crossmark

Interleukin-8, CXCL1, and MicroRNA miR-146a Responses to Probiotic Escherichia coli Nissle 1917 and Enteropathogenic E. coli in Human Intestinal Epithelial T84 and Monocytic THP-1 Cells after Apical or Basolateral Infection ¨ lschläger,b Ulrich Sonnenborn,c M. Alexander Schmidta Harshana Sabharwal,a Christoph Cichon,a Tobias A. O Institut für Infektiologie, Zentrum für Molekularbiologie der Entzündung (ZMBE), Westfälische Wilhelms-Universität Münster, Münster, Germanya; Institut für Molekulare Infektionsbiologie, Julius-Maximilians-Universität Würzburg, Würzburg, Germanyb; Ardeypharm GmbH, Herdecke, Germanyc

Bacterium-host interactions in the gut proceed via directly contacted epithelial cells, the host’s immune system, and a plethora of bacterial factors. Here we characterized and compared exemplary cytokine and microRNA (miRNA) responses of human epithelial and THP-1 cells toward the prototype enteropathogenic Escherichia coli (EPEC) strain E2348/69 (O127:H6) and the probiotic strain Escherichia coli Nissle 1917 (EcN) (O6:K5:H1). Human T84 and THP-1 cells were used as cell culture-based model systems for epithelial and monocytic cells. Polarized T84 monolayers were infected apically or basolaterally. Bacterial challenges from the basolateral side resulted in more pronounced cytokine and miRNA responses than those observed for apical side infections. Interestingly, the probiotic EcN also caused a pronounced transcriptional increase of proinflammatory CXCL1 and interleukin-8 (IL-8) levels when human T84 epithelial cells were infected from the basolateral side. miR-146a, which is known to regulate adaptor molecules in Toll-like receptor (TLR)/NF-␬B signaling, was found to be differentially regulated in THP-1 cells between probiotic and pathogenic bacteria. To assess the roles of flagella and flagellin, we employed several flagellin mutants of EcN. EcN flagellin mutants induced reduced IL-8 as well as CXCL1 responses in T84 cells, suggesting that flagellin is an inducer of this cytokine response. Following infection with an EPEC type 3 secretion system (T3SS) mutant, we observed increased IL-8 and CXCL1 transcription in T84 and THP-1 cells compared to that in wild-type EPEC. This study emphasizes the differential induction of miR-146a by pathogenic and probiotic E. coli strains in epithelial and immune cells as well as a loss of probiotic properties in EcN interacting with cells from the basolateral side.

T

he gastrointestinal tract (GIT) is home to abundant and complex bacterial communities that contribute to various immune and metabolic functions in the host (1). For protection against intruding pathogens, immune responses are activated by the pathogen-associated molecular pattern (PAMP) pathway via membrane-associated Toll-like receptors (TLRs), resulting in the stimulation of NF-␬B signaling. The NF-␬B pathway is central to the immune response and controls the transcription of various proinflammatory cytokines, including interleukin-8 (IL-8) and a variety of microRNAs (miRNAs). Intestinal epithelial cells (IEC) mount an appropriate immune response to pathogenic microbes and at the same time need to avoid damage to resident commensal bacteria. However, how this complex task is orchestrated is still only poorly understood (2–4). At the GIT interface, members of the microbiota and their human host are in constant communication with each other. This multilogue/“on-site conference” is mediated by various molecular signals, and its disruption is detrimental for both the bacterium and the host. Hence, these pathways are regulated at many different levels involving various participating regulatory molecules (5, 6). miRNAs are 19- to 24-nucleotide (nt) small RNAs acting as posttranscriptional regulators of gene expression by controlling and fine-tuning many signaling pathways, such as the TLR pathway (7, 8). Although the role of miRNAs in infection was initially investigated in the realm of viral and parasitic infections, a role for miRNAs in bacterial infections has also been demonstrated (9, 10). In the context of inflammatory bowel diseases (IBD), such as

2482

iai.asm.org

ulcerative colitis or Crohn’s disease, the complexity of the signaling interplay increases even further as inflammatory immune reactions are triggered and perpetuated, involving, e.g., a network of chemoattractant cytokines (chemokines) (11–13) and miRNA signatures (14–16). In particular, the miRNAs miR-146a, miR-155, and miR-21 have emerged as major players in modulating TLR signaling (17). With their strong association with bacterial infections, miR-146a, miR-155, and miR-21 might be involved in differential regulation under different infection conditions. They are coordinately induced in response to Helicobacter pylori, Salmonella enterica, Listeria monocytogenes, and Mycobacterium infections. The present study focuses on miR-146a, as it displays the largest fold changes under different infection conditions. Further, miR-146a is known to target important players of the MyD88 signaling pathway, such

Received 11 May 2016 Returned for modification 1 June 2016 Accepted 9 June 2016 Accepted manuscript posted online 13 June 2016 Citation Sabharwal H, Cichon C, O¨lschläger TA, Sonnenborn U, Schmidt MA. 2016. Interleukin-8, CXCL1, and microRNA miR-146a responses to probiotic Escherichia coli Nissle 1917 and enteropathogenic E. coli in human intestinal epithelial T84 and monocytic THP-1 cells after apical or basolateral infection. Infect Immun 84:2482–2492. doi:10.1128/IAI.00402-16. Editor: A. J. Bäumler, University of California, Davis Address correspondence to M. Alexander Schmidt, [email protected]. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Infection and Immunity

September 2016 Volume 84 Number 9

Apical/Basolateral Cytokine/miRNA Responses to E. coli

as TRAF6 and IRAK1. Several reports also suggest that miR-146a is critical for developing endotoxin tolerance in vitro in cultured monocytes (18). Knockout mice lacking miR-146a are hyperresponsive to lipopolysaccharide (LPS) (19). In addition, these mice demonstrate heightened proinflammatory responses to endotoxin challenge and demonstrate deregulation of NF-␬B signaling (20). Probiotics are defined as live microorganisms that confer a health benefit to the host when administered in adequate quantities (21). They include bacteria from different genera and species which exert beneficial effects at the intestinal mucosa. These effects include, e.g., outcompeting incoming pathogens, improvement of barrier functions, and/or alteration of the immune activities of the host (22). Some probiotics possess immunomodulatory activities, as they stimulate innate immunity and initiate adaptive immunity in the direction of tolerance responses (23). Escherichia coli Nissle 1917 (EcN), the most commonly used Gram-negative probiotic, was isolated in 1917 by the physician and bacteriologist Alfred Nissle from the feces of a World War I soldier who, in contrast to his fellows, did not come down with infectious diarrhea during a Shigella outbreak. The probiotic effects of the EcN strain—which now has a recognized GRAS (generally recognized as safe) status— have been demonstrated in numerous clinical trials, which also showed the strain to be a therapeutically effective drug (24). Since its discovery, EcN has been used as a microbial remedy for enteric diseases in Central Europe, and it has been characterized intensively over the last 2 decades (e.g., see references 24 to 29). In addition, there are numerous clinical studies showing that EcN is as effective at keeping IBD patients in remission as the standard drug mesalazine, but without known side effects (e.g., see references 24 and 30 to 32). Enteropathogenic E. coli (EPEC) is known to cause significant morbidity and mortality in infants in developing countries (33, 34). EPEC and other related pathogens, such as enterohemorrhagic E. coli (EHEC), the mouse pathogen Citrobacter rodentium, rabbit enteropathogenic E. coli (REPEC), and Escherichia albertii, constitute a group known as attaching and effacing (A/E) pathogens, as upon infection these pathogens attach to intestinal cells and damage cellular microvilli (35, 36). This destruction of the microvilli reduces the ability of the cells to absorb water and nutrients, which ultimately leads to diarrhea. Like many other enteric pathogens, A/E pathogens utilize a syringe-like type 3 secretion system (T3SS) to translocate effector proteins into host cells, which facilitates bacterial colonization, survival, and immune evasion in infected hosts (35, 37). In contrast to many Gram-negative pathogens, EcN does not encode a T3SS (38). This study investigates the differential host responses toward EPEC and the probiotic EcN. To characterize molecular and cellular interactions with distinct enteric E. coli strains, T84 and THP-1 cells were used as exemplary model systems for epithelial and monocytic cells. The prototypic pathogenic EPEC strain E2348/69 (O127:H6) and the probiotic EcN (O6:K5:H1) were contrasted as model organisms in this study. The differences in host responses in terms of cytokine and miRNA expression were explored for epithelial infections initiated from the apical and basolateral sides. As representative indicators, we chose CXCL1 and miR-146a, as both also play a role in intestinal inflammation (e.g., see references 11, 12, 15, and 16). In addition, bacterial factors triggering miRNA and cytokine responses were investigated.

