JOURNAL OF NEUROCHEMISTRY

| 2014 | 129 | 988–1001

, ,1

doi: 10.1111/jnc.12682

, ,1 ,

,

,

, ,

*Department of Cardiology, Renmin Hospital of Wuhan University, Wuhan, China †Cardiovascular Research Institute of Wuhan University, Wuhan, China ‡Wuhan Center for Magnetic Resonance, State Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan, China §College of Life Sciences, Wuhan University, Wuhan, China

Abstract Interferon regulatory factor 8 (IRF8), a transcriptional regulator in the IRF family, has been implicated in innate immunity, immune cell differentiation and tumour cell apoptosis. In the present study, we found that IRF8 is constitutively expressed in the brain and suppressed after cerebral ischaemia in a timedependent manner. IRF8 knockout (IRF8-KO) mice, wild type (WT) mice, neuron-specific IRF8 transgenic (TG) mice and non-transgenic mice were used in a transient cerebral ischaemic model. The IRF8 knockout mice exhibited aggravated apoptosis, inflammation and oxidative injury in the ischaemic brain, eventually leading to poorer stroke outcomes, whereas neuron-specific IRF8 transgenic mice showed a

marked inhibition of apoptosis and improved stroke outcomes. To model ischaemia/reperfusion conditions in vitro, primary cortical neurons were cultured and subjected to transient oxygen and glucose deprivation for 60 min. Similar to the in vivo study, IRF8 knockdown by Ad-shIRF8 resulted in increased apoptosis, whereas IRF8 over-expression by Ad-IRF8 significantly decreased neuronal apoptosis. These data indicate that IRF8 is strongly protective in ischaemic stroke by regulating neuronal apoptosis, the inflammatory response and oxidative stress. Keywords: apoptosis, inflammation, IRF8, ischaemia, oxidative stress, stroke. J. Neurochem. (2014) 129, 988–1001.

Stroke is the second leading cause of death and most common cause of disability worldwide, and has a profoundly negative impact on individuals and society (Bronner et al. 1995; Tu 2010). Almost 85% of strokes are ischaemic. In the last decade, the mechanisms of ischaemic cerebral injury have been extensively investigated; however, little progress has been made in the clinical realm. Currently, reperfusion with recombinant human tPA is the only effective therapy for ischaemic stroke (Baldwin et al. 2010), but this treatment is limited because of the narrow therapeutic time window (3– 4.5 h) needed to protect against severe reperfusion injury (Murray et al. 2010). Thus, exploring novel targets to reduce cerebral ischaemia-reperfusion injury is important and urgent for stroke therapy. The pathological processes of cerebral ischaemia-reperfusion injury are complex and include a series of pathological changes involving cellular bioenergetic failure, excitotoxicity,

oxidative stress, inflammation and apoptosis, eventually leading to neuronal cell death (Doyle et al. 2008; Brouns and De Deyn 2009). The modulation of these pathological processes depends on the expression of endogenous mediators that are regulated by transcription factors (Yi et al. 2007).

988

Received November 13, 2013; revised manuscript received February 7, 2014; accepted February 12, 2014. Address correspondence and reprint requests to Hongliang Li, Department of Cardiology, Cardiovascular Research Institute, Wuhan University, Renmin Hospital of Wuhan University, Jiefang Road 238, Wuhan 430060, China. E-mail: [email protected] 1 These authors contributed equally to the work. Abbreviations used: CBF, cerebral blood flow; IRF8, interferon regulatory factor 8; LDH, lactate dehydrogenase; MCA, middle cerebral artery; PBS, phosphate-buffered saline; tMCAO, transient middle cerebral artery occlusion.

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

IRF8 protects against stroke

Our recent studies have demonstrated that several Interferon regulatory factors (IRFs), members of the IRF transcriptional factor family, are involved in the pathophysiological processes of cardiovascular diseases and metabolic disorders (Lu et al. 2013a; Jiang et al., 2013; Wang et al. 2013c). We found that IRF8 is constitutively expressed in the brain, especially in neurons, and that the expression of IRF8 is dramatically reduced after cerebral ischaemia-reperfusion injury. This significant change in IRF8 expression indicated that IRF8 might play an important role in the pathological processes of cerebral ischaemia-reperfusion. IRF8, also known as interferon consensus sequence-binding protein, is a member of the IRF family, which has nine members in mammals (Driggers et al. 1990; Marecki et al. 1999; Tamura and Ozato 2002). The IRF family was originally identified as a group of transcriptional factors in the type I interferon system and has been proven to have versatile and critical functions in innate immunity and immune cell differentiation (Tailor et al. 2006; Paun and Pitha 2007; Tamura et al. 2008). As a transcriptional regulator, IRF8 can regulate transcription through multiple target DNA elements and functions as either a transcriptional activator or repressor, depending on the formation of different heterodimeric complexes with partner molecules and target DNA elements (Weisz et al. 1992; Kurotaki et al. 2013). IRF8 was first identified in lymphoid and myeloid cells. Previous studies have shown that IRF8 plays a central role in immune regulation and myeloid cell differentiation and is involved in the development of systemic lupus erythematosus and leukaemia (Weisz et al. 1992; Holtschke et al. 1996; Tamura and Ozato 2002; Hu et al. 2011; Chrabot et al. 2013). In studies by Yang et al., IRF8 expression was demonstrated in non-hematopoietic cancer cells, where it mediates the expression of Fas, Bax, FLICEinhibitory protein (FLIP), Janus kinase 1 and Signal transducer and activator of transcription 1 to regulate apoptosis in sarcoma cells and colon carcinoma cells (Yang et al. 2007a,b, 2009). Several studies have shown that IRF8 may participate in multiple sclerosis, a central nervous system inflammatory demyelinating disease and peripheral nerve injury (De Jager et al. 2009; Park et al. 2013). However, the functional role of IRF8 in ischaemic brain injury has not been elucidated. In the present study, IRF8 expression was detected in the brain and in cultured neurons and was observed to be dramatically reduced after ischaemia-reperfusion or oxygen and glucose deprivation (OGD) challenge. Additionally, IRF8 knockout mice showed poorer stroke outcomes due to increased neuronal apoptosis, inflammation and oxidative injury in the ischaemic brain. Furthermore, neuron-specific IRF8 transgene inhibited neuronal apoptosis and improved stroke outcomes. A similar trend in the apoptosis levels was also observed in cultured neurons that gained or lost IRF8 expression. These findings demonstrated that IRF8 is a critical modulator of the pathological processes of cerebral ischaemiareperfusion and plays a protective role in reperfusion injury.

989

Materials and methods Animals All animal procedures were approved by the Wuhan University Animal Ethics Committee. IRF8-deficient mice (B6.129P2-Irf8tm1Hor/Kctt) were purchased from the European Mouse Mutant Archive (EMMA, EM: 02414; Munich, Germany). The IRF8 knockout (KO) mice were genotyped using PCR analysis with the primers 50 -CATGGCA CTGGTCCAGATGTCTTCC-30 , 50 CTTCCAGGGGATACGGAA CATGGTC-30 and 50 -CGAAGGAGCAAAGCTGCTGCTATTGG CC-30 . IRF8 KO mice with a B6.129 background were backcrossed to a C57BL/6 mouse for at least six generations to yield IRF8 KO mice. To generate IRF8 TG mice, full-length mouse IRF8 cDNA was cloned downstream of the neuron-specific promoter calcium/calmodulin-dependent protein kinase II alpha (CaMKIIa). The resulting construct drives IRF8 expression preferentially within neuronal cell bodies in the cortex, hippocampus and cerebellum (Kelly and Vernon 1985; Dragatsis and Zeitlin 2000). TG mice were then produced via microinjection of the CaMKIIa-IRF8 construct into fertilised mouse embryos (C57BL/6 background). Four independent transgenic lines were established and examined. The TG mice were identified using PCR analysis of tail genomic DNA (forward primer: 50 - CCAGATTACGCTGATTGTGACCGGAAC GGCGGGCG -30 ; reverse primer: 50 - AGGGAAGATCTTGATTTAGACGGTGATCTGTTGAT -30 ). The WT mice we used in the present study were the littermates of IRF8 KO mice, the non-transgenic (NTG) mice were the littermates of the IRF8 TG mice. Male, 10- to 12-week-old WT mice, IRF8 KO mice, IRF8 TG mice and NTG mice were used in this study.

