding protein CBF-1, Su(H), Lag-1.

needs to be investigated further. However, the results of the present study did not exclude the classical Notch signalling pathway trigged by the binding of Notch ligand and receptor. Both Notch ligands and receptors have been found to be expressed in developing follicles, with Jagged1 being expressed in oocytes of preantral follicles and Notch2 expressed in granulosa cells (consistent with the results of the present study; Fig. 3a) and oocytes of primordial and primary follicles (Zhang et al. 2011). The binding of Jagged1 in oocytes of developing follicles to receptors such as Notch2 in granulosa cells leads to transcription of target genes such as Hey2, resulting in granulosa cell proliferation. It is well known that the proliferation of granulosa cells plays important roles in follicular development. When follicles reach the antral stage, the complete absence of Notch2 (Zhang et al. 2011) leads to a slow proliferation of granulosa cells. The signalling causing

granulosa cell proliferation may be oocyte derived, and the present study showing that ActA causes granulosa cells proliferation is probably due to direct effects on granulosa cells. Acknowledgements This work was supported by grants from the National Nature Science Foundation (No. 31101716 and 31471346), Program for New Century Excellent Talents in University (NCET-12-1026) and Nature Science Foundation (ZR2013CQ029) of Shandong Province.

References Amarir, S., Marx, M., and Calothy, G. (2010). Notch signaling activation suppresses v-Src-induced transformation of neural cells by restoring TGF-b-mediated differentiation. PLoS One 5, e13572. doi:10.1371/ JOURNAL.PONE.0013572

TGF-b Notch granulosa cell proliferation

Reproduction, Fertility and Development

Andrieux, G., Le Borgne, M., and The´ret, N. (2014). An integrative modeling ramework reveals plasticity of TGF-b signaling. BMC Syst. Biol. 8, 30. doi:10.1186/1752-0509-8-30 Artavanis-Tsakonas, S., Rand, M. D., and Lake, R. J. (1999). Notch signaling: cell fate control and signal integration in development. Science 284, 770–776. doi:10.1126/SCIENCE.284.5415.770 Attisano, L., and Wrana, J. L. (2002). Signal transduction by the TGFsuperfamily. Science 296, 1646–1647. doi:10.1126/SCIENCE.1071809 Blokzijl, A., Dahlqvist, C., Reissmann, E., Falk, A., Moliner, A., Dahlqvist, C., Lendahl, U., and Iba´n˜ez, C. F. (2003). Cross-talk between the Notch and TGF-b signaling pathways mediated by interaction of the Notch intracellular domain with Smad3. J. Cell Biol. 163, 723–728. doi:10.1083/ JCB.200305112 Bray, S. J. (2006). Notch signalling: a simple pathway becomes complex. Nat. Rev. Mol. Cell Biol. 7, 678–689. doi:10.1038/NRM2009 Chen, C. L., Fu, X. F., Wang, L. Q., Wang, J. J., Ma, H. G., Cheng, S. F., Hou, Z. M., Ma, J. M., Quan, G. B., Shen, W., and Li, L. (2014). Primordial follicle assembly was regulated by Notch signaling pathway in the mice. Mol. Biol. Rep. 41, 1891–1899. doi:10.1007/S11033-014-3038-4 Choi, J. H., Park, J. T., Davidson, B., Morin, P. J., Shih, IeM., and Wang, T. L. (2008). Jagged-1 and Notch3 juxtacrine loop regulates ovarian tumor growth and adhesion. Cancer Res. 68, 5716–5723. doi:10.1158/00085472.CAN-08-0001 Chu, P. C., Chuang, H. C., Kulp, S. K., and Chen, C. S. (2012). The mRNAstabilizing factor HuR protein is targeted by b-TrCP protein for degradation in response to glycolysis inhibition. J. Biol. Chem. 287, 43 639–43 650. doi:10.1074/JBC.M112.393678 Derynck, R., and Zhang, Y. E. (2003). Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 425, 577–584. doi:10.1038/NATURE02006 Feng, Y. M., Liang, G. J., Pan, B., Qin, X. S., Zhang, X. F., Chen, C. L., Li, L., Cheng, S. F., De Felici, M., and Shen, W. (2014). Notch pathway regulates female germ cell meiosis progression and early oogenesis events in fetal mouse. Cell Cycle 13, 782–791. doi:10.4161/CC.27708 Heldin, C. H., Miyazono, K., and ten Dijke, P. (1997). TGF-b signaling from cell membrane to nucleus through SMAD proteins. Nature 390, 465–471. doi:10.1038/37284 Hopfer, O., Zwahlen, D., Fey, M. F., and Aebi, S. (2005). The Notch pathway in ovarian carcinomas and adenomas. Br. J. Cancer 93, 709–718. doi:10.1038/SJ.BJC.6602719 Johnson, J., Espinoza, T., McGaughey, R. W., Rawls, A., and Wilson-Rawls, J. (2001). Notch pathway genes are expressed in mammalian ovarian follicles. Mech. Dev. 109, 355–361. doi:10.1016/S0925-4773(01) 00523-8 Jovanovic, V. P., Sauer, C. M., Shawber, C. J., Gomez, R., Wang, X., Sauer, M. V., Kitajewski, J., and Zimmermann, R. C. (2013). Intraovarian regulation of gonadotropin-dependent folliculogenesis depends on notch receptor signaling pathways not involving Delta-like ligand 4 (Dll4). Reprod. Biol. Endocrinol. 11, 43. doi:10.1186/1477-7827-11-43 Kovall, R. A. (2008). More complicated than it looks: assembly of Notch pathway transcription complexes. Oncogene 27, 5099–5109. doi:10.1038/ONC.2008.223 Li, Y., Cheng, S. Y., Chen, N., and Reith, M. E. A. (2010). Interrelation of dopamine transporter oligomerization and surface presence as studied with mutant transporter proteins and amphetamine. J. Neurochem. 114, 873–885. doi:10.1111/J.1471-4159.2010.06818.X Logeat, F., Bessia, C., Brou, C., LeBail, O., Jarriault, S., Seidah, N. G., and Israe¨l, A. (1998). The Notch1 receptor is cleaved constitutively by a furin-like convertase. Proc. Natl Acad. Sci. USA 95, 8108–8112. doi:10.1073/PNAS.95.14.8108