September 2016 Volume 84 Number 9

MATERIALS AND METHODS Reagents, bacterial strains, and tissue culture. Tissue culture reagents and medium (Dulbecco’s modified Eagle’s medium [DMEM]/Ham’s F-12 medium and fetal calf serum [FCS]) were obtained from SigmaAldrich Chemie GmbH, Munich, Germany. E. coli Nissle 1917 (EcN) (O6:K5:H1) and enteropathogenic E. coli (EPEC) E2348/69 (O127:H6) were grown overnight at 37°C in lysogeny broth (LB) medium (Merck, Darmstadt, Germany). Bacterial strains were stored in medium with the addition of 10% glycerol at ⫺80°C (strain collection of the Institute of Infectiology, Zentrum für Molekularbiologie der Entzündung [ZMBE]). The generation of ⌬fliC and ⌬K5 EcN mutants has been described previously (38). The ⌬TLR5 EcN mutant, lacking the flagellin TLR5 binding domain, was generated as described previously (39). The ⌬espB (UMD864) and ⌬escN (cfm 14-2-1) EPEC mutants were a kind gift of M. Donnenberg (Baltimore, MD) (40, 41). T84 cells were grown in DMEM/Ham’s F-12 high-glucose medium supplemented with 5% FCS. THP-1 cells were cultured in RPMI 1640 medium supplemented with 10% FCS. Both cell lines were maintained at 37°C with 5% CO2 in a humid atmosphere. The cells were cultured in the respective medium in 75-cm2 cell culture flasks. Culture of T84 cells on a permeable membrane support. T84 cells were polarized by culture on permeable membrane supports (Thincerts cell culture inserts; Greiner Bio-One, Frickenhusen, Germany). The cells were polarized with the apical (luminal) and basolateral (abluminal) sides facing the upper and lower compartments, respectively, of the two-chambered filter support system. Before culture of the cells, the permeable membrane support filters were precooled for 1 h at ⫺20°C and coated with extracellular matrix (ECM) proteins (Harbor Bio-Products, Norwood, MA). The ECM stock solution was diluted in Dulbecco’s phosphate-buffered saline (D-PBS) (1:1,000) and added to cover the filters for 2 h at room temperature. The T84 cells were then seeded in the upper compartment of the filters, at a density of 106 cells/cm2 in 500 ␮l of medium. Five hundred microliters of medium was also added to the lower compartment. For basolateral infection, the filters were placed upside down and coated with ECM, followed by seeding with T84 cells as described above. After overnight incubation, the filters were flipped and placed in an upright orientation in 12-well plates. Medium was added to the upper and lower compartments of the filter devices. The medium was exchanged every 2 or 3 days, and the cells were cultured for 10 or 11 days, until the cell monolayer was fully polarized and displayed a stable transepithelial electrical resistance (TER). Infection of polarized epithelial T84 and monocytic THP-1 cells. For infection experiments, T84 and THP-1 cells were grown to a density of 106 cells/cm2 in 500 ␮l of medium in 12-well plates, with or without filter inserts for T84 cells. The medium was replaced every 2 days until the cells became confluent. For basolateral infection of polarized T84 cells, cells were grown on inverted filters and flipped back so that the infection was done from the upper chamber. For polarization, T84 cells were grown on this permeable membrane support for a 10- to 11-day period. Overnight bacterial cultures were diluted 1:100 and incubated at 37°C until they reached an optical density at 600 nm (OD600) of 1. Bacteria were added to cells at a multiplicity of infection (MOI) of 10 and incubated for different time points. RNA isolation and qRT-PCR. Preparation of cellular RNA from cells was performed using an miRNeasy minikit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. T84 and THP-1 cells were cultured in 12-well plates to a confluence of 106 cells. After infection with bacteria, the cells were lysed with 700 ␮l QIAzol lysis reagent per well. Purification was based on guanidine-isothiocyanate lysis followed by silica membrane purification. An miScript reverse transcription (RT) kit (Qiagen) was employed according to the manufacturer’s instructions to reverse transcribe miRNA and mRNA into cDNA in a single step. The cDNA obtained by the reverse transcriptase reaction was used as the template for quantitative RT-PCR (qRT-PCR), which was performed using a Light Cycler 480 machine (Roche Diagnostics GmbH, Mannheim, Ger-

Infection and Immunity

iai.asm.org

2483

Sabharwal et al.

TABLE 1 Sequences of primers used for qRT-PCR Oligonucleotide

Sequence (5=–3=)

GAPFP GAPRP TRAF6FP TRAF6RP CXCL1FP CXCL1RP IL8FP IL8RP Hs_RNU6-2 Hs_miR-21-2 Hs_miR-146A_1 Hs_miR-155_2

GGTCGTATTGGGCGCCTGGTCACC CACACCCATGACGAACATGGGGGC CCTTTGGCAAATGTCATCTGTG CTCTGCATCTTTTCATGGCAAC GCTGAACAGTGACAAATCCAAC CTTCAGGAACAGCCACCAGT GAGCACTCCATAAGGCACAAA ATGGTTCCTTCCGGTGGT GCCCCTGCGCAAGGATGAC UAGCUUAUCAGACUGAUGUUGA UGAGAACUGAAUUCCAUGGGUU UUAAUGCUAAUCGUGUAGGGGU

many). Prior to amplification, the cDNA was diluted 1:10. Primer pairs were designed with the Universal Probe Library Assay Design Center (Roche, Mannheim, Germany) and synthesized by Eurofins MWG Operon (Ebersberg, Germany). The miRNA primers were purchased from Qiagen. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 snRNA genes were used as reference (housekeeping) genes for mRNA and miRNA, respectively. The oligonucleotide sequences used as primers are summarized in Table 1. The data were analyzed by relative quantification using the ⌬Cq or ⌬CT method. Flagellin isolation. To isolate flagellin from EcN, 250 ml of LB medium was transferred to an Erlenmeyer flask (500 ml) and inoculated with 2 ml of fresh overnight culture of EcN (streaked from a single colony and incubated overnight as a static culture at 37°C). Bacteria and debris were removed by centrifugation at 3,452 ⫻ g (4,000 rpm) for 20 min at 4°C (Heraeus Multifuge X3R centrifuge). The supernatant was removed and stored in a Falcon tube at 4°C, and the pellet was resuspended in sterile PBS with a proteinase inhibitor (1 mM phenylmethylsulfonyl fluoride [PMSF]). The suspension was transferred to a 15-ml Falcon tube, mixed for 20 min, and then centrifuged for 30 min at 3,452 ⫻ g at 4°C. After centrifugation, the supernatant was transferred by sterile filtration into a fresh 15-ml Falcon tube and stored at ⫺20°C. An aliquot of the supernatant was loaded onto a 12% SDS gel to confirm the presence of flagellin. Blocking of TLR5 with anti-TLR5 antibodies. T84 cells at the basolateral side were treated with 5 ␮g/ml polyclonal anti-human TLR5 neutralizing antibody (InvivoGen, San Diego, CA) for 1 h prior to challenge with purified flagellin. Purified flagellin was obtained from wild-type EcN and an EcN mutant with flagella lacking the TLR5 binding site. The flagellin was added from the basolateral side at a concentration of 250 ng/ml for 4 h. The cells were subsequently lysed, and the RNA was isolated. Statistical analyses. All statistical analyses were performed using GraphPad Prism software, version 5.01. Comparison between two groups was conducted using the Student t test. P values of ⱕ0.05 were considered statistically significant.

