cf. MOE. Biol. (1992) 228, 1104-?PB4

Interlocking of Plasmi Repressor-Operator Hai-Young

Interactio Wu

Department oj Pharmacology, Wayne State Uniwwity School of Medicine, 540 East Canfield Avenue Detroit, MI 48201, U.S.A.

Kawai

725

Lau and Leroy

Department of Biological Chemistry Johns Hopkins School of Medicine Wolfe Street, Baltimore, MD 21205, U.S.A.

N.

(Received 12 May

1992; accepted 24 August

1992)

The presence of a single lac repressor binding sequence on piasmid DNAs is shown t,o mediate the formation of interlocked dimers in E. coli. The presence of both homo- and hetero-interlocked dimers suggests that the lac repressor complex can bring together randomly two plasmid DPI’A molecules to facilitate gyrase-mediated interlocking. The exclusive formation of multiply intertwined dimers also suggests that the lac repressor complex may bind simultaneously to a pair of replicated daughter plasmid molecules prior to their segregation. The formation of interlocked plasmid DNAs can be indicative of interaction between two DNA bound proteins in viva. Keywords:

lac repressor; catenation; iac operat,or; DNA replicating intermediate

1. Introduction Transcription factor-mediated protein-protein intera&ion has been suggested to be important for the regulation of transcription in many systems (&Martin et al., 1986; Ptashne, 1986, 1988; Schleif, 1987; Carey et ab., 1990). However, there have been few methods for studying protein-protein interactions in viva. Looping of DNA due to proteinprotein interaction was initially suggested from studies of the arabinose operon; the periodic expression of the arabinose operon is dependent upon the presence of DKA sequences in integral numbers of DKA helical repeats between the arabinose operators (Dunn et al., 1984; Lobe11 & Schleif, 1990; 1991). Studies of lambda repressors have similarly suggested looping of DKA due to repressor(Griffith et aZ., 1986; interactions repressor Hochschild & Pt’ashne, 1986, 1988). More recent studies of transcription factors from yeast and t Author to whom all correspondence addressed. 0022-2836/92/241104-11

$08.00/0

should

be

DNA

looping;

mammalian ceils have in general suggest’ed that possible protein-prot(ein interactions are involved in activation of transcription (Hofmann et al.; 1989; Xluller et al., 1989; Scha,tt et al.; 1990; for a review, see Ptashne, 1986). Besides transcription factors, replication init’iator protein (7~) is another example of a cellular fact’or that requires protein-protein interaction for its biological activity (Miron et al., 1992). The Zac operon (Jacob & Monad, 1961) ha,s been a paradigm system for studying protein-protein interactions. Apparently, the presence of t,wo pseudooperators (Oi and 0,) near the main operator (0) is to enhance the formation of an operator-tetrameric bc repressor-operator ternary complex (Besse et al., 1986; Oehler et al., 1990). In vitro studies of the interaction between the operator and lac repressor molecules have indicated that the simult’aneous binding of tetrameric Zac repressor to two operator sites greatly enhanced the stability of the repressoroperator complex (O’Gorman et al., 1980; Whit’son & Matthews, 1986; Whitson et al., 1986; Hsieh et al., !987). Gel shift assays a,nd the enhanced rate of

1104

Lac Repressor-Operator

Interaction

1105

Table 1 Plasmids

used Lac repressor

Plasmids PAO pAO-SLO PTO pT03 pACYC184 pACYC-SLO

Major genes

bla bla t&A t&A t&A Cm tetA

Reference

binding site

No Yes Yes No

Wu & Liu, 1991 Wu & Liu, 1991 This work This work Chang & Cohen, 1978

Yes

This work

NO

Oehler

No

Oehler et al., 1990

NO

Cm

ps01010 pSOll0

tetA Wild-type lac I tetA Mutant lac I(jodi)

cyclization of small DNA circles containing two lac operator sites have provided strong evidence for lac repressor-mediated looping of DNA in vitro (Krhmer et al., 1987). Flanking the res site with two lac operators was shown to inhibit the Tn3 resolvase-dependent recombination in vitro (Saldanha, et al., 1987). This study provides further evidence for the formation of a lac repressor-mediated DNA loop in vitro. Studies of lac promoter strength using constructs containing the lac operator (or pseudo-operators) in different configurations have suggested that lac repressor may mediate looping of DNA in vivo through prot,ein-protein interaction (Besse, et al., 1986; Mossing & Record, 1986; Oehler et al., 1990). More recently, through analysis of the supercoiled state of DNA during transcription, lac repressormediated looping of DNA into stable topological domains in vivo has again been inferred (Wu & Liu, 1991). In the present communication, we use a simple method, through the formation of interlocked plasmid DNA molecules, to demonstrate protein-protein interaction between lac repressoroperator complexes in vivo.