Mouse transient focal cerebral ischaemia model The procedure for transient middle cerebral artery occlusion (tMCAO) was previously described (Wang et al. 2012a,b). The animals were anaesthetised with 2.5–3% isoflurane in O2. A probe was fixed to the skull (2 mm posterior and 5 mm lateral to the bregma) through a little small incision on the scalp and connected to a laser Doppler flow metre (Periflux System 5010; Perimed, J€arf€alla, Sweden) to continuously monitor the cerebral blood flow (CBF). The rectal temperature during the operation was maintained at 37  0.5°C using a heating pad. To achieve tMCAO, a 6-0 monofilament surgical suture coated with silicon (Doccol, Redland, CA, USA) was inserted into the left external carotid artery. Then the suture was advanced to the internal carotid artery and wedged into the Willi’s artery circle to obstruct the origin of the left middle cerebral artery (MCA). An interruption of the CBF in the MCA territory was confirmed by recording greater than 80% decline in the relative CBF. The filament was withdrawn after 45 min of ischaemia. A return to greater than 70% of basal CBF within 10 min confirmed the reperfusion of the MCA territory. Mice in which the filament was withdrawn immediately after a decline in CBF were used as sham controls. Heart rate, systolic blood pressure and diastolic blood pressure were monitored in randomly selected, conscious mice using the non-invasive tail-cuff method (see Supporting Information). Body weight and arterial blood gases were measured prior to surgery. The experimental groups were wild-type (WT; n = 74), IRF8 KO (n = 70), NTG (n = 60) and TG-IRF8 (n = 60). Analyses were conducted at the times after reperfusion indicated in the text. In all experiments, the examiners were blinded to the mouse genotypes.

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

990

M. Xiang et al.

Neurological deficit scores At 24 and 72 h after tMCAO, the following neurological deficits were assessed using a nine-point scale (Xia et al. 2006; Wang et al. 2012a,b): 0 point: lack of neurological deficit, one point: left forelimb flexion when suspended by the tail or unable to fully extend the right forepaw, two points: left shoulder adduction when suspended by the tail, three points: reduced resistance when lateral push toward the left side, four points: spontaneous movement in all directions, and circling to the left only when the animal was pulled by the tail, five points: spontaneously circling or walking solely to the left, six points: only walking when stimulated, seven points: lack of response to stimulation and eight points: strokerelated death. Measurement of infarct volume The infarct volume was measured at 24 and 72 h after tMCAO by 2,3,5-triphenyl-2H-tetrazolium chloride (TTC) staining (Wang et al. 2012a,b). Briefly, the mice were anaesthetized with sodium pentobarbital (50 mg/kg IP) and then killed by cervical dislocation. The brains were cut into 1-mm-thick coronal sections and stained with 2% TTC (Sigma, St. Louis, MO, USA) in phosphate-buffered saline (PBS) (pH 7.4) for 15 min at 37°C. After staining, the sections were fixed with a 10% formalin solution overnight. Fixed sections were then photographed, and the volume of the infarction was quantified using Image-Pro Plus 6.0 software (Media Cybernetics, Bethesda, MD, USA). To correct for the oedema, the area of the infarction was measured by subtracting the area of the non-lesioned ipsilateral hemisphere from the area of the contralateral hemisphere. The volume of the infarction was calculated by the accumulation of the lesion areas at the seven measured levels of the brain. Magnetic resonance imaging Magnetic resonance imaging was performed using a 7.0-T magnetic resonance scanner (BioSpec 70/20USR; Bruker, Billerica, MA, USA). The mice were anaesthetised with chloral hydrate (15307500G-R; Sigma). We used a volume coil for the radio frequency transmitter and a surface coil for the receiver. The temperature was maintained via a heating block built into the gradient system, and respiration was monitored throughout the entire scan. We acquired images with a two-dimensional T2-weighted fast spin echo sequence with the following parameters: slice thickness 0.50 mm, FOV (field of view) 2 cm, echo time (TE)/repetition time (TR) = 26.7/ 2000 ms, resolution = 0.078 9 0.078 mm, echo train length = 4, number of averages = 4 and matrix size = 256 9 256. The infarct volume, expressed as a percentage of the contralateral hemisphere, was summed (a total of five slices), multiplied by the slice thickness and corrected for oedema. Immunofluorescence, TUNEL and Fluoro-Jade B staining The section preparation was previously described (Wang et al. 2012a,b). Sections of 5 lm thickness were prepared and stored at 40°C. For immunofluorescence staining, the sections were washed in PBS containing 10% goat serum and incubated overnight with the following primary antibodies at 4°C: mouse anti-NeuN (MAB377; 1 : 200; Millipore, Temecula, CA, USA), chicken anti-microtubuleassociated protein 2 (MAP2) (Ab5392; 1 : 100; Abcam, Cambridge, UK), rabbit anti-cleaved caspase-3 (##9661; 1 : 100; Cell Signaling Technology, Danvers, MA, USA), anti-IRF8 (#sc13043, 1 : 200;

Santa Cruz Biotechnology, Santa Cruz, CA, USA), mouse anti-4hydroxynonenal (4HNE, ab48506, 1 : 500, Abcam), mouse anti-8-hydroxyguanosine (8OHdG, sc-66036,1 : 200; Santa Cruz Biotechnology), rabbit anti-Nrf2 (ab31163, 1 : 1000, Abcam), rabbit anti-HO-1 (#5141s, 1 : 1000, Cell Signaling Technology), rabbit anti-brain-derived neurotrophic factor (BDNF) (ab72439, 1 : 50; Abcam), rabbit anti-bcl2 (#2870, 1 : 50; Cell Signaling Technology), rat anti-7/4 (ab53457, 1 : 100, Abcam) and mouse anti-F4/80 (#MAC497, 1 : 200; Serotec, Raleigh, NC, USA). For NeuN immunofluorescence staining, the sections were washed in PBS containing 10% goat serum and 0.1% Triton X-100. After washing, the sections were incubated with the anti-NeuN antibody for 2 h prior to incubation in the secondary antibody for 1 h at 37°C. After the sections were washed in PBS, they were incubated with a secondary antibody for 1 h. Finally, the nuclei were labelled with 40 ,6-diamidino-2-phenylindole. For Terminal Deoxynucleotidyl Transferase Mediated dUTP Nick End Labeling (TUNEL) staining, the sections were stained with an ApopTagâ Plus In Situ Apoptosis Fluorescein Detection Kit (S7111; Millipore), according to the manufacturer’s protocol. For Fluoro Jade staining, the sections were stained with a Fluoro Jade B fluorescent dye (AG310; Millipore) according to the manufacturer’s protocol. Visualisation was performed under a fluorescence microscope (Olympus DX51, Olympus, Tokyo, Japan) with DP2-BSW Ver. 2.2 software, and the image analysis was performed with Image-Pro Plus 6.0 software. Tissue preparation For quantitative real-time PCR (qRT-PCR) and western blotting analysis, the mice were anaesthetised and perfused with cold sodium phosphate; the brains were quickly removed. To collect tissue in an unbiased manner that reflected the infarcts globally, the olfactory bulbs and the front and back 1 mm sections of brain tissue were excised. We then collected the remaining portion of left hemisphere which included the infarct area and the peri-infarct area. The brain tissues were frozen in liquid nitrogen immediately and stored in 80°C freezer for storage. Quantitative real-time PCR Total RNA was obtained from snap-frozen tissue specimens using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). A quantity of 2 lg of RNA was reverse-transcribed into cDNA with a Transcriptor First Strand cDNA Synthesis Kit (Roche, Indianapolis, IN, USA). Quantitative RT-PCR analysis was performed with LightCycler 480 SYBR Green 1 Master Mix (Roche) and a LightCycler 480 QPCR System (Roche). The sequence-specific primers for Tumor necrosis factor alpha (TNFa), Monocyte chemoattractant protein-1 (MCP-1), IL-1b, IL-6, Intercellular Adhesion Molecule 1 (ICAM-1), Vascular cell adhesion protein 1 (VCAM-1), Cyclooxygenase-2 (COX-2), Inducible nitric oxide synthase (iNOS), Cluster of Differentiation 36 (CD 36), Matrix metalloproteinase-2 (MMP-2), Matrix metalloproteinase-9 (MMP-9), Nuclear factor erythroid 2-related factor 2 (Nrf2), Heme oxygenase 1 (HO-1) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were described in our previous studies (Wang et al. 2012a,b, 2013a,b). The primer sequences for analysing the Superoxide dismutase 1 (SOD1), Superoxide dismutase 2 (SOD2), Superoxide dismutase 3 (SOD3), Glutathione peroxidase (GPX), Thioredoxin-1 (Txn-1), p67-phox, gp91-phox, IL-2 and F4/80 mRNA levels were shown in Supporting Information.