RESULTS

Expression of inflammatory cytokines in polarized human epithelial T84 cells upon infection with EPEC strain E2348/69 and the probiotic EcN strain. In addition to serving as a physical barrier, the single-layered polarized intestinal epithelial cells (IEC) act as immune sensors for bacterial pathogens. The interaction of pathogenic bacteria with the intestinal epithelium induces a plethora of proinflammatory cytokines. IL-8 and CXCL1 are potent neutrophil attractants (42–44), which create a chemotactic gradient to attract neutrophils to the site of infection by binding to the extracellular matrix. CXCL1 is particularly highly induced, e.g., during Citrobacter rodentium infection, which is reminiscent of

2484

iai.asm.org

EPEC infections and therefore often used as a surrogate model (44). To investigate the effects of EPEC and EcN on polarized T84 cells, infections were performed at an MOI of 10 for 4 h, and changes in transcript levels were monitored by qRT-PCR. Particularly in inflamed tissues, where the integrity of the epithelial barrier can be compromised, or following transcytosis, e.g., via M cells, epithelial cells might also encounter bacteria from the basolateral side. To compare cellular responses, infections were carried out at either the basolateral or apical surface, and the expression levels of IL-8 and CXCL1 were monitored (Fig. 1). Interestingly, introducing bacteria from the basolateral side induced not only altered but also greatly enhanced IL-8 and CXCL1 transcript levels compared to those for apical infections. Basolateral EPEC infection induced about 20 times more IL-8 transcripts than those with apical infections, whereas the about 60-fold increase in CXCL1 transcription appeared to be largely unchanged. Moreover, apical incubation with EcN showed slightly reduced IL-8 transcription, while basolateral incubation increased IL-8 transcription, by a factor of 30. In contrast, apical incubation of T84 cells with EcN enhanced CXCL1 transcription about 30-fold, whereas basolateral incubation resulted in an even higher, nearly 200-fold increase in CXCL1 transcription. These results demonstrate that there is a more pronounced induction of IL-8 and CXCL1 responses to EPEC and EcN infections from the basolateral side of T84 cells. In general, CXCL1 was induced to a substantially higher fold change than that for IL-8. Hence, the expression profiles of the two cytokines are distinct and apparently independent of each other. Expression of miRNAs changes upon bacterial challenge. The miRNAs miR-146a, miR-155, and miR-21 are of substantial interest in innate immunity in relation to TLR and NF-␬B signaling (17). Therefore, we determined the induction of mature miR146a, miR-155, and miR-21 transcripts in the presence of EPEC and EcN in epithelial T84 and monocytic THP-1 cells by real-time PCR. As shown in Fig. 2, upon apical infection of T84 cells, miR146a expression was induced ⬃2- to 3-fold, compared to an ⬃4to 7-fold increase upon basolateral infection. However, this difference in expression was not significant. miR-155 and miR-21 displayed only relatively modest and comparable increases in expression following both apical and basolateral infections. In contrast, THP-1 cells showed a dramatic increase in miR-146a expression, with an ⬃40-fold increase upon EcN infection and a smaller increase (⬃20-fold) upon EPEC infection. Collectively, these results suggest that in polarized T84 cells, expression of the three analyzed miRNAs is moderately upregulated by apical infections with EPEC and EcN, whereas only miR-146a is affected following basolateral infections. THP-1 cells respond to the impact of E. coli with a substantial increase in miR-146a expression. Time course of cytokine and miR-146a expression in THP-1 cells. Due to bacterial overgrowth, the time course of cytokine and miR-146a induction could be determined only for a period of 6 h. To infer potential effects of miR-146a expression on its target genes, TRAF6 was also included in the analysis. The analysis of both IL-8 and CXCL1 revealed a rapid induction in response to incubation with both E. coli strains (Fig. 3). As previously shown following 4 h of incubation, miR-146a was already rapidly induced at 2 h postinfection, although at similar levels for both EPEC and EcN. The differences between the two E. coli strains became more apparent at 6 h postinfection (Fig. 3C). As before,

Infection and Immunity

September 2016 Volume 84 Number 9

Apical/Basolateral Cytokine/miRNA Responses to E. coli

FIG 1 Polarized T84 cells grown on transwell filters were infected from the apical (AP) and basolateral (BL) sides with EPEC and EcN at an MOI of 10 for 4 h. Control cells were left untreated. (A and B) Changes in IL-8 transcript levels on AP (A) and BL (B) infections. (C and D) Changes in CXCL1 transcript levels on AP (C) and BL (D) infections. The analysis was performed by quantitative real-time PCR. The data were normalized using GAPDH transcript levels. All results are presented as fold changes relative to the untreated control. The data were obtained from at least three independent experiments performed in duplicate. The error bars show the standard errors of the means (SEM). *, P ⬍ 0.05.

EPEC induced a lower increase in miR-146a expression than that observed with EcN. Since miR-146a was constantly upregulated during the course of infection, its TRAF6 target remained downregulated compared to that in untreated controls for both infection conditions, as expected (Fig. 3D). However, the expression profiles of miR-146a and the TRAF6 target are not negatively correlated, indicating that additional factors might contribute to the observed TRAF6 inhibition. Investigation of putative bacterial “trigger” or virulence factors involved in probiotic or pathogenic effects on the host. Probiotic bacteria might convey benefits to the host by fine-tuning signaling pathways which in turn induce beneficial activities, e.g., modulating immune responses (5). These activities might be mediated by certain trigger factors that are associated with the cell wall and that affect specific signaling pathways of the targeted host cells. On the other hand, damage induced by pathogenic bacteria

September 2016 Volume 84 Number 9

is often due to their specific profiles of virulence factors. For example, it has been shown that flagellin of EcN is involved in the probiotic effect by inducing the expression of human ␤-defensin 2 (hBD2) (24). It has been also suggested that the EPEC T3SS is responsible for triggering IL-8 production in epithelial cells (45). To account for bacterial factors that might induce the observed changes in cytokine and miRNA expression patterns in our model system, T84 cells were challenged with EPEC and EcN mutants lacking some of the putative factors that might be involved in the observed effects. A ⌬fliC EcN mutant lacking flagellin, the major subunit of the flagella, induced reduced IL-8 and CXCL1 responses in T84 cells compared to those observed with wild-type EcN (Fig. 4). The ⌬K5 mutant, which is devoid of the K5 capsule, induced a relatively modest reduction in IL-8 transcript levels compared to wild-type EcN. On the other hand, a significant reduction was observed for CXCL1. While EcN flagellin has a role in

Infection and Immunity

iai.asm.org

2485

Sabharwal et al.