2. Materials

and Methods

(a) Chemicals, enzymes and DNA Chemicals used in this study were purchased from Sigma Co. Restriction enzymes and other enzymes were purchased from Bethesda Research Laboratories. Plasmids used in this study are listed in Table 1. The constructions of pA0 and pAO-SLO have been described previously (Wu & Liu, 1991). pT0 plasmid DNA was constructed by deleting &PI-PstI 561 bpt fragment from pAT153 to remove the promoter of the bla gene. A 42 bp DNA oligomer containing a 21 bp Zac repressor binding sequence is inserted into the single BaZI site of pT0 to generate pT03 (see Fig. 3). pACYC-SLO DNA was

t Abbreviations used: bp, base-pair(s); IPTG, isopropyl-P-D-thiogalactoside; LB, Luria broth; TPE, triphosphate EDTA; mono, monomeric; di, dimeric; hm-i; homo-interlocked dimer; ht-i, hetero-interlocked dimer; DTT, dithiothreitol; BSA, bovine serum albumin.

et

al., 1990

constructed as follows: the BamHIand SacI-digested 42 bp synthetic DNA oligomer containing the 21 bp lae repressor binding essential sequence was inserted into the multiple cloning sites (between BamHI and Sac1 sites) of pUCl9 DNA. A 60 bp DNA fragment containing the inserted 21 bp Zac repressor binding sequence is then isolated from the multiple cloning region with XaZI and EcoRI digestion. This 60 bp DNA fragment was then inserted into the single EcoRI site of pACYC184 to form pACYC-SLO DNA. pSOlOl0 and pSOll0 are pACYCbased (low copy number) plasmids, which carry th’e wildtype 1acI gene and the mutated ZacI gene (jadi), respectively (Lehming et al., 1987). Both genes are expressed via a synthetic promoter which is 7-fold less active than i4 promoter (Oehler et al.; 1990). These 2 plasmids were generous gifts from Dr Benno Miiller-Hill (Institute of Genetics, University of Kijln, Germany). Calf thymus DNA topoisomerase II was purified as described (Halligan et al., 1985).

(b) Bacteria and cell yrowth

Escherichia coli HBlOl (F-, hsdSZO (re, me), recAl3, am-14, proA&, lacYI, yaZK2, rpsL2O(Sm’), ~~1-5, m&l, supE44, a-), E. eoZi AS19 (a recA+ strain derived from E. coli B strain which was originally selected for its permeability and E. coli

to actinomycin D) (Sekiguchi & Iida, 1967), MC1060 (A(ZacI-Y)74, yaZE15, yaZK16, i-, reZA1, rpsL150, spoT1, hsdR2), a lac repressor deletion strain (Casadaban & Cohen, 1980), were used in this study. Cells were freshly transformed with various plasmid DNAs and colonies were picked, 10 h after transformation, from LB plates containing an appanpriate antibiotic and IPTG (1 mM) as needed. Colonies were inoculated directly into L broth that contained appropriate antibiotics and IPTG (1 mM). After 6 h, when cells were in log phase growth, plasmid DNAs were isolated by the alkaline lysis method. Cultures were also frozen in samples at this stage to be used as inoculum in future experiments. Inhibition of DNA gyrase in HBlOl cells was through treatment with a mixture of novobiocin (final concentration 500 pg/ml) and oxolinic acid (final concentration 100 hg/ml) for 30 min prior to plasmid DNA isolation.