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

IRF8 protects against stroke

Western blotting Proteins were extracted from brains or cultured cells and homogenised in lysis buffer. The western blot analyses were performed using 50 lg of extracted protein that was separated on 8–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis gels. The proteins were then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The membranes were blocked in tris-buffered saline (TBS) containing 0.1% tween-20 (with 5% skim milk powder) for 1 h at 25  2°C and incubated with primary antibodies overnight at 4°C. Next, the membranes were incubated with secondary antibodies (goat anti-rabbit IRDye 800CW, 92632211, goat anti-mouse IRDye 800CW, 926-32210, or donkey anti-goat IRDye 800CW, 926-32214; LI-COR Biosciences, Lincoln, NE, USA) for 1 h at 25  2°C. The protein signals were detected using the Odyssey Infrared Imaging System (LI-COR Biosciences). The following primary antibodies were used: anti-caspase-3 (#9662), anti-caspase-9 (#9504), anti-cleaved caspase-9 (Asp353; #9509), anti-Bax (#2772), anti-Bcl-2 (#2870), anti-phosphorylated IKKa/b (ser176/180, #2697), anti-IKKb (#2370), anti-NF-jB p65 (#4764), anti-IjBa (#4814) (all from Cell Signaling Technology, Beverly, MA, USA), rabbit anti-BDNF (ab72439), SOD1 (ab13498), SOD2 (ab13533), SOD3 (ab8946) (all from Abcam), anti-IRF8 (sc13043; Santa Cruz Biotechnology), Rabbit anti-cleaved caspase-3 (Asp175; AB3623; Millipore), anti-phosphorylated IjBa (Ser32/36, BS4105) and phosphorylated NF-jB p65 (ser536, BS4138) (both from Bioworld Technology, Minneapolis, MN, USA). Mouse anti-GAPDH (MB001; Bioworld Technology) served as the internal control. In situ zymography In situ zymography was used for localising the net gelatinolytic activity of MMPs (Wang et al. 2013b). A gelatinase/collagenase assay kit (EnzChek; Molecular Probes, Eugene, OR) containing FITC-labelled intramolecularly quenched DQ gelatin was used as a substrate for gelatinase degradation. Gelatinase-induced proteolysis yielded cleaved gelatin-FITC peptides and released fluorescence. The localisation of the fluorescence indicated the sites of net gelatinolytic activity. The mice brains were dissected and rinsed in cold PBS at 24 h after tMCAO, then immersed in an OCT compound (Tissue-Tek, Torrance, CA, USA) and quick-frozen into a block on dry ice. Once embedded in the OCT block, the optic nerves were cut into 20-lm sections using a cryostat (Leica, Wetzler, Germany) and sequentially collected. The brain sections were kept at 80°C. For the in situ zymography, the sections were incubated overnight in a reaction buffer (0.05 M Tris–HCl, 0.15 M NaCl, 5 mM CaCl2, and 0.2 mM NaN3, pH 7.6) that contained 40 mg/mL DQ gelatin. Without fixation or washes at the end of the incubation period, the gelatinolytic activity of MMPs was localised and photographed by fluorescence microscopy with DP2BSW Ver. 2.2 software. The Image-Pro Plus 6.0 software was used for image analysis. Rat cortical neuronal cell culture and an in vitro model of ischaemia Rat cortical neuronal cell cultures and an in vitro model of ischaemia were described in our previous study (Lu et al. 2013b). Cortical neurons were obtained from Sprague–Dawley rats within one day of their birth. The cortices were dissociated by incubation at 37°C in

991

2 mL of 0.125% trypsin (Gibco, Grand Island, NY, USA) for 15 min, followed by the addition of 4 mL of Dulbecco’s modified Eagle’s medium/F-12 (Gibco) which contained 20% foetal bovine serum (Gibco) to inactivate the trypsin. The cell suspension was centrifuged at 1000 rpm for 10 min and resuspended in Dulbecco’s modified Eagle’s medium containing 20% foetal bovine serum. The cells were then filtered with 200-lm sterile filters and seeded on poly-L-lysine coated plates. The neurons were cultured in neurobasal medium (Gibco) fortified with B27 (Gibco) at 37°C and 5% CO2 for 24 h. After plating for 24 h to inhibit cell proliferation, AraC (10 lM, Sigma) was added to the medium and the medium was changed every 48 h. The cells were cultured for 5 days before the experiments. To model ischaemia/reperfusion in vitro, the cultured neurons were exposed to transient OGD for 60 min and then returned to normal culture conditions for various periods. For OGD, the neurobasal medium was replaced with serum-free, glucose-free Locke’s buffer (154 mM NaCl, 5.6 mM KCl, 2.3 mM CaCl2, 1 mM MgCl2, 3.6 mM NaHCO3, 5 mM HEPES and 5 mg/mL gentamicin, pH 7.2), and the cultures were incubated in an hypoxia chamber in a saturated atmosphere of 95% N2 and 5% CO2. Control cells that cultured in the presence of normal levels of glucose were incubated in a humidified atmosphere of 95% air and 5% CO2 for the same periods. Adenoviral vectors construction and infection of neurons Adenoviruses harbouring sequences encoding mouse IRF8 and short hairpin RNA targeting IRF8 (shIRF8) were generated. The ORF clone of mouse IRF8 subcloned into a pCMV6-AC-GFP shuttle vector was purchased from OriGene (TG701093, Rockville, MD, USA). The hairpin-forming oligonucleotides IRF8-f, 50 - TGACCAGCGGCCGCGCCA CCATGTGTGACCGGAACGGC -30 and IRF8-r, 50 - TGACCAAA GCTTTTAAGCGTAATCTGGAACATCGTATGGGTAGACGGT GATCTGTTGAT-30 were synthesised, annealed and subcloned into the shuttle vector distal to the U6 promoter. Recombinant adenoviruses were generated using an AdEasy vector kit (Stratagene, La Jolla, CA, USA). Inserts were cloned into the pShuttle-CMV vector. Plasmids were then recombined with the pAdEasy backbone vector according to the manufacturer’s instructions and transfected into HEK293 cells using the FuGENE transfection reagent (E2312; Roche) for adenoviruses generation. Recombinant adenoviruses were plaque-purified, titred to 109 PFU/mL and verified by restriction digestion. The cultured neurons were transfected with adenovirus at an multiplicity of infection of 100 for 48 h. Analysis of cell viability and lactate dehydrogenase release A non-radioactive cell counting kit-8 (CCK-8) assay (CK04; Dojindo, Kumamoto, Japan) was used for evaluating cell viability. A colorimetric lactate dehydrogenase (LDH) cytotoxicity assay (G1782; Promega, Madison, WI, USA) was used for analysing LDH release. All the procedures were according to the manufacturer’s instructions. Three independent experiments were performed. Dual luciferase-reporter assay The IRF8 binding sites in the bax and SOD1 promoter were predicted by GenomatixMatInspector online software (http://www.genomatix. de/), whereas the binding site in Bcl-2 promoter was identified