with the EcN ⌬fliC mutant than in those challenged with wildtype EcN, suggesting that the EcN flagellin contributes, at least in part, to miR-146a induction. The T3SS mutant of EPEC did not induce significant differences in the expression of miR-146a. Effects of EPEC T3SS mutants and EcN mutants on THP-1 cells. To compare the effects of different EcN and EPEC mutants on immune cells, monocytic THP-1 cells were challenged with EPEC and EcN mutants. In contrast to the results for epithelial T84 cells, expression of IL-8 and CXCL1 in THP-1 cells was not reduced in response to the EcN ⌬fliC mutant compared to that in response to wild-type EcN (Fig. 5). The EPEC ⌬escN mutant induced higher expression levels of IL-8 and CXCL1 than those obtained with wild-type EPEC, indicating that proteins of the T3SS play a role in suppressing cytokine production. The ⌬espB mutant induced cytokine levels similar to those with the ⌬escN mutant. This might indicate a role for EspB in inhibiting cytokine expression in THP-1 cells, which does not correspond to the results obtained with T84 cells. In contrast to the results for epithelial cells, miR-146a showed the same level of induction by the ⌬fliC mutant of EcN and the wild type (Fig. 5E). The T3SS mutants of EPEC induced higher levels of miR-146a than those observed with wild-type EPEC, indicating that in contrast to T84 cells, the T3SS might have a role in modulating miR146a expression in THP-1 cells (Fig. 5F). Role of TLR5 in mediating the CXCL1 cytokine response induced by EcN-derived flagellin in T84 cells. TLR5 has been shown to be present exclusively at the basolateral side of polarized T84 cells, and its agonist, flagellin, activates proinflammatory gene expression via TLR5 (46, 47). To investigate whether the induction of proinflammatory IL-8 and CXCL1 by EcN is mediated via TLR5, T84 cells were exposed to either purified wild-type flagellin or flagellin lacking the TLR5 binding site (⌬TLR5 flagellin) (39). CXCL1 induction was monitored in the presence and absence of anti-TLR5 antibodies. Wild-type EcN flagellin induced the expected increase in CXCL1 expression (Fig. 6). However, in the presence of antibodies directed against TLR5, the flagellin-induced CXCL1 response was reduced. The ⌬TLR5 flagellin also induced a reduced CXCL1 response, even in the absence of TLR5 neutralizing antibody (Fig. 6). These results confirm the involvement of TLR5 in mediating cytokine responses triggered by EcN. FIG 2 miRNA expression in polarized T84 epithelial cells grown on transwell filters infected from the apical (AP) side (A) or the basolateral (BL) side (B) or in THP-1 cells (C). All infections were carried out at an MOI of 10 for 4 h. Quantification was performed by quantitative real-time PCR and normalized by using U6 RNA levels. The data represent results from three independent experiments performed in duplicate. Error bars represent SEM.

inducing both IL-8 and CXCL1, the EcN capsule appears to be involved in the induction of CXCL1 expression. To confirm that the T3SS is responsible for cytokine induction, we profiled IL-8 and CXCL1 expression in wild-type EPEC and two T3SS mutants, namely, the ⌬escN (mutated for the ATPase driving the T3SS) and ⌬espB (lacking the EspB protein) mutants. The ⌬escN strain induced a higher expression level of IL-8 and a significantly higher expression level of CXCL1 than those seen with wild-type EPEC, indicating that proteins of the T3SS play a role in suppressing cytokine production. These results also showed that EspB apparently does not contribute to this effect. miR-146a (Fig. 4E) showed less expression in T84 cells challenged

2486

iai.asm.org

DISCUSSION

As an important contributor to innate defenses, the intestinal epithelium releases cytokines that act as mediators of the immune response. Intestinal epithelial cells are structurally and functionally polarized, with an apical surface facing the intestinal lumen and a basolateral surface facing the underlying basement membrane. Usually the intestinal microbiota is in constant contact with the apical side of intestinal epithelial cells, therefore giving rise to only moderate cytokine expression. This single-cell-layer barrier needs to be impermeable to intestinal microorganisms; however, barrier disruption occurs during intestinal inflammation, ulceration, or infection with pathogens, allowing bacteria and/or their components to gain access to the basolateral side. Hence, probiotic bacteria might also contact epithelial cells basolaterally, e.g., during therapeutic interventions under inflamed conditions. Here we compared differences in responses to apical and basolateral infections in human intestinal epithelial T84 cells between

Infection and Immunity

September 2016 Volume 84 Number 9

Apical/Basolateral Cytokine/miRNA Responses to E. coli

FIG 3 Kinetics of IL-8 (A), CXCL1 (B), miR-146a (C), and TRAF6 (D) expression. THP-1 cells were challenged with EPEC and EcN for up to 6 h at an MOI of 10. Analysis was performed by real-time PCR and normalized by using U6 RNA levels for miRNA expression and GAPDH gene levels for mRNA expression. All results are presented as fold changes relative to the untreated control. The data represent results from three independent experiments performed in duplicate. Error bars represent SEM. *, P ⬍ 0.05; **, P ⬍ 0.01.

exemplary pathogenic and probiotic bacteria by using a model system in tissue culture. Polarized T84 cells and, for further comparison, human monocytic THP-1 cells were challenged with the EPEC prototype E2348/69 and probiotic EcN wild-type strains and several mutants thereof. As response indicators, we analyzed the expression levels of the proinflammatory cytokines IL-8 and CXCL1 as well as that of miR-146a. The probiotic EcN and the pathogenic EPEC strain both induced cytokine expression in polarized T84 cells. Interestingly, this expression was largely enhanced when the bacteria were brought into contact with the basolateral side of polarized T84 cells (Fig. 1). This further supports the findings that the polarized epithelium apparently tolerates the presence of PAMPs at the apical side and mounts only a restricted immune response. Epithelial cells might follow this strategy to avoid being in a constant state of enhanced inflammation and, in addition, might also use it as a means to differentiate between pathogenic and probiotic bacteria (48, 49). Indiscriminate recognition of PAMPs from nonpathogenic commensals would be detrimental to the host. Basolateral EcN infection induced even greater transcriptional CXCL1 and IL-8 responses than those for basolateral EPEC infection (Fig. 1). IL-8 and CXCL1 are chemoattractants for neutrophils and monocytes and are important signaling molecules for the initiation of inflammatory responses. Neutrophil infiltration is classically associated with an increase in IBD activity and an increase in inflammation (50). Moreover, in acute inflammatory

September 2016 Volume 84 Number 9

bowel disease, where a compromised intestinal barrier is very likely, basolateral access of microbes, including commensals and probiotics introduced for therapy, is possible and may result in progressive inflammation (51). In contrast, however, there is a growing number of reports that emphasize beneficial effects of neutrophil infiltration (52). Host defense against bacteria requires recruitment of neutrophils because they phagocytize antigens and contribute to bacterial clearance. In murine models, CXCL1 has been shown to be essential for survival and for clearance of Klebsiella pneumoniae from the host (53). Further, it has been demonstrated that in response to commensal bacteria, CXCL1 production via TLR2-, TLR4-, and MyD88-mediated signaling recruits neutrophils and thereby renders a protective effect in the dextran sodium sulfate (DSS)-induced colitis model (54, 55). This suggests a mechanism by which EcN may confer a protective effect on the host and promote bacterial clearance, in particular when the epithelial barrier has been infringed. Thus, although at first sight the upregulation of inflammatory cytokines by a probiotic might appear contradictory, in the end it might confer an advantage to the host during infection (56). In agreement with our findings, Hafez et al. (57) observed that apical infection by EcN induced a modest increase of IL-8, whereas basolateral application caused a dramatic increase in IL-8 gene expression and secretion in Caco-2 cells. In contrast to T84 cells, monocytic THP-1 cells showed stronger responses in terms of both cytokine and miRNA expression

Infection and Immunity

iai.asm.org

2487

Sabharwal et al.