(c) Gel eZectrophoresis Different plasmid DNA species were analyzed by using 1 or 2 dimensional gel electrophoresis (Wu et al., 1988). One-dimensional gel electrophoresis was carried out in

1106

H.-Y. buffer. Two-dimensiona! gel electro-

TPE electrophoresis phoresis was carried

out in the same buffer

with

various

concentrations of chloroquine diphosphate. The chloroquine concentrations for the first and second dimensions for experiments described in Figs 2 and 5 were 0 FM and 8 PM, respectively, whereas for experiment,s described in

Fig. 4, they were 3 PM and 8 PM, respectively. Dried slab gels were prepared described previously

for in situ Southern (Wu et al., 1988)

hybridization

as

the formation

of

3. Results (a) Lac repressor-binding promotes interlocked dimers

pAO-SLO was constructed originally for the purpose of st,udying the effect of lac repressormediated looping of DNA on the supercoiled state of Dn’A during transcription (Wu & Liu, 1991). A single 21 bp lac repressor binding essential sequence was cloned as a 42 bp DNA into a plasmid

Wzr.et a!.

-.

DKA (pA0 DNA); which contains just one major transcription unit, bla (the p lactamase gene). Studies on the rate of formation of positively supercoiled pAOSLO DNA topoisomers in novobiocintreated E. coli have suggested t,hat simuhaneous binding of the lac repressor tetrameric complex to two operator sites occurs both intra- and intermolecularly. Tnt~ermolecular binding of the tetrameric complex appears much less efficient through analysis of the rate of positive supercoiling of the monomeric pAO-SLO DNA with or without IPTG treatment (Wu & Liu, 1991). During studies of dhe supercoiled state of pAO-SLO DNA, we repeatedly observed that IPTG treatment also affected the amount’ of interlocked dimers of pAO-SLO DNA. /4s shown in Figure I(a), format,ion of multiply interlocked dimers of pAO-SLO DNA (compare 13, and C,, in lanes 3 and 4 of Fig. l(A) and in lanes 3 and 4 of Fig. l(R), respectively) was reduced to half upon IPTG treatment of E. eobi HBlOl, a Rec& strain.

42 bp 5’

CGGATCCAAGGlAATTGTGAGCGGATAACAATTlCTCGAGCTCGACGT~, ';GCAGCCTAGGTTCCITTAACACTCGCCTATTGTTAA~~AGCTCGAGC~, 21 bp Lac repressor binding essential sequence

Figure 1. Lac repressor-mediated formation of multiply interlocked dimers. A. B;‘. c&i KBlOl was transformed with pAO-SLO D?jA. Ten hours after transformation, a colony was picked and inoculated into 1 ml of L broth (containing 50 pg ampicillin/ml) for 1 h and then diluted into two 50 ,nl cult’ures with (A, lanes 4 and 6) or without 1 mM-IPTG (A. lanes 3 and 5) in the same medium for 3 h. 5 ;&I of C3H]thymidine was added to each culture during the last 30 min of cell growth. pAO-SLO DNA was then isolated by the alkaline lysis method and half of each DKA sample was analyzed by agarose gel electrophoresis and in situ Southern hybridization (lanes 3 and 4). The other half of each DXA sample was loaded onto the same agarose gel but analyzed by fluorography using Fluoro-Hance (lanes 5 and 6). C, marks the position of multiply interlocked dimers with both rings in the closed-circular form. Under these gel electrophoresis conditions, supercoiled circular dimers (I’) and multiply interlocked dimers (C,) co-migrate. B, marks the position of multiply interlocked dimers with only 1 ring in the closed-circular form and the other in the nicked or gapped form. The insert (lanes 1 and 2) represents an over-exposure of the upper part of the gel shown in lanes 3 and 4, respectively. B. eel1 growth was under identical conditions as described above. Instead of [3H]thymidine, novobiocin (finaf conen. 500 @g/ml) and oxolinic acid (final concn. 100 pg/ml ) were added to the culture (lanes 5 and 6) during the last 30 min of cell growth in the absence (lane 5) or presence of IPTG (lane 6). pAO-SLO DNA samples shown in lanes 3 and 4 were the same as those shown in A, lanes 3 and 4, respectively. In lanes 1 and 2, the parental pAO DNA; which lacks the Zac repressor binding site of pAOSLO DNA, was isolated under the same growth conditions as described for the pAO-ST,0 DSA samples shown in lanes 3 and 4, respectively.