1881

Massague´, J., Blain, S. W., and Lo, R. S. (2000). TGF-b signaling in growth control, cancer, and heritable disorders. Cell 103, 295–309. doi:10.1016/ S0092-8674(00)00121-5 Nomura, M., Sakamoto, R., Morinaga, H., Wang, L., Mukasa, C., and Takayanaqi, R. (2013). Activin stimulates CYP19A gene expression in human ovarian granulosa cell-like KGN cells via the Smad2 signaling pathway. Biochem. Biophys. Res. Commun. 436, 443–448. doi:10.1016/ J.BBRC.2013.05.124 Rabinovici, J., Spencer, S. J., Doldi, N., Goldsmith, P. C., Schwall, R., and Jaffe, R. B. (1992). Activin-A as an intraovarian modulator: actions, localization, and regulation of the intact dimer in human ovarian cells. J. Clin. Invest. 89, 1528–1536. doi:10.1172/JCI115745 Roberts, A. B., and Sporn, M. B. (1990). The transforming growth factors-b. In ‘Handbook of Experimental Pharmacology. Peptide Growth Factors and Their Receptors’. (Eds MB Sporn and AB Roberts.) pp. 419–472. (Springer: Berlin.) Rognoni, E., Widmaier, M., Jakobson, M., Ruppert, R., Ussar, S., Katsougkri, D., Bo¨ttcher, R. T., Lai-Cheong, J. E., Rifkin, D. B., McGrath, J. A., and Fa¨ssler, R. (2014). Kindlin-1 controls Wnt and TGF-b availability to regulate cutaneous stem cell proliferation. Nat. Med. 20, 350–359. doi:10.1038/NM.3490 Sjo¨lund, J., Bostro¨m, A. K., Lindgren, D., Manna, S., Moustakas, A., Ljungberg, B., Johansson, M., Fredlund, E., and Axelson, H. (2011). The Notch and TGF-b signaling pathways contribute to the aggressiveness of clear cell renal cell carcinoma. PLoS One 6, e23057. doi:10.1371/JOURNAL.PONE.0023057 Trombly, D. J., Woodruff, T. K., and Mayo, K. E. (2009). Suppression of Notch signaling in the neonatal mouse ovary decreases primordial follicle formation. Endocrinology 150, 1014–1024. doi:10.1210/ EN.2008-0213 Vale, W., Rivier, J., Vauqhan, J., McClintock, R., Corrigan, A., Woo, W., Karr, D., and Spiess, J. (1986). Purification and characterization of an FSH releasing protein from porcine ovarian follicular fluid. Nature 321, 776–779. doi:10.1038/321776A0 Xu, J., and Gridley, T. (2013). Notch2 is required in somatic cells for breakdown of ovarian germ-cell nests and formation of primordial follicles. BMC Biol. 11, 13. doi:10.1186/1741-7007-11-13 Yao, G., Yin, M., Lian, J., Tian, H., Liu, L., Li, X., and Sun, F. (2010). MicroRNA-224 is involved in transforming growth factor-betamediated mouse granulosa cell proliferation and granulosa cell function by targeting Smad4. Mol. Endocrinol. 24, 540–551. doi:10.1210/ ME.2009-0432 Zavadil, J., Bitzer, M., Liang, D., Yang, Y. C., Massimi, A., Kneitz, S., Piek, E., and Bottinger, E. P. (2001). Genetic programs of epithelial cell plasticity directed by transforming growth factor-b. Proc. Natl Acad. Sci. USA 98, 6686–6691. doi:10.1073/PNAS.111614398 Zavadil, J., Cermak, L., Soto-Nieves, N., and Bo¨ttinger, E. (2004). Integration of TGF-b/Smad and Jagged1/Notch signalling in epithelial-tomesenchymal transition. EMBO J. 23, 1155–1165. doi:10.1038/ SJ.EMBOJ.7600069 Zhang, C. P., Yang, J. L., Zhang, J., Li, L., Huang, L., Ji, S. Y., Hu, Z. Y., Gao, F., and Liu, Y. X. (2011). Notch signaling is involved in ovarian follicle development by regulating granulosa cell proliferation. Endocrinology 152, 2437–2447. doi:10.1210/EN.2010-1182 Zhang, Z. P., Liang, G. J., Zhang, X. F., Zhang, G. L., Chao, H. H., Li, L., Sun, X. F., Min, L. J., Pan, Q. J., Shi, Q. H., Sun, Q. Y., De Felici, M., and Shen, W. (2012). Growth of mouse oocytes to maturity from premeiotic germ cells in vitro. PLoS One 7, e41771. doi:10.1371/JOURNAL. PONE.0041771

www.publish.csiro.au/journals/rfd