FIG 4 Expression profiles of cytokines and miR-146a in T84 cells challenged from the basolateral side with EPEC or EcN mutants. Infections were performed for 4 h at an MOI of 10. (A and B) Alterations in IL-8 expression induced by EcN (A) and EPEC (B) mutants. (C and D) CXCL1 expression levels induced by EcN (C) and EPEC (D) mutants. (E and F) miR-146a expression levels induced by EcN (E) and EPEC (F) mutants. Analysis was performed by qRT-PCR and normalized with respect to GAPDH levels. All results are presented as fold changes relative to the untreated control. The data represent results from three independent experiments performed in duplicate. Error bars represent SEM. *, P ⬍ 0.05; **, P ⬍ 0.01.

(Fig. 2). It has been shown previously that IEC express low levels of TLR4 and respond poorly to LPS in terms of IL-8 secretion and NF-␬B activation (58). On the other hand, monocytic cells have been shown to express TLR1 to -10, MyD88, and TRIF transcripts and are often one of the primary sources of proinflammatory cytokines (59). For monocytic THP-1 cells, a distinct pattern of expression of the cytokines CXCL1 and IL-8 emerged, with EPEC inducing low expression levels compared to those with EcN

2488

iai.asm.org

(Fig. 3). This is consistent with studies associating EPEC infections with weaker inflammatory responses, which points to the subversion of host immune responses involving T3SS effector proteins (e.g., see Fig. 4B) (33, 60–63). The expression levels of the two cytokines exemplarily investigated in this study seem to be independent of each other even under the same infection conditions. In both T84 and THP-1 cells, expression of CXCL1 was more pronounced than that of IL-8

Infection and Immunity

September 2016 Volume 84 Number 9

Apical/Basolateral Cytokine/miRNA Responses to E. coli

FIG 5 Expression profiles of cytokines in THP-1 cells challenged with EPEC and EcN mutants. Infections were performed for 4 h at an MOI of 10. (A and B) Alterations in IL-8 expression induced by EcN (A) and EPEC (B) mutants. (C and D) CXCL1 expression levels induced by EcN (C) and EPEC (D) mutants. (E and F) miR-146a expression levels induced by EcN (E) and EPEC (F) mutants. Analysis was performed by qRT-PCR and normalized with respect to GAPDH levels. All results are presented as fold changes relative to the untreated control. The data represent results from three independent experiments performed in duplicate. Error bars represent SEM. *, P ⬍ 0.05; **, P ⬍ 0.01.

upon bacterial challenge (Fig. 1 and 3). This suggests differences in regulation of gene expression between the two cytokines (64). Flagellins of various E. coli strains have been shown to induce proinflammatory signaling (65) and are also major factors for the virulence of pathogenic bacteria (66). For EcN, flagellin induces the expression of human ␤-defensin 2 (hBD2), which is an antimicrobial peptide that acts against adherence and invasion of

September 2016 Volume 84 Number 9

pathogens (67). TLR5 has been shown to be localized at the basolateral surface of T84 cells (46). Our results indicate that the increase in basolateral cytokine expression is attributable, at least for a major part, to the EcN flagellin, as EcN flagellin mutants caused reduced IL-8 and CXCL1 expression compared to that seen with wild-type EcN (Fig. 4), and isolated flagellin from EcN produced a reduced CXCL1 response upon blocking of TLR5 by anti-TLR5

Infection and Immunity

iai.asm.org

2489

Sabharwal et al.

FIG 6 Effect of blocking TLR5 on proinflammatory effect of purified flagellin from wild-type EcN (WT) or its mutant with flagellin lacking the TLR5 binding site (⌬TLR5). T84 cells were treated on the basolateral side with purified flagellin, with or without treatment with anti-human TLR5 neutralizing antibody (Ab). The expression of CXCL1 was measured by qRT-PCR. All results are presented as fold changes relative to the untreated control. Error bars represent SEM.

antibodies (Fig. 6). Similarly, expression of miR-146a was also reduced upon challenge with the EcN flagellin mutant (Fig. 4). In monocytic THP-1 cells, however, IL-8 and CXCL1 responses were enhanced when cells were challenged with the flagellin mutant (Fig. 5), indicating that different signaling pathways may be involved in THP-1 cells. EcN exhibits a capsule of the K5 serotype, which is present in only about 1% of E. coli isolates (24). The results obtained in this study show that in T84 cells, loss of the capsule significantly reduced the level of CXCL1 transcription but not that of IL-8 or miR-146a expression (Fig. 4). These findings support the study of Hafez et al., who showed that in Caco-2 cells, secreted levels of MCP-1, RANTES, IL-8, and macrophage inflammatory protein (MIP) were reduced when cells were challenged with a ⌬K5 EcN mutant (57). We observed increased IL-8 and CXCL1 transcription in T84 and THP-1 cells upon challenge with a mutant lacking the escNencoded T3SS ATPase (Fig. 4 and 5). Hence, our results suggest that the T3SS effector proteins are involved in modulating proinflammatory responses, although there have been contradictory reports (68, 69). Interestingly, in T84 cells the EspB protein appears not to be involved (Fig. 4), whereas in THP-1 cells EspB seems to play a role (Fig. 5) by causing cytokine suppression. Expression of miR-146a, however, seems to be antagonized in part by EspB in THP-1 cells (Fig. 5). Concordant with these results, inhibition of IL-8 in Caco-2 cells was previously found to be partly T3SS dependent (45). That study excluded the potential involvement of the locus of enterocyte effacement (LEE)-encoded Map, EspF, and Tir effectors as well as the intimin membrane protein in this inhibition. More recently, it was revealed that T3SS needle proteins induced cytokine expression and signaling by NF-␬B and/or AP-1 following interaction with TLR2 or TLR4 in an MyD88-dependent fashion (70). miR-146a, miR-155, and miR-21 are well-known miRNAs that have been found to be expressed upon TLR stimulation in various screening platforms (17). miR-146a expression was shown to be induced in THP-1 cells in response to challenges with LPS, a synthetic TLR2 agonist (Pam3CSK4), peptidoglycan (TLR2), and