Lac

Repressor-Operator

Interaction

Figure 2. Analysis of the topological structures of multiply interlocked dimers by 2-dimensional gel electrophoresis. A; the same DKA samples from Fig. l(B), lanes 5 and 6, were analyzed by Z-dimensional gel electrophoresis and are shown in panels 1 and 2, respectively. The interlocked DNA species are located at the region where closed circular dimiers are located. This region is highlighted with a rectangle on the 2-dimensional gel. This highlighted area was over-exposed and shown in the insert at the top of the Figure. The nicked monomeric DNA, marked n, was used as a reference point for comparing the relative locations of other DNA populations on the 2-dimensional gel. Cl-C, are the interlocked dimers with 1 to n intertwines between 2 monomeric DNA circles. B, is the interlocked DNA population with n intertwines between a closed circular DNA ring and a nicked or gapped DNA circle. B, illustrates the possible structures of these interlocked DNA species (B,, C,-C,). The interwined area is indicated between brackets, while n indicates the number of interwines.

The designation of C, (both rings in the closedcircular forms) and B, (only one ring is closed and the other nicked or gapped) for interlocked dimers is in accordance with that of Sundin & Varshavsky (1981). A 30-min [3H]thymidine pulse revealed more clearly that the C, population was reduced upon IPTG induction (compare C, in lanes 5 and 6 in Fig. l(A)). The band labeled C, in Figure 1 actually consists of two roughly equal populations, which are not well resolved by gel electrophoresis. However, under different gel electrophoresis conditions, two closely migrating bands were observed (data not shown). The faster-migrating band of the two is due to multiply interlocked dimers (C,). The slower-migrating band represents supercoiled circular dimers (I’). The parental plasmid pA0, which does not contain the lat. repressor binding sequence, also exhibited a population migrating at the C, position (Fig. l(B), lanes 1 and 2). However, this population was shown to consist primarily of supercoiled dimers (I’) (data not shown). (b) The interlocked

lac repressor

dimers formed are multiply

in the presence

of

intertwined

To examine the topological structure of C,,, pAOSLO DNA was isolated from E. coli HBlOl treated with novobiocin and oxolinic acid to inhibit DNA

gyrase (Fig. l(B), lane 5 and Fig. 2(A), panel 1). pAOSLO DNA isolated from gyrase inhibited cells exhibited a smear in gel in a region trailing behind the C, position (Fig. l(B), lane 5). pAO-XL0 DNA molecules in this region of the gel were further analyzed by two-dimensional gel electrophoresis with 8 PM-chloroquine in the second dimension (see insert of Fig. Z(A), panel 1). Most of the pAO-SLO DNA molecules in this region were multiply intertwined (C, . , C,). Each series of C, contains topoisomers whose distributions were similar to ,that of the monomeric pAOSLO DNA (see Pig. 2(B) for schematic diagrams for C,). The number n indicates the number of intertwines between the two monomeric pAOSLO DNA partners. Another pAOSLO DNA topoisomer series labeled B, probably represents interlocked dimers with one nicked DNA circle. The B,, series of topoisomers has a nabrrower distribution compared to that of monomeric pAOSLO DNA topoisomers. Both the B, and C, series of topoisomers were readily detectable in regions corresponding to circular dimers and tetramers but not monomers and trimers (data not shown), consistent with the designation of replicating intermediates. The formation of B, topoisomers was again stimulated by the formation of lac repressor-operator complexes, as IPTG treatment significantly reduced these interlocked dimers (Fig. l(B), lane 6 and

N.-Y.

1108

123456

123456

12

wu et al. Fig. 2(A), panel 2). Interestingly, C,, series,

which

contains

interlocked

differing from the dimers with a

low degree of intertwining (C,, C, . . ., etc.) in novobiocin-treated cells, the B, series only contains multiply intertwined interlocked dimers (i.e. no B, : B, . .: etc.) in novobiocin-treated cells. This result, could be explained if B, is the precursor of 6, and the rate of conversion of B, to C, is higher than that of B, to B,, where m < n. Together, these results suggest that lac repressoroperator interaction stimulates the formation of multiply intertwined dimers (C, and B,) rather than singly intertwined dimers (C, and B,) (see C, in Fig. 1). Inhibition of DNA gyrase by novobiocin and oxolinic acid generated some interlocked dimers with fewer intertwines (C, . 6,) (Figs l(B) and 2(A). One possible explanation of the increase in t,he amount of multiply interlocked dimers may be that Zac repressor binds preferentially to the replicated but unsegregated daughter DNA molecules which can exist as multiply interlocked dimers.