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

992

M. Xiang et al.

according to the published method (Burchert et al. 2004). Mouse Bax, Bcl-2 and SOD1 promoters were amplified from C57BL/6 genome using PCR with primers respectively (see Supporting Information). Then these PCR products were inserted into a pGL3basic vector (Promega) to generate wild-type bax, Bcl-2 and SOD1 promoter. Based on a 2-step fusion-PCR approach (primers for mutation were shown in Supporting Information), the core IRF8 binding sites in the bax, Bcl-2 and SOD1 promoter were mutated to generate mutation plasmids. The primary mouse cortical neurons were cultured in a 24-well plate and co-transfected with the indicated vectors for 24 h. Before harvesting, the cultured neurons were then subjected to OGD/reperfusion for 24 h. The passive lysis buffer (100 lL/well, PLB; Promega) was used to lysis the cells for 30 min at 25°C. After centrifuging, the supernatant was collected and assessed for luciferase activity using a Single-Mode SpectraMaxâ Microplate Reader as previously described (Jiang et al. 2013).

Statistical analysis The data were expressed as the means  SE. Differences among groups were determined by two-way ANOVA followed by a post hoc Tukey test. Comparisons between two groups were performed using an unpaired Student’s t-test. A p-value of less than 0.05 was accepted as statistical significance.

Results IRF8 expression is down-regulated after stroke An experimental model of stroke was induced by middle cerebral artery occlusion for 45 min, followed by various periods of reperfusion. Immunofluorescence staining revealed down-regulated IRF8 signals in the peri-infarct area (ipsilateral cortex) compared with the contralateral cortex following cerebral ischaemia-reperfusion (Fig. 1a).

(a)

(b)

(c)

Fig. 1 Interferon regulatory factor 8 (IRF8) expression in the brain was suppressed by ischaemia-reperfusion injury. (a) IRF8 protein expression was measured in neurons in the brain by doubleimmunofluorescence labeling. IRF8 expression in neurons was down-regulated in the ischaemic hemisphere compared with the contralateral hemisphere (n = 3). (b) Western blotting revealed that IRF8 expression was reduced in a timedependent manner from 2 to 72 h after ischaemia onset (n = 3 for each time point). (c) IRF8 expression was detected in cultured neurons and suppressed by oxygen and glucose deprivation (OGD) challenge (n = 3 for each time point).

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

IRF8 protects against stroke

Double-immunofluorescence labelling showed that IRF8 was abundantly expressed in neurons. Western blot analysis of ipsilateral brain homogenates revealed a timedependent decrease in IRF8 expression after cerebral ischaemia-reperfusion injury, with only 26% of the normal levels of IRF8 at 72 h after ischaemic onset (Fig. 1b). A similar IRF8 expression pattern was detected in cultured primary rat cortical neurons. The cultured neurons were challenged with OGD for 1 h, which mimiced the conditions of low oxygen and low glucose during stroke, and returned to normal conditions for various periods of time. Double-immunofluorescence labelling of IRF8 and MAP2 demonstrated that OGD decreased IRF8 expression in a time-dependent manner, similar to the in vivo results (Fig. 1c).

(a)

(b)

IRF8 deficiency aggravated the ischaemic brain injury TTC staining was performed at 24 or 72 h after ischaemia. Compared with the WT mice, the IRF8 deficiency enlarged the infarct volume by approximately 58.3% and 70.1% at 24 h and 72 h after ischaemic onset, respectively (Fig. 2a). Analysis of the infarct volume using Magnetic resonance imaging 24 h after ischaemia showed a similar result (Fig. 2b). IRF8-deficient mice also exhibited significantly higher neurological scores at both time points, with increased approximately 45.8% and 66.7% at 24 h and 72 h, respectively (Fig. 2c). To examine the direct impact of IRF8 deficiency on neurons injury after ischaemia-reperfusion, cultured neurons were infected with IRF8 short hairpin RNA (Ad-shIRF8) or an Ad-shRNA control. Under basal conditions, no significant difference in neuronal survival was observed between the treatments. However, when challenged with OGD, Ad-shIRF8 infection, which knocked down IRF8 expression, led to fewer viable neurons and increased LDH release (Fig. 2d) at each time points. These results demonstrated that IRF8 deficiency led to poorer ischaemic outcomes and exacerbated the neuronal injuries after cerebral ischaemia reperfusion. Neuron-specific IRF8 transgenic mice had reduced stroke lesions The above findings suggested that IRF8 deficiency aggravated brain injury following cerebral ischaemia. To confirm this hypothesis, we generated TG mice that constitutively expressed full-length mouse IRF8 cDNA under the control of the CaMKIIa promoter (see Supporting Information). Four lines of TG mice were established, and the line with the highest IRF8 protein levels in the brain was used for further experiments (see Supporting Information). IRF8 transgenic mice exhibited much smaller infarction areas and better neurological assessment scores compared with the NTG mice after tMCAO (Fig. 3a–c). Additionally, in vitro experiments showed that IRF8 over-expression led to more viable neurons

993

(c)

(d)

Fig. 2 Interferon regulatory factor 8 (IRF8) deficiency aggravated ischaemic injury in a mouse transient middle cerebral artery occlusion (tMCAO) model and in cultured neurons. (a) TTC staining showed that IRF8 deficiency significantly increased the infarct volume at 24 and 72 h after ischaemia (*p < 0.05 vs. n = 6 for WT at 24 h, n = 5 for WT at 72 h, n = 8 for IRF8-KO at 24 h, n = 6 for IRF8-KO at 72 h). (b) Magnetic resonance imaging (MRI) showed an increased infarct volume at 24 h after ischaemic onset. (c) Neurological function was worse in IRF8 KO mice at 24 and 72 h after ischaemia (*p < 0.05 vs. WT, n = 6 for WT at 24 h, n = 5 for WT at 72 h, n = 8 for IRF8-KO at 24 h, n = 6 for IRF8-KO at 72 h). (d) In cultured neurons, the knock-down of IRF8 expression by AdshIRF8 infection led to fewer viable neurons and increased lactate dehydrogenase (LDH) release at 6, 12 and 24 h after oxygen and glucose deprivation (OGD) challenge (*p < 0.05 vs. AdshRNA infection group, n = 6 for each group).