2490

iai.asm.org

flagellin (TLR5) (71). Stimulation of TLR3, TLR7, or TLR9 had no effect on miR-146a (61). Upon activation of TLRs, a molecular cascade including TRAF6 and IRAK1, the key adaptor molecules in the TLR pathway, leads to NF-␬B activation, which in turn results in induction of miR-146a. Mature miR-146a has been shown to target IRAK1 and TRAF6 both in vivo and in vitro (19, 71). Therefore, miR-146a acts in a negative-feedback loop regulating the same signaling system that is used for its own induction. This points to multiple, complex layers of regulation to control and dampen immune responses. In this study, miR-146a was generically upregulated upon infection in T84 and THP-1 cells, the latter of which were clearly more responsive (Fig. 1 to 3). EPEC induced less expression of miR-146a than that observed with EcN. This might be attributed to the suppression of the NF-␬B pathway upon EPEC infection. Thus, the release of cytokines regulated by TLR signaling may involve miR-146a-mediated gene regulation in the case of infection by the two E. coli strains. The pertinent question that arises is how miR-146a, with its differences in expression based on challenges with probiotic or pathogenic bacteria, controls NF-␬B activity under different infection conditions. The bacterial strains investigated in this study differentially activate or trigger the expression of the cytokines IL-8 and CXCL1. Our results indicate that the response of host cells to different bacterial strains in terms of IL-8, CXCL1, and miR-146a, instead of being an on or off event, leads to fine-tuning in the levels of expression, as supposed for miRNA activity. This might ultimately contribute to subtle balances of pro- and anti-inflammatory signals. More importantly, there is a need to delineate the period after stimulation when modulatory miRNAs are induced. TLRs on the surfaces of immune cells seem to be stimulated differentially and allow the immune system to discriminate between different bacterial types. The present data underscore the layers of complexity to the interaction between different bacterial strains and host cells. ACKNOWLEDGMENTS We are indebted to M. Donnenberg (Baltimore, MD) for the kind gift of the EPEC E2348/69 ⌬escN and ⌬espB mutants. Further, we thank V. Humberg for excellent technical assistance. This study is part of the PhD thesis of H.S. This study was supported by grants from the Deutsche Forschungsgemeinschaft (DFG), including SCHM770/15-1, the Graduate School of the Cells-in-Motion (CiM) Cluster of Excellence (grant EXC 1003-CIM), a CiM bridging fellowship to H.S., the DFG graduate school (GRK1409), and the Collaborative Research Center (CRC 629 TP03), and also by a personal grant to H.S. from the Deanery of the Medical Faculty, University of Mu¨nster.

FUNDING INFORMATION This work, including the efforts of M. Alexander Schmidt, was funded by Deutsche Forschungsgemeinschaft (DFG) (EXC 1003-CIM, CRC 629 TP03, GRK1409, and SCHM770/15-1). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

REFERENCES 1. Belkaid Y, Hand TW. 2014. Role of microbiota in immunity and inflammation. Cell 157:121–141. http://dx.doi.org/10.1016/j.cell.2014.03.011. 2. Hooper LV, Gordon JI. 2001. Commensal host-bacterial relationships in the gut. Science 292:1115–1118. http://dx.doi.org/10.1126/science .1058709. 3. Ashida H, Ogawa M, Kim M, Mimuro H, Sasakawa C. 2011. Bacteria

Infection and Immunity

September 2016 Volume 84 Number 9

Apical/Basolateral Cytokine/miRNA Responses to E. coli

4. 5.

6. 7. 8. 9. 10. 11.

12.

13. 14.

15. 16.

17. 18. 19.

20.

21. 22. 23.

and host interactions in the gut epithelial barrier. Nat Chem Biol 8:36 – 45. http://dx.doi.org/10.1038/nchembio.741. Winter SE, Lopez CA, Bäumler A. 2013. The dynamics of gut-associated microbial communities during inflammation. EMBO Rep 14:319 –327. http://dx.doi.org/10.1038/embor.2013.27. Lebeer S, Vanderleyden J, De Keersmaecker SC. 2010. Host interactions of probiotic bacterial surface molecules: comparison with commensals and pathogens. Nat Rev Microbiol 8:171–184. http://dx.doi.org/10.1038 /nrmicro2297. Kravchenko VV, Kaufmann GF. 2013. Bacterial inhibition of inflammatory responses via TLR-independent mechanisms. Cell Microbiol 15:527– 536. http://dx.doi.org/10.1111/cmi.12109. He X, Jing Z, Cheng G. 2014. MicroRNAs: new regulators of Toll-like receptor signalling pathways. Biomed Res Int 2014:945169. http://dx.doi .org/10.1155/2014/945169. Zhou R, O’Hara SP, Chen X-M. 2011. MicroRNA regulation of innate immune responses in epithelial cells. Cell Mol Immunol 8:371–379. http: //dx.doi.org/10.1038/cmi.2011.19. Eulalio A, Schulte L, Vogel J. 2012. The mammalian microRNA response to bacterial infections. RNA Biol 9:742–750. http://dx.doi.org/10.4161 /rna.20018. Flór TB, Blom B. 2016. Pathogens use and abuse microRNAs to deceive the immune system. Int J Mol Sci 17:E538. http://dx.doi.org/10.3390 /ijms17040538. Puleston J, Cooper M, Murch S, Bid K, Makh S, Ashwood P, Bingham AH, Green H, Moss P, Dhillon A, Morris R, Strobel S, Gelinas R, Pounder RE, Platt A. 2005. A distinct subset of chemokines dominates the mucosal chemokine response in inflammatory bowel disease. Aliment Pharmacol Ther 21:109 –120. http://dx.doi.org/10.1111/j.1365-2036.2004 .02262.x. Egesten A, Eliasson M, Olin AI, Erjefält JS, Bjartell A, Sangfeldt P, Carlson M. 2007. The proinflammatory CXC-chemokine GRO-␣/ CXCL1 and MIG(CXCL9) are concomitantly expressed in ulcerative colitis and decrease during treatment with topical corticosteroids. Int J Colorectal Dis 22:1421–1427. http://dx.doi.org/10.1007/s00384-007-0370-3. Atreya R, Neurath MF. 2010. Chemokines in inflammatory bowel disease. Dig Dis 28:386 –394. http://dx.doi.org/10.1159/000320392. Schaefer JS, Attumi T, Opekun AR, Abraham B, Hou J, Shelby H, Graham DY, Streckfus C, Klein JR. 2015. MicroRNA signatures differentiate Crohn’s disease from ulcerative colitis. BMC Immunol 16:5. http: //dx.doi.org/10.1186/s12865-015-0069-0. Dalal SR, Kwon JH. 2010. The role of microRNA in inflammatory bowel disease. Gastroenterol Hepatol 6:714 –722. Van der Goten J, Vanhove W, Lemaire K, Van Lommel L, Machiels K, Wollants WE, De Preter V, De Hertogh G, Ferrante M, Van Assche G, Rutgeerts P, Schuit F, Vermeire S, Arijs I. 2014. Integrated miRNA and mRNA expression profiling in inflamed colon of patients with ulcerative colitis. PLoS One 9:e116117. http://dx.doi.org/10.1371/journal.pone .0116117. Quinn SR, O’Neill LA. 2011. A trio of microRNAs that control Toll-like receptor signalling. Int Immunol 23:421– 425. http://dx.doi.org/10.1093 /intimm/dxr034. Nahid MA, Satoh M, Chan EK. 2011. MicroRNA in TLR signaling and endotoxin tolerance. Cell Mol Immunol 8:388 – 403. http://dx.doi.org/10 .1038/cmi.2011.26. Boldin MP, Taganov KD, Rao DS, Yang L, Zhao JL, Kalwani M, Garcia-Flores Y, Luong M, Devrekanli A, Xu J, Sun G, Tay J, Linsley PS, Baltimore D. 2011. miR-146a is a significant brake on autoimmunity, myeloproliferation, and cancer in mice. J Exp Med 208:1189 –1201. http: //dx.doi.org/10.1084/jem.20101823. Zhao JL, Rao DS, Boldin MP, Taganov KD, O’Connell RM, Baltimore D. 2011. NF-␬B dysregulation in microRNA-146a-deficient mice drives the development of myeloid malignancies. Proc Natl Acad Sci U S A 108: 9184 –9189. http://dx.doi.org/10.1073/pnas.1105398108. FAO. 2006. Probiotics in food: health and nutritional properties and guidelines for evaluation. FAO food and nutrition paper 85. FAO, Rome, Italy. Vieira AT, Teixeira MM, Martins FS. 2013. The role of probiotics and prebiotics in inducing gut immunity. Front Immunol 4:445. http://dx.doi .org/10.3389/fimmu.2013.00445. Ng SC, Hart AL, Kamm MA, Stagg AJ, Knight SC. 2009. Mechanisms of action of probiotics: recent advances. Inflamm Bowel Dis 15:300 –310. http://dx.doi.org/10.1002/ibd.20602.