Figure 3. The formation

of interlocked dimers requires the lac operator sequence in cis and lac repressor in trans. A, pT0 was constructed by deleting the 561 bp SspI-PstI fragment of pAT153 DNA. This deletion removes the bla gene promoter and results in a plasmid containing the t&4 gene and a possible anti-tet promoter, which is directly transcribed from a promoter overlapping with the promoter region of t’he tetA gene (see the plasmid map) (Stiiber & Bujard, 1981). pT03 DNA contains a 42 bp synthetic DEA oligomer with a 21 bp Zac repressor binding essential sequence (the Zac operator) inserted into pT0 DXA at t,he single BaZI site, which is located just outside the 3’ end of the tetA gene. The plasmid is otherwise identical to pT0. Both constructs were transformed into E. coli AS19 cells and plated on L broth agar plates containing tetracycline (15 pg/ml) and I mm-IPTG. 12 h later, colonies were inoculated into LB medium (15 pg tetracycline/ml and 1 m&r-IPTG) for 3 h to reach early log phase. Cells were pelleted and resuspended into LB medium without IPTG. The release from IPTG was to allow lac repressor-mediated interlocking to occur. Cultures in IPTG-free medium were incubated at 37°C with vigorous shaking for 3 h (lanes 3 and 4) and 15 h (lanes 5 and 6). As a control, the pelleted cells were also resuspended into L broth containing 1 mivr-IPTG and incubated for 15 h (lanes 1 and 2). DNAs were isolated at each time point by using the alkaline lysis method and analyzed by agarose gel electrophoresis in TPE buffer. Lanes 1,3 and 5, pT0 DNA; lanes 2,4 and 6, pT03 DNA. B, portions of the same DATA samples were treated with calf thymus DNA topoisomerase II in a reaction buffer (40 rnM-Tris (pW 7.5), 100 rnM-KCl, 10 mM-MgCl,; 1 mivr-ATP, 6% mM-DTT, 95 mM-EDTA and 30 pg BSA/mI) for 30 min prior to gel electrophoresis and are shown in the same order (lanes 1 to 6). C, is the interlocked dimer. I and I’ indicate the positions of supercoiled circular monomer and dimer, respectively. II and II’ indicate the positions of nicked circular monomer and dimer, respectively. III and III’ indicate the positions of linearized monomer and dimer, respectively. In this gel electrophoresis system, the interlocked dimers with various interwines (C,-C,) distribute in a region between I’ and II’. C, pT0 and pT03 were also transformed into E. coli MC1060 (a Zac repressor deletion mutant strain)

(c) he

repressor-mediated DNA dimerization

plasmid

The effect of lac repressor-operator interaction on the formation of interlocked dimers has been studied using a different plasmid, pT0, which contains the tetA gene but not, the bla gene of pBR322. The 42 bp DKA, which contains a single 21 bp lac repressor binding site was cloned into the Bali site of pT0 DSA to create pT03 DNA. pT03 DNA isolated from E. GO& AS19 (a recA+ strain) contains more interlocked dimers than pT0 DXA (compare lanes 5 and 6 of Fig. 3(8). In this experiment, cells were transformed in the presence of IPTG, and colonies were inoculat’ed into TPTG-containing 1, broth for 3 h (Fig. 3(A), lanes 1 and 2) and then transferred to L broth without IPTG for either another 3 h (Fig. 3(A), la,nes 3 and 4) or for 15 h (Fig. 3(A), lanes 5 and 6). The formation of interlocked dimers was confirmed by treatment of the purified pT0 and pT03 DNA with calf thymus DKA topoisomerase IT, which converted all interlocked species into monomeric j _ D;“1’4. Supercoiled plasmid DSAs were also relaxed during topoisomerase II treatment (Fig. 3(B)). The formation of interlocked pT03 DXA was shown to depend on the presence of the hc repressor, as pT03 DNA isolated from E. coli MC1060 (a Alac strain) did not contain detectable interlocked dimers (Fig. 3(C)). In addition to the formation of interlocked dimers, more circular dimers of pT03 DNA were also formed as a result of lac repressor binding to the Zac operator (compare Fig. 3(B). lanes 5 and 6).