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

994

M. Xiang et al.

in neuronal death in the ischaemic brain of IRF8 KO mice, whereas decreased in the IRF8 TG mice (Fig. 4a). TUNEL was a common method for detecting DNA fragmentation that resulted from programmed cell death. TUNEL staining showed that IRF8 deficiency increased the number of TUNEL-positive cells by approximately two-fold; conversely, decreased the number of TUNEL-positive cells by 92% in IRF8-TG compared with their littermate controls (Fig. 4a). We further examined caspase-3, which was a pivotal effector of the apoptosis signalling cascade in ischaemic stroke, and found that the number of cleaved (active) caspase-3-positive cells was ~ 2.1-fold greater in IRF8 KO mice whereas declined to 27.56% in IRF8 TG mice when compared with their control littermates (Fig. 4b). IRF8 deficiency also down-regulated the anti-apoptotic protein expression levels of BDNF and Bcl2 and up-regulated the expression of the pro-apoptotic genes Bax and cleaved caspase-9 6 h after ischaemic onset (Fig. 4c–e).Opposite to the IRF8 KO mice, the anti-apoptotic protein levels were upregulated, whereas pro-apoptotic protein levels were downregulated in IRF8 TG mice after tMCAO when compared with control littermates (Fig. 4c, d, f). Furthermore, in vitro experiments showed similar results; Ad-shIRF8 infection suppressed Bcl-2 expression and increased cleaved caspase-3 expression, whereas Bcl-2 protein levels increased and cleaved caspase 3 protein levels decreased at different time points in IRF8-over-expressing neurons (Fig. 4g). Thus, these results suggest that IRF8 plays a protective role in neuronal apoptosis in the ischaemic brain.

(a)

(b)

(c)

(d)

Fig. 3 A neuron-specific interferon regulatory factor 8 (IRF8) transgene mitigated the ischaemic injury in a mouse transient middle cerebral artery occlusion (tMCAO) model and in cultured neurons. (a and b) Neuron-specific IRF8 TG mice had a smaller infarct volume (*p < 0.05 vs. non-transgenic (NTG), n = 6 for WT at 24 h, n = 9 for IRF8-KO at 24 h, n = 4 for each group at 72 h). (c) Neuron-specific IRF8 TG mice exhibited improved outcomes based on neurological assessments (*p < 0.05 vs. NTG, n = 6 for WT at 24 h, n = 9 for IRF8-KO at 24 h, n = 4 for each group at 72 h). (d) In cultured neurons, up-regulating IRF8 expression with Ad-IRF8 infection led to more viable neurons and decreased lactate dehydrogenase (LDH) release at 6, 12 and 24 h after oxygen and glucose deprivation (OGD) challenge (*p < 0.05 vs. AdGFP infection group, n = 6 for each group).

and decreased LDH release in cultured neurons challenged with OGD (Fig. 3d). Together, these data demonstrated that IRF8 over-expression effectively protects neurons from ischaemic injury. IRF8 provides neuroprotection in cerebral ischaemia The biological role of IRF8 in neuroapoptotic cascades was detected in vivo. Fluoro-Jade B staining at 24 h after ischaemia-reperfusion was used for evaluating neuronal death. Fluoro-Jade B staining showed a remarkable increase

Deletion of IRF8 exacerbated ischaemia-induced inflammation We next analysed the impact of IRF8 on ischaemia-induced inflammation. Inflammatory cell recruitment was detected using immunofluorescence staining; specifically, an anti-7/4 antibody was used to detect neutrophils, and an anti-F4/80 antibody was used to detect macrophages/microglia. Inflammatory cells were dramatically increased in IRF8-deficient mice relative to the WT controls (Fig. 5a, b). The expression of inflammatory mediators, such as IL-1b, IL-2, IL-6, iNOS, MCP-1, CD36, TNF-a, VCAM-1, ICAM-1, COX-2 and F4/ 80, was increased in the ischaemic brain of IRF8-deficient mice after tMCAO (Fig. 5c). NF-jB signal pathway played a key role in mediating the expression of genes that were involved in inflammation. IRF8 deficiency promoted NF-jB activity as revealed by the increased phosphorylation of IKKb, IjBa and p65 (Fig. 5d). MMP-2 and MMP-9 facilitated inflammatory recruitment and mediated brain injury after cerebral ischaemia. In situ zymography indicated that the gelatinolytic activity of the MMPs was increased in IRF8-deficient mice following ischaemic brain injury (Fig. 5e). IRF8 deficiency was also associated with an increase in MMP-2 and MMP-9 mRNA levels (Fig. 5f).

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

IRF8 protects against stroke

(a)

(b)

(c)

(d)

Fig. 4 Interferon regulatory factor 8 (IRF8) protected neurons from ischemic injury during cerebral ischaemia-reperfusion. (a) Fluoro-Jade B and TUNEL staining of brains at 24 h after ischaemia showed increased Fluoro-Jade B- and TUNEL-positive neurons in IRF8 KO mice and decreased Fluoro-Jade B- and TUNEL-positive neurons in IRF8 TG mice compared with their control littermates (*p < 0.05 vs. WT/nontransgenic (NTG), n = 5 for Fluoro-Jade B staining in each group, n = 4 for TUNEL staining in each group). (b) Immunofluorescence staining for cleaved caspase-3 in the brain sections showed increased cleaved caspase-3-positive neurons in IRF8 KO mice and decreased cleaved caspase-3-positive neurons in IRF8 TG mice (*p < 0.05 vs. WT/NTG, n = 4 for WT, n = 3 for IRF8-KO, n = 4 for NTG, n = 3 for IRF8-TG). (c and d) Immunofluorescence staining of anti-apoptotic Bcl-2 and BDNF was merged with the neuronal marker NeuN; the lower panels show that the Bcl-2 and BDNF protein levels were decreased in IRF8 KO mice and increased in IRF8 TG mice compared with control littermates (*p < 0.05 vs. WT/NTG, n = 4 for WT, IRF8 KO, NTG, n = 3 for IRF8 TG). (e) Immunoblotting for pro-apoptotic Bax, cleaved caspase-3 and cleaved

995

caspase-9 and anti-apoptotic Bcl2 and BDNF in brain homogenates from IRF8 KO mice and WT mice 6 h after ischaemia. GAPDH served as a loading control in each lane. The panels show the quantification of the indicated protein levels in sham-operated or transient middle cerebral artery occlusion (tMCAO)-treated mice. The pro-apoptotic proteins were increased, whereas anti-apoptotic proteins were decreased in the IRF8 KO mice (*p < 0.05 vs. WT, #p < 0.05 vs. sham, n = 6 for each group). (f) The pro-apoptotic proteins were decreased, whereas anti-apoptotic proteins were increased in the IRF8 TG mice (*p < 0.05 vs. NTG, #p < 0.05 vs. sham, n = 6 for each group). (g) Immunoblotting of proapoptotic cleaved caspase-3 and anti-apoptotic Bcl2 in cell homogenates from AdshRNA, AdshIRF8, AdIRF8 and AdGFP infected neurons at 0, 6, 12 and 24 h following oxygen and glucose deprivation (OGD). Bcl2 protein levels were decreased, whereas cleaved caspase-3 protein levels were increased in AdshIRF8 infected neurons at each time point, opposite tendency was found in AdIRF8 infected neurons (*p < 0.05 vs. AdshRNA /AdGFP infection group, #p < 0.05 vs. Control, n = 6 for each group).