September 2016 Volume 84 Number 9

24. Sonnenborn U, Schulze J. 2009. The non-pathogenic Escherichia coli Nissle 1917—features of a versatile probiotic. Microb Ecol Health Dis 21:122–158. http://dx.doi.org/10.3109/08910600903444267. 25. Boudeau J, Glasser AL, Julien S, Colombel JF, Darfeuille-Michaud A. 2003. Inhibitory effect of probiotic Escherichia coli strain Nissle 1917 on adhesion to and invasion of intestinal epithelial cells by adherent-invasive E. coli strains isolated from patients with Crohn’s disease. Aliment Pharmacol Ther 18:45–56. 26. Grabig A, Paclik D, Guzy C, Dankof A, Baumgart DC, Erckenbrecht J, Raupach B, Sonnenborn U, Eckert J, Schumann RR, Wiedenmann B, Dignass AU, Sturm A. 2006. Escherichia coli strain Nissle 1917 ameliorates experimental colitis via Toll-like receptor 2- and Toll-like receptor 4-dependent pathways. Infect Immun 74:4075– 4082. http://dx.doi.org /10.1128/IAI.01449-05. 27. Henker J, Laass M, Blokhin BM, Bolbot YK, Maydannik VG, Elze M, Wolff C, Schulze J. 2007. The probiotic Escherichia coli strain Nissle 1917 (EcN) stops acute diarrhoea in infants and toddlers. Eur J Pediatr 166: 311–318. http://dx.doi.org/10.1007/s00431-007-0419-x. 28. Zyrek AA, Cichon C, Helms S, Enders C, Sonnenborn U, Schmidt MA. 2007. Molecular mechanisms underlying the probiotic effects of Escherichia coli Nissle 1917 involve ZO-2 and PKCzeta redistribution resulting in tight junction and epithelial barrier repair. Cell Microbiol 9:804 – 816. http://dx.doi.org/10.1111/j.1462-5822.2006.00836.x. 29. Ukena SN, Singh A, Dringenberg U, Engelhardt R, Seidler U, Hansen W, Bleich A, Bruder D, Franzke A, Rogler G, Suerbaum S, Buer J, Gunzer F, Westendorf AM. 2007. Probiotic Escherichia coli Nissle 1917 inhibits leaky gut by enhancing mucosal integrity. PLoS One 2:e1308. http: //dx.doi.org/10.1371/journal.pone.0001308. 30. Rembacken BJ, Snelling Am Hawkey PM, Chalmers DM, Axon ATR. 1999. Non-pathogenic Escherichia coli versus mesalazine for the treatment of ulcerative colitis: a randomized trial. Lancet 354:635– 639. http://dx.doi .org/10.1016/S0140-6736(98)06343-0. 31. Kruis W, Fric P, Pokrotnieks J, Lukás M, Fixa B, Kascak M, Kamm MA, Weismueller J, Beglinger C, Stolte M, Wolff C, Schulze J. 2004. Maintaining remission of ulcerative colitis with the probiotic Escherichia coli Nissle 1917 is as effective as with standard mesalazine. Gut 53:1617–1623. http://dx.doi.org/10.1136/gut.2003.037747. 32. Schultz M. 2008. Clinical use of E. coli Nissle 1917 in inflammatory bowel disease. Inflamm Bowel Dis 14:1012–1018. http://dx.doi.org/10.1002/ibd .20377. 33. Kaper JB, Nataro JP, Mobley HL. 2004. Pathogenic Escherichia coli. Nat Rev Microbiol 2:123–140. http://dx.doi.org/10.1038/nrmicro818. 34. Wong AR, Pearson JS, Bright MD, Munera D, Robinson KS, Lee SF, Frankel G, Hartland EL. 2011. Enteropathogenic and enterohaemorrhagic Escherichia coli: even more subversive elements. Mol Microbiol 80:1420 –1438. http://dx.doi.org/10.1111/j.1365-2958.2011.07661.x. 35. Deng W, Puente JL, Gruenheid S, Li Y, Vallance BA, Vázquez A, Barba J, Ibarra JA, O’Donnell P, Metalnikov P, Ashman K, Lee S, Goode D, Pawson T, Finlay BB. 2004. Dissecting virulence: systematic and functional analyses of a pathogenicity island. Proc Natl Acad Sci U S A 101: 3597–3602. http://dx.doi.org/10.1073/pnas.0400326101. 36. Schmidt MA. 2010. LEEways: tales of EPEC, ATEC and EHEC. Cell Microbiol 12:1544 –1552. http://dx.doi.org/10.1111/j.1462-5822.2010.01518.x. 37. Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. 2013. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev 26:822– 880. http://dx.doi.org/10.1128/CMR .00022-13. 38. Schlee M, Wehkamp J, Altenhoefer A, Oelschlaeger TA, Stange EF, Fellermann K. 2007. Induction of human ␤-defensin 2 by the probiotic Escherichia coli Nissle 1917 is mediated through flagellin. Infect Immun 75:2399 –2407. http://dx.doi.org/10.1128/IAI.01563-06. 39. Erdelt S. 2015. Analysis of the interaction mechanisms of the probiotic E. coli Nissle 1917 with intestinal mucin/mucin 2. B.S. thesis. University of Würzburg, Würzburg, Germany. 40. Donnenberg MS, Calderwood SB, Donohue-Rolfe A, Keusch GT, Kaper JB. 1990. Construction and analysis of TnphoA mutants of enteropathogenic Escherichia coli unable to invade HEp-2 cells. Infect Immun 58: 1565–1571. 41. Donnenberg MS, Yu J, Kaper JB. 1993. A second chromosomal gene necessary for intimate attachment of enteropathogenic Escherichia coli to epithelial cells. J Bacteriol 175:4670 – 4680. 42. Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. 2002. Multiple control of interleukin-8 gene expression. J Leukoc Biol 72:847– 855.

Infection and Immunity

iai.asm.org

2491

Sabharwal et al.