and grown in a medium without IPTG for 15 h. DS,Js were then isolated and analyzed by agarose gel eleet,rophoresis. Lane 1, pT0 DNA isolated from E. coli MC1 060: lane 2, pT03 DNS isolated from E. coli MC1060.

Lac Repressor-Operator Interaction The increase in the amount of circular dimers of pT03 DNA was accompanied by a decrease in the amount of circular monomers of pT03 DNA (compare lanes 5 and 6 in Fig. 3(A) and (B)). The increase in circular dimers of pT03 DNA is most likely due to an increased rate of recombination between two monomeric pT03 DNA molecules in the presence of the lac repressor. The topological structure of pT03 DNA isolated from E. coli AS19 15 h post-release into the IPTG-free medium was further examined by twodimensional gel electrophoresis (Fig. 4, lane B). In this modified two-dimensional gel system, both dimensions contained chloroquine (3 PMehloroquine in the first dimension and 8 PMchloroquine in the second dimension). Due to nicking of pT03 DNA during isolation, interlocked dimers of pT03 with both DNA molecules in the nicked form were readily observed (see the A, series in Fig. 4, lane B). In addition to the increase in

2nd

1109

interlocked dimers of pT03 DNA, the amount of circular dimers of pT03 DNA was also increased significantly relative to its monomeric counterpart when compared to pT0 DNA isolated under the same conditions (compare lanes A and B in Fig. 4). Furthermore, pT0 DNA and pT03 DNA isolated from E. coli AS19 grown in the presence of IPTG before release into IPTG-free medium showed approximately the same distribution of monomers and circular dimers (compare lanes C and D in Fig. 4). Consistent with these results, pT0 and pT03 DNAs isolated from E. coli MC1060 (a Alac strain) showed the same ratio of dimers to monomers (Fig. 3(C), compare lanes 1 and 2). These results suggest that the formation of both interlocked dimers and circular dimers is due to lac repressor-operator interactions. A surprising finding during the analysis of the topological structure of pT0 and pT03 DNA was that rather substantial amounts of the plasmid

D

Kl

Kll

Figure 4. Analysis of the topological structures of interlocked dimers by Z-dimensional gel electrophoresis. The same DNA samples from Fig. 3, lanes 5, 6: 1 and 2 were analyzed by Z-dimensional gel electrophoresis. pT0 DNA and pT03 DNA isolated from E. coli AS19 without IPTG treatment (Fig. 3(A), lanes 5 and 6) are shown in lanes A and B of the 2-dimensional gel on the left of the Figure, respectively. pT0 DNA and pT03 DNA isolated from E. coli AS19 with IPTG treatment (Fig. 3(A), lanes 1 and 2) are shown in lanes C and D, respectively. K, is nicked, singly knotted DNA, knotted dimeric DNA and K,* is the closed and K, is nicked, multiply knotted DNA. K, *’ is the closed circular, multiply circular, multiply knotted monomeric DNA. A, is nicked, singly interlocked dimer, and A, is nicked multiply interlocked dimer. A,-A, DWA populations of pTO3 DNA isolated from E. coli AS19 without IPTG treatment (lane B) are co-distributed with K,_,, DNA populations slightly off the diagonal line between nicked monomeric and nicked dimeric DNAs. C, populations (distributed as multiple arcs within the arc of closed circular dimer of pT03 in lane B) are closed circular interlocked dimers with different intertwines between 2 monomeric DNAs. Spot V (lanes C and D) indicates the position where the irreversible denatured closed circular DNA (form V DPiA ) migrates in our gel electrophoresis system. Form V DNA was generated during DNA isolation. The possible structures of K,, K, and K,* are also illustrated.

1110

H.-Y.

wu et, a;.