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

996

M. Xiang et al.

(e)

(f)

(g)

Fig. 4 Continued

Oxidative injury was increased in IRF8 deficient mice Oxidative stress is an important pathological mechanism for cerebral ischaemic injury. Thus, we examined oxidative biomarkers, anti-oxidative and pro-oxidative gene expression in vivo. Oxidative injury was estimated based on immunofluorescence staining for 8OHdG, a biomarker of oxidative DNA damage, and 4HNE, a stable product of lipid perox-

idation (Imai et al. 2001; Kawai et al. 2011). 8OHdG- and 4HNE-positive cells were significantly increased by approximately 2.3- and 2.5-fold, respectively, in IRF8-deficient mice compared with WT mice. Nrf2 is an antioxidative transcription factor (Wang et al. 2011). HO-1 is a target gene of Nrf2 and plays a antioxidative role in cerebral ischaemic injury (Kweon et al. 2006). Immunofluorescence staining

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

IRF8 protects against stroke

(b)

(a)

Fig. 5 The inflammatory response was aggravated in interferon regulatory factor 8 (IRF8) KO mice after ischaemia-reperfusion injury. (a and b) Immunofluorescence staining showed that the recruitment of neutrophils (7/ 4 positive cells) and macrophages/microglia (F4/80 positive cells) in the peri-infarct area at 72 h after ischaemia was significantly increased in IRF8 KO mice compared with WT mice (*p < 0.05 vs. WT, n = 4 for WT, n = 3 for IRF8-KO). (c) Quantitative real-time PCR showed that the mRNA levels of IL-1b, IL-2, IL-6, iNOS, MCP-1, CD36, TNFa, VCAM-1, ICAM-1, COX-2 and F4/80 in brain homogenates from IRF8 KO mice were significantly increased in IRF8 mice 6 h after ischaemia (*p < 0.05 vs. WT, n = 3 for each group). (d) IRF8 deficiency led to the increased activity of the NF-jB signalling pathway 6 h after ischaemia. Immunoblotting showed that the phosphorylation of IKKb, IjBa and NF-jB p65 was up-regulated in IRF8 KO mice compared with WT mice (*p < 0.05 vs. WT and #p < 0.05 vs. sham, n = 4 for each group). The total protein levels of IKKb, IjBa and NF-jB p65 did not change in IRF8 KO or WT mice. GAPDH served as a loading control in each lane. (e) The gelatinolytic activity of MMPs, as detected by in situ zymography at 24 h after ischaemic onset, was increased inIRF8 KO mice (*p < 0.05 vs. WT, n = 3 for each group). (f) Quantitative real-time PCR showed that the MMP-2 and MMP-9 mRNA levels increased 24 h after ischaemic onset in IRF8 KO mice compared with WT mice (*p < 0.05 vs. WT, n = 3 for each group).

997

(c)

(d)

(e)

showed a remarkable suppression of Nrf2 and HO-1 expression in IRF8-deficient mice compared with WT controls (Figure 6a). We further examined the mRNA levels of anti-oxidative genes (Nrf2, HO-1, SOD1, SOD2, SOD3, GPX and Txn-1) and pro-oxidative genes (p67-phox and gp91-phox) and found that the anti-oxidative genes were inhibited, whereas the pro-oxidative genes were up-regulated, in IRF8-deficient mice (Fig. 6b). Western blot analysis showed a similar pattern in the SOD1, SOD2 and SOD3 protein levels (Fig. 6c). Thus, IRF8 deficiency led to significantly increased oxidative injury after cerebral ischaemia-reperfusion.

(f)

Transcriptional regulation of Bax, Bcl-2 and SOD-1 by IRF8 To investigate whether the expression of some apoptosis relative genes and oxidative genes were attributable to IRF8-dependent transcriptional regulation, we examined Bax, Bcl-2 and SOD-1 promoter activity in cultured primary neurons. Neurons were transfected with an IRF8 vector or an empty vector following OGD/reperfusion. Over-expression of IRF8 reduced Bax promoter luciferase activity to 19.5% of the control, whereas increased Bcl-2 and SOD1 activity by 2.8 and 2.9 folds (see Supporting Information). To further confirm this finding, we mutated the core IRF binding sites in the Bax, Bcl-2 and SOD1

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

998

M. Xiang et al.

(a)

Fig. 6 Oxidative injury was increased in the interferon regulatory factor 8 (IRF8) KO mice. (a) Immunofluorescence staining showed that the numbers of both 8OHdGpositive cells and 4HNE-positive cells in the peri-infarct area were significantly increased, whereas Ntf2- and HO-1positive cells were significantly decreased in IRF8 KO mice compared with WT mice (*p < 0.05 vs. WT, n = 5 for WT, n = 4 for IRF8-KO). (b) Quantitative real-time PCR revealed the mRNA levels of the antioxidative genes Nrf2, HO-1, SOD1, SOD2, SOD3, GPX and Txn-1 and of the prooxidative genes p67-phox and gp91-phox 24 h after ischaemic onset. All the antioxidative genes were inhibited, whereas the pro-oxidative genes were up-regulated in IRF8 KO mice compared with WT mice (*p < 0.05 vs. WT, n = 3 for each group). (c) Immunoblotting showed the protein levels of SOD1, SOD2 and SOD3 were significantly down-regulated in IRF8 KO mice (*p < 0.05 vs. WT, #p < 0.05 vs. sham, n = 6 for each group).

(b)

(c)

promoter, and constructed the corresponding mutant vectors respectively. Over-expression of IRF8 had no effect on the promoter luciferase activity of mutant Bax, Bcl-2 and SOD1 (see Supporting Information). This finding suggested that IRF8 could directly regulate the transcription of Bax, Bcl-2 and SOD1.

Discussion In this study, we found the following results: (i) IRF8 was constitutively expressed in the brain and was detected both in neurons in the brain and in primary cultured neuronal cells in vitro. Additionally, ischaemia-reperfusion and OGD led to

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

IRF8 protects against stroke

a significant decrease in IRF8 expression in the brain and in cultured neurons. (ii) IRF8 KO mice showed poorer stroke outcomes, including larger infarct volumes and higher neurological deficit scores, whereas neuron-specific IRF8 TG mice showed considerably improved stroke outcomes. (iii) IRF8 deficiency exacerbated ischaemia-induced neuronal apoptosis in the ischaemic brain or in OGD-challenged cultured neurons, whereas a neuron-specific transgene overexpressing IRF8 effectively protected neurons from ischaemia- or OGD-induced apoptosis. (iv) Finally, the systemic knockout of IRF8 led to aggravated inflammation and oxidative stress in the ischaemic brain. Although previous studies have shown that IRF8 is expressed in a limited number of cell types, such as lymphoid cells, myeloid cells, some tumour cells and microglia (Weisz et al. 1992; Holtschke et al. 1996; Yang et al. 2007a,b, 2009; Hu et al. 2011; Horiuchi et al. 2012; Masuda et al. 2012), in the present study, we showed that IRF8 was constitutively expressed in the brain, especially in neurons. IRF8 expression was confirmed by both western blot analysis and double immunofluorescence techniques. However, this finding was inconsistent with a previous study in the spinal cord which reported that IRF8 expression was normally low and could be induced in microglia but not in neurons (Masuda et al. 2012). This inconsistency can probably be attributed to the intrinsic differences between brain and spinal cord in gene expression patterns in physiological conditions and in response to various injuries (Schnell et al. 1999; Campbell et al. 2002). We further investigated changes in IRF8 expression after cerebral ischaemia-reperfusion injury. Western blot analysis and immunofluorescence showed that IRF8 expression was significantly reduced after ischaemia-reperfusion or OGD challenge in the brain and cultured neurons in a timedependent manner. This dramatic change in IRF8 expression strongly suggested that IRF8 plays a critical role in the pathological process of cerebral ischaemia-reperfusion, especially in determining the fate of neurons. Apoptosis is one of the fundamental mechanisms of cell death that occurs during ischaemic brain injury and is an important determinant of stroke outcomes (Broughton et al. 2009; Brouns and De Deyn 2009). Neuronal apoptosis begins few minutes after ischaemic onset and can last for several days. The mitochondrial pathway is involved in the neuronal apoptosis after cerebral ischaemia, especially Bcl-2 family proteins that govern mitochondrial outer membrane permeabilisation and the death receptor-mediated pathway triggered by the binding of Fas ligand and Fas death receptors (Sugawara et al. 2004). These two major ischaemic cell death signalling pathways eventually led to the activation of caspase-3, the common apoptosis executor. Recent studies have shown that IRF8 is involved in both the mitochondrial pathway and the death receptor-mediated pathway in sarcoma cells, primary myeloid cells, myeloid