43. Eckmann L, Kagnoff MF, Fierer J. 1993. Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry. Infect Immun 61:4569 – 4574. 44. Spehlmann ME, Dann SM, Hruz P, Hanson E, McCole DF, Eckmann L. 2009. CXCR2-dependent mucosal neutrophil influx protects against colitis-associated diarrhea caused by an attaching/effacing lesion-forming bacterial pathogen. J Immunol 183:3332–3343. http://dx.doi.org/10.4049 /jimmunol.0900600. 45. Ruchaud-Sparagano M-H, Maresca M, Kenny B. 2007. Enteropathogenic Escherichia coli (EPEC) inactivate innate immune responses prior to compromising epithelial barrier function. Cell Microbiol 9:1909 –1921. http://dx.doi.org/10.1111/j.1462-5822.2007.00923.x. 46. Gewirtz AT, Navas TA, Lyons S, Godowski PJ, Madara JL. 2001. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J Immunol 167:1882–1885. http://dx.doi.org/10.4049/jimmunol.167.4.1882. 47. Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett DR, Eng JK, Akira S, Underhill DM, Adarem A. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099 –1103. http://dx.doi.org/10.1038/35074106. 48. Naik S, Kelly EJ, Meijer L, Pettersson S, Sanderson IR. 2001. Absence of Toll-like receptor 4 explains endotoxin hyporesponsiveness in human intestinal epithelium. J Pediatr Gastroenterol Nutr 32:449 – 453. http://dx .doi.org/10.1097/00005176-200104000-00011. 49. Melmed G, Thomas LS, Lee N, Tesfay SY, Lukasek K, Michelsen KS, Zhou Y, Hu B, Arditi M, Abreu MT. 2003. Human intestinal epithelial cells are broadly unresponsive to Toll-like receptor 2-dependent bacterial ligands: implications for host-microbial interactions in the gut. J Immunol 170:1406 –1415. http://dx.doi.org/10.4049/jimmunol.170.3.1406. 50. Foell D, Kucharzik T, Kraft M, Vogl T, Sorg C, Domschke W, Roth J. 2003. Neutrophil derived human S100A12 (EN-RAGE) is strongly expressed during chronic active inflammatory bowel disease. Gut 52:847– 853. http://dx.doi.org/10.1136/gut.52.6.847. 51. Jensen SR, Mirsepasi-Lauridsen HC, Thysen AH, Brynskov J, Krogfelt KA, Petersen AM, Pedersen AE, Brix S. 2015. Distinct inflammatory and cytopathic characteristics of Escherichia coli isolates from inflammatory bowel disease patients. Int J Med Microbiol 305:925–936. http://dx.doi .org/10.1016/j.ijmm.2015.10.002. 52. Fournier BM, Parkos CA. 2012. The role of neutrophils during intestinal inflammation. Mucosal Immunol 5:354 –366. http://dx.doi.org/10.1038 /mi.2012.24. 53. Cai S, Batra S, Lira SA, Kolls JK, Jeyaseelan S. 2010. CXCL1 regulates pulmonary host defense to Klebsiella infection via CXCL2, CXCL5, NF␬B, and MAPKs. J Immunol 185:6214 – 6225. http://dx.doi.org/10.4049 /jimmunol.0903843. 54. Fukata M, Michelsen KS, Eri R, Thomas LS, Hu B, Lukasek K, Nast CC, Lechago J, Xu R, Naiki Y, Soliman A, Arditi M, Abreu MT. 2005. Toll-like receptor-4 is required for intestinal response to epithelial injury and limiting bacterial translocation in a murine model of acute colitis. Am J Physiol Gastrointest Liver Physiol 288:G1055–G1065. http://dx.doi.org /10.1152/ajpgi.00328.2004. 55. Shea-Donohue T, Thomas K, Cody MJ, Aiping Zhao Detolla LJ, Kopydlowski KM, Fukata M, Lira SA, Vogel SN. 2008. Mice deficient in the CXCR2 ligand, CXCL1 (KC/GRO-alpha), exhibit increased susceptibility to dextran sodium sulfate (DSS)-induced colitis. Innate Immun 14:117– 124. http://dx.doi.org/10.1177/1753425908088724. 56. Bleich A, Sundberg JP, Smoczek A, von Wasielewski R, de Buhr MF, Janus LM, Julga G, Ukena SN, Hedrich HJ, Gunzer F. 2008. Sensitivity to Escherichia coli Nissle 1917 in mice is dependent on environment and genetic background. Int J Exp Pathol 89:45–54. 57. Hafez M, Hayes K, Goldrick M, Warhurst G, Grencis R, Roberts IS.

2492

iai.asm.org

58.

59.

60. 61. 62.

63.

64. 65.

66. 67.

68.

69.

70.

71.

2009. The K5 capsule of Escherichia coli strain Nissle 1917 is important in mediating interactions with intestinal epithelial cells and chemokine induction. Infect Immun 77:2995–3003. http://dx.doi.org/10.1128/IAI .00040-09. Abreu MT, Vora P, Faure E, Thomas LS, Arnold ET, Arditi M. 2001. Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J Immunol 167:1609 –1616. http://dx.doi.org/10.4049/jimmunol.167.3.1609. Zhang C, Bai N, Chang A, Zhang Z, Yin J, Shen W, Tian Y, Xiang R, Liu C. 2013. ATF4 is directly recruited by TLR4 signaling and positively regulates TLR4-triggered cytokine production in human monocytes. Cell Mol Immunol 10:84 –94. http://dx.doi.org/10.1038/cmi.2012.57. Robins-Browne RM, Hartland EL. 2002. Escherichia coli as a cause of diarrhea. J Gastroenterol Hepatol 17:467– 475. http://dx.doi.org/10.1046 /j.1440-1746.2002.02769.x. Jayamani E, Mylonakis E. 2014. Effector triggered manipulation of host immune response elicited by different pathotypes of Escherichia coli. Virulence 5:733–739. http://dx.doi.org/10.4161/viru.29948. Sanchez-Villamil J, Navarro-Garcia F. 2015. Role of virulence factors on host inflammatory response induced by diarrheagenic Escherichia coli pathotypes. Future Microbiol 10:1009 –1033. http://dx.doi.org/10.2217 /fmb.15.17. Ruchaud-Sparagano MH, Mühlen S, Dean P, Kenny B. 2011. The enteropathogenic E. coli (EPEC) Tir effector inhibits NF-␬B activity by targeting TNF␣ receptor-associated factors. PLoS Pathog 7:e1002414. http://dx.doi.org/10.1371/journal.ppat.1002414. Amiri KI, Richmond A. 2003. Fine tuning the transcriptional regulation of the CXCL1 chemokine. Prog Nucleic Acid Res Mol Biol 74:1–36. http: //dx.doi.org/10.1016/S0079-6603(03)01009-2. Bambou J-C, Giraud A, Menard S, Begue B, Rakotobe S, Heyman M, Taddei F, Cerf-Bensussan N, Gaboriau-Routhiau V. 2004. In vitro and ex vivo activation of the TLR5 signaling pathway in intestinal epithelial cells by a commensal Escherichia coli strain. J Biol Chem 279:42984 – 42992. http://dx.doi.org/10.1074/jbc.M405410200. Ramos HC, Rumbo M, Sirard JC. 2004. Bacterial flagellins: mediators of pathogenicity and host immune responses in mucosa. Trends Microbiol 12:509 –517. http://dx.doi.org/10.1016/j.tim.2004.09.002. Wehkamp J, Harder J, Wehkamp K, Meissner W, Schlee M, Enders C, Sonnenborn U, Nuding S, Bengmark S, Schröder JM, Stange EF. 2004. NF-␬B- and AP-1-mediated induction of human ␤-defensin-2 in intestinal epithelial cells by Escherichia coli Nissle 1917: a novel effect of a probiotic bacterium. Infect Immun 72:5750 –5758. http://dx.doi.org/10.1128 /IAI.72.10.5750-5758.2004. Sharma R, Tesfay S, Tomson FL, Kanteti RP, Viswanathan VK, Hecht G. 2006. Balance of bacterial pro- and anti-inflammatory mediators dictates net effect of enteropathogenic Escherichia coli on intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 290:G685–G694. http://dx .doi.org/10.1152/ajpgi.00404.2005. Zhou X, Girón JA, Torres AG, Crawford JA, Negrete E, Vogel SN, Kaper JB. 2003. Flagellin of enteropathogenic Escherichia coli stimulates interleukin-8 production in T84 cells. Infect Immun 71:2120 –2129. http: //dx.doi.org/10.1128/IAI.71.4.2120-2129.2003. Jessen DL, Osei-Owusu P, Toosky M, Roughead W, Bradley DS, Nilles ML. 2014. Type III secretion needle proteins induce cell signaling and cytokine secretion via Toll-like receptors. Infect Immun 82:2300 –2309. http://dx.doi.org/10.1128/IAI.01705-14. Taganov KD, Boldin MP, Chang K-J, Baltimore D. 2006. NF-kappaBdependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A 103:12481–12486. http://dx.doi.org/10.1073/pnas.0605298103.

Infection and Immunity

September 2016 Volume 84 Number 9