999

leukaemia cells and mammary carcinoma cells by the transcriptional regulation of Fas, Bax, FLIP and acid ceramidase (A-CDase) (Yang et al. 2007a,b, 2009; Hu et al. 2011). In the present study, both TUNEL and cleaved caspase-3 staining demonstrated that the knockout of IRF8 significantly increased apoptosis in the ischaemic brain and OGD-challenged cultured neurons, whereas over-expression of IRF8 by transgenic technology in neurons markedly reduced apoptosis. This finding contrasts with what has been found in myeloid cells and tumour cells in which IRF8 is a pro-apoptotic modulator. We further examined the apoptosis signalling cascade and found that in the ischaemic brain, the anti-apoptotic protein Bcl-2 was reduced in IRF8 KO mice and increased in IRF8 TG mice, whereas the pro-apoptotic protein Bax and cleaved caspase-9 and 3 were up-regulated in IRF8 KO mice and down-regulated in IRF8 TG mice. A similar pattern of Bcl-2 and cleaved caspase-3 expression was found in cultured neurons. Additionally, the nerve growth factor BDNF, which plays an important role in neuroprotection in the ischaemic brain, was inhibited following ischaemia in IRF8 KO mice and up-regulated in IRF8 TG mice. To determine whether the expression of some apoptosis relative genes were attributable to IRF8-dependent transcriptional regulation, we examined Bax and Bcl-2 promoter activity in cultured primary neurons. Dual luciferase-reporter assay showed IRF8 reduced Bax promoter luciferase activity and increased Bcl-2 promoter luciferase activity. These findings clearly demonstrate that IRF8 plays an anti-apoptotic role in neurons after cerebral ischaemic injury. Inflammation is an important pathological process in ischaemic stroke, especially during the acute phase (Candelario-Jalil 2009; Lakhan et al. 2009). In the present study, we found that in IRF8 KO mice, the inflammatory response after cerebral ischaemia was markedly aggravated. Inflammatory cell recruitment and inflammatory markers were significantly up-regulated in IRF8 knockout mice compared with WT controls. The NF-jB signalling pathway, a key player in the inflammatory response, was also activated in the ischaemic brain of IRF8 knockout mice. IRF8 has been reported to govern the expression of genes involved in innate and adaptive immunity and to play a negative regulatory role in the cells of the immune system. Recent studies have also indicated that IRF8 may influence some phenotypes of microglia, such as proliferation, cytokine expression and phagocytic capacity; however, no study has investigated the role of IRF8 in inflammation in the ischaemic brain. Our data revealed, for the first time, that IRF8 plays a critical role in the regulation of post-ischaemic inflammation in the brain, which has a major impact on stroke outcomes. There is accumulating evidence that the oxidative stress associated with excessive production of reactive oxygen species has a profound effect on ischaemic stroke pathogenesis (Allen and Bayraktutan 2009; Brouns and De Deyn 2009). Reactive oxygen species not only has direct effects on protein

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

1000

M. Xiang et al.

denaturation and DNA damage but also plays a role in various biological processes, including apoptosis and inflammation, by acting on several signal transduction pathways (Allen and Bayraktutan 2009). In the present study, biomarkers of oxidative damage (8OHdG and 4HNE) were markedly increased in the ischaemic brains of IRF8 KO mice, which suggested that oxidative damage was aggravated by IRF8 deficiency. The severity of oxidative stress depends on the balance between antioxidants and pro-oxidants. We estimated the expression of the antioxidant genes Nrf2, HO-1, SOD1, SOD2, SOD3, GPX and Txn-1 and pro-oxidant genes p67-phox and gp91phox. All the antioxidant genes were suppressed, whereas all the pro-oxidant genes were upregulated in IRF8 knockout mice compared with WT mice. Furthermore, dual luciferase-reporter assay indicated that IRF8 directly regulated the promoter activity of SOD1. These findings demonstrated that IRF8 played a critical role in oxidative stress in cerebral ischaemia-reperfusion injury by regulating the expression of pro-oxidant and antioxidant genes. In conclusion, we identified IRF8 as a strongly protective modulator of ischaemic stroke that regulates neuronal apoptosis, inflammatory responses and oxidative stress. This investigation implicates IRF8 as a novel therapeutic target for ischaemic stroke. Further studies are needed to explore the intrinsic mechanisms through which IRF8 influences the various pathological processes of ischaemic stroke.

Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (NO. 81100230, NO. 81070089, and NO. 81200071), National Science and Technology Support Project (NO. 2011BAI15B02, NO. 2012BAI39B05, NO. 2013YQ03092305 and 2014BAI02B01), and the National Basic Research Program of China (NO. 2011CB503902), and the Key Project of the National Natural Science Foundation (No. 81330005). All experiments were conducted in compliance with the ARRIVE guidelines. The authors have no conflict of interest to declare.

Supporting information Additional supporting information may be found in the online version of this article at the publisher's web-site: Data S1. Supplementary methods. Table S1. Physiological variables of WT mice, IRF8 KO mice, NTG mice and IRF8 TG mice. Figure S1. Generation of neuron-specific IRF8 transgenic mice. Figure S2. IRF8-dependent transcriptional regulation of Bax, Bcl-2 and SOD-1.

References Allen C. L. and Bayraktutan U. (2009) Oxidative stress and its role in the pathogenesis of ischaemic stroke. Int. J. Stroke 4, 461–470.

Baldwin K., Orr S., Briand M., Piazza C., Veydt A. and McCoy S. (2010) Acute ischemic stroke update. Pharmacotherapy 30, 493–514. Bronner L. L., Kanter D. S. and Manson J. E. (1995) Primary prevention of stroke. N. Engl. J. Med. 333, 1392–1400. Broughton B. R., Reutens D. C. and Sobey C. G. (2009) Apoptotic mechanisms after cerebral ischemia. Stroke 40, e331–e339. Brouns R. and De Deyn P. P. (2009) The complexity of neurobiological processes in acute ischemic stroke. Clin. Neurol. Neurosurg. 111, 483–495. Burchert A., Cai D., Hofbauer L. C. et al. (2004) Interferon consensus sequence binding protein (ICSBP; IRF-8) antagonizes BCR/ABL and down-regulates bcl-2. Blood 103, 3480–3489. Campbell S. J., Wilcockson D. C., Butchart A. G., Perry V. H. and Anthony D. C. (2002) Altered chemokine expression in the spinal cord and brain contributes to differential interleukin-1beta-induced neutrophil recruitment. J. Neurochem. 83, 432–441. Candelario-Jalil E. (2009) Injury and repair mechanisms in ischemic stroke: considerations for the development of novel neurotherapeutics. Curr. Opin. Investig. Drugs 10, 644–654. Chrabot B. S., Kariuki S. N., Zervou M. I., Feng X., Arrington J., Jolly M., Boumpas D. T., Reder A. T., Goulielmos G. N. and Niewold T. B. (2013) Genetic variation near IRF8 is associated with serologic and cytokine profiles in systemic lupus erythematosus and multiple sclerosis. Genes Immun. 14, 471–478. De Jager P. L., Jia X., Wang J. et al. (2009) Meta-analysis of genome scans and replication identify CD6, IRF8 and TNFRSF1A as new multiple sclerosis susceptibility loci. Nat. Genet. 41, 776–782. Doyle K. P., Simon R. P. and Stenzel-Poore M. P. (2008) Mechanisms of ischemic brain damage. Neuropharmacology 55, 310–318. Dragatsis I. and Zeitlin S. (2000) CaMKIIalpha-Cre transgene expression and recombination patterns in the mouse brain. Genesis 26, 133–135. Driggers P. H., Ennist D. L., Gleason S. L., Mak W. H., Marks M. S., Levi B. Z., Flanagan J. R., Appella E. and Ozato K. (1990) An interferon gamma-regulated protein that binds the interferoninducible enhancer element of major histocompatibility complex class I genes. Proc. Natl Acad. Sci. USA 87, 3743–3747. Holtschke T., L€ohler J., Kanno Y. et al. (1996) Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene. Cell 87, 307–317. Horiuchi M., Wakayama K., Itoh A., Kawai K., Pleasure D., Ozato K. and Itoh T. (2012) Interferon regulatory factor 8/interferon consensus sequence binding protein is a critical transcription factor for the physiological phenotype of microglia. J. Neuroinflammation 9, 227. Hu X., Yang D., Zimmerman M. et al. (2011) IRF8 regulates acid ceramidase expression to mediate apoptosis and suppresses myelogeneous leukemia. Cancer Res. 71, 2882–2891. Imai H., Masayasu H., Dewar D., Graham D. I. and Macrae I. M. (2001) Ebselen protects both gray and white matter in a rodent model of focal cerebral ischemia. Stroke 32, 2149–2154. Jiang D. S., Bian Z. Y., Zhang Y. et al. (2013) Role of interferon regulatory factor 4 in the regulation of pathological cardiac hypertrophy. Hypertension 61, 1193–1202. Kawai H., Deguchi S., Deguchi K. et al. (2011) Synergistic benefit of combined amlodipine plus atorvastatin on neuronal damage after stroke in Zucker metabolic rat. Brain Res. 1368, 317–323. Kelly P. T. and Vernon P. (1985) Changes in the subcellular distribution of calmodulin-kinase II during brain development. Brain Res. 350, 211–224. Kurotaki D., Osato N., Nishiyama A. et al. (2013) Essential role of the IRF8-KLF4 transcription factor cascade in murine monocyte differentiation. Blood 121, 1839–1849.

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001

IRF8 protects against stroke

Kweon M. H., Adhami V. M., Lee J. S. and Mukhtar H. (2006) Constitutive overexpression of Nrf2-dependent heme oxygenase-1 in A549 cells contributes to resistance to apoptosis induced by epigallocatechin 3-gallate. J. Biol. Chem. 281, 33761–33772. Lakhan S. E., Kirchgessner A. and Hofer M. (2009) Inflammatory mechanisms in ischemic stroke: therapeutic approaches. J. Transl. Med. 7, 97. Lu J., Bian Z. Y., Zhang R. et al. (2013a) Interferon regulatory factor 3 is a negative regulator of pathological cardiac hypertrophy. Basic Res. Cardiol. 108, 326. Lu Y. Y., Li Z. Z., Jiang D. S. et al. (2013b) TRAF1 is a critical regulator of cerebral ischaemia-reperfusion injury and neuronal death. Nat. Commun. 4, 2852. Marecki S., Atchison M. L. and Fenton M. J. (1999) Differential expression and distinct functions of IFN regulatory factor 4 and IFN consensus sequence binding protein in macrophages. J. Immunol. 163, 2713–2722. Masuda T., Tsuda M., Yoshinaga R., Tozaki-Saitoh H., Ozato K., Tamura T. and Inoue K. (2012) IRF8 is a critical transcription factor for transforming microglia into a reactive phenotype. Cell Rep. 1, 334–340. Murray V., Norrving B., Sandercock P. A., Terent A., Wardlaw J. M. and Wester P. (2010) The molecular basis of thrombolysis and its clinical application in stroke. J. Intern. Med. 267, 191–208. Park T. J., Kim H. J., Kim J. H., Bae J. S., Cheong H. S., Park B. L. and Shin H. D. (2013) Associations of CD6, TNFRSF1A and IRF8 polymorphisms with risk of inflammatory demyelinating diseases. Neuropathol. Appl. Neurobiol. 39, 519–530. Paun A. and Pitha P. M. (2007) The IRF family, revisited. Biochimie 89, 744–753. Schnell L., Fearn S., Klassen H., Schwab M. E. and Perry V. H. (1999) Acute inflammatory responses to mechanical lesions in the CNS: differences between brain and spinal cord. Eur. J. Neurosci. 11, 3648–3658. Sugawara T., Fujimura M., Noshita N., Kim G. W., Saito A., Hayashi T., Narasimhan P., Maier C. M. and Chan P. H. (2004) Neuronal death/survival signaling pathways in cerebral ischemia. NeuroRx 1, 17–25. Tailor P., Tamura T. and Ozato K. (2006) IRF family proteins and type I interferon induction in dendritic cells. Cell Res. 16, 134–140. Tamura T. and Ozato K. (2002) ICSBP/IRF-8: its regulatory roles in the development of myeloid cells. J. Interferon Cytokine Res. 22, 145–152. Tamura T., Yanai H., Savitsky D. and Taniguchi T. (2008) The IRF family transcription factors in immunity and oncogenesis. Annu. Rev. Immunol. 26, 535–584.

1001

Tu J. V. (2010) Reducing the global burden of stroke: INTERSTROKE. Lancet 376, 74–75. Wang B., Cao W., Biswal S. and Dore S. (2011) Carbon monoxideactivated Nrf2 pathway leads to protection against permanent focal cerebral ischemia. Stroke 42, 2605–2610. Wang L., Lu Y., Deng S., Zhang Y., Yang L., Guan Y., Matozaki T., Ohnishi H., Jiang H. and Li H. (2012a) SHPS-1 deficiency induces robust neuroprotection against experimental stroke by attenuating oxidative stress. J. Neurochem. 122, 834–843. Wang L., Deng S., Lu Y., Zhang Y., Yang L., Guan Y., Jiang H. and Li H. (2012b) Increased inflammation and brain injury after transient focal cerebral ischemia in activating transcription factor 3 knockout mice. Neuroscience 220, 100–108. Wang L., Lu Y., Guan H. et al. (2013a) Tumor necrosis factor receptorassociated factor 5 is an essential mediator of ischemic brain infarction. J. Neurochem. 126, 400–414. Wang L., Lu Y., Zhang X. et al. (2013b) Mindin is a critical mediator of ischemic brain injury in an experimental stroke model. Exp. Neurol. 247, 506–516. Wang X. A., Zhang R., Jiang D. et al. (2013c) Interferon regulatory factor 9 protects against hepatic insulin resistance and steatosis in male mice. Hepatology 58, 603–616. Weisz A., Marx P., Sharf R., Appella E., Driggers P. H., Ozato K. and Levi B. Z. (1992) Human interferon consensus sequence binding protein is a negative regulator of enhancer elements common to interferon-inducible genes. J. Biol. Chem. 267, 25589–25596. Xia C. F., Smith R. S., Jr, Shen B., Yang Z. R., Borlongan C. V., Chao L. and Chao J. (2006) Postischemic brain injury is exacerbated in mice lacking the kinin B2 receptor. Hypertension 47, 752–761. Yang D., Thangaraju M., Greeneltch K., Browning D. D., Schoenlein P. V., Tamura T., Ozato K., Ganapathy V., Abrams S. I. and Liu K. (2007a) Repression of IFN regulatory factor 8 by DNA methylation is a molecular determinant of apoptotic resistance and metastatic phenotype in metastatic tumor cells. Cancer Res. 67, 3301–3309. Yang D., Thangaraju M., Browning D. D., Dong Z., Korchin B., Lev D. C., Ganapathy V. and Liu K. (2007b) IFN regulatory factor 8 mediates apoptosis in nonhemopoietic tumor cells via regulation of Fas expression. J. Immunol. 179, 4775–4782. Yang D., Wang S., Brooks C. et al. (2009) IFN regulatory factor 8 sensitizes soft tissue sarcoma cells to death receptor-initiated apoptosis via repression of FLICE-like protein expression. Cancer Res. 69, 1080–1088. Yi J. H., Park S. W., Kapadia R. and Vemuganti R. (2007) Role of transcription factors in mediating post-ischemic cerebral inflammation and brain damage. Neurochem. Int. 50, 1014–1027.

© 2014 International Society for Neurochemistry, J. Neurochem. (2014) 129, 988--1001