DNAs existed in the topologically knotted forms (see K, . K, in Fig. 4). These topologically knotted DNAs were nicked and formed an array in a diagonal line. The formation of these nicked, knotted DNAs was apparently independent of lac repressor operator interaction (compare lanes C and D in Fig. 4). In addition to nicked, knotted DNA, a prominent group of bands (labeled K*) begins at the position near K, and extends to the right of Ii, and eventually merges into the diagonal line. The topological structure of the DNA in this group of bands has not been determined. However, it could be related to the closed-circular form of knotted dimeric DNAs. A speculative structure of K* is shown diagrammatically in Figure 4.

2nd

pACYC (cl) Interlocking

between two compatible DNA

plasmid

The preferential formation of multiply intertwined dimers (C, and B,} rather than singly intertwined dimers (C, and B,) (Fig. 1) has led to an interpretation that lac repressor binding preferentially affects the unsegregated daughter DXA molecules, which can exist as a multiply interlocked form before segregation. Kinetically, however, lac repressor-binding should also promote the interlocking between two random plasmid DNAs albeit a,t a slower rate. The product of this interlocking process is expected to be a singly intertwined dimer (C,) rather than a multiply intertwined dimer (C,). To test this possibility, we have cotransformed HBlOl cells with pACYC-SLO and pAOSLO, and selected for ampicillin resistance and tetracycline resistance. These two compatible plasmids contain different origins of replication; therefore the presence of hetero-interlocked dimers of pACYC-SLO and pAO-SLO is evidence for interlocking occurring between two random DNA molecules rather than being mediated through unsegregated replicating intermediates. Gyrase-inhibited HBlOl cells harboring pACYCSLO and pAO-SLO were harvested from a log-phase culture. Plasmid DNAs were then isolated and analyzed by two-dimensional gel electrophoresis (Fig. 5). pACYC and pA0 specific probes were used to probe the two-dimensional gel separately for the purpose of distinguishing the DNA populations of pACYC-SLO from the DNA populations of pAOSLO. DNA populations such as monomeric (mono) or dimeric (di) pACYC-SLO or pAO-XL0 can be readily identified from their distinct sizes (pACYCSLO is 4286 bp; pAO-SLO is 2272 bp) (Fig. 5(A) and (B)). Homo-interlocked dimer (hm-i) of pAOXL0 is also clearly identified on the two-dimensional gel (Pig. 5(B)). The above DNA populations are all located at different positions on the twodimensional gel, there is only one DNA population (see ht-i of Fig. 5(A) and (B)) located at the same position on both autoradiograms and that can be hybridized by both DNA specific probes. Gel mobility of the DNA population of hetero-interlocked dimers (ht-i) is slower than the gel mobilities of

Figure 5. Lac repressor-mediated interlocking between 2 compatible plasmids. E. co& HBlOl was co-transformed with pACYCSL0 DNA and pAOSLO DNA and grown to the log phase. h’ovobiocin (final concn. 500 pg/ml) and oxolinic acid (final conen. 100 pg/ml) were added to cultures 30 min prior to DrJA isolation. Pla,smid DKAs isolated from the E. coli HE%101 were then analyzed by 2-dimensional gel electrophoresis in TPE buffer. The 2nd dimension contained 4-5 @M-chloroquine. Two identical samples were electrophoresed and hybridized with pACYC- and pAO-specific probes, respectively. A, shows the autoradiograph from a pACYC184 DNA probe and B, shows the autoradiograph from a p40 DNA probe. Monomeric (mono) and dimeric (di) DNA of each DNA species are labeled at the upper apex of each DNA group, while the hetero-interlocking dimer (ht-i) and homo-int’erlocking dimer (hm-i) are labeled on the left side of ea,ch DNA group.

mono pACYCSL0 and di pAOSLO, but’ is faster than the gel mobility of di pACYCSL0, suggesting that this DNA population contains both pACYCSLO and pAO-SILO plasmid DNAs. This is eonsistent with the co-localization by the specific probes for pACYC and ~~40. The formation of this DNA population (ht-i and hm-i) can be drama.titally reduced with a 30 min IPTG treatment! prior to harvest (data not shown). The presence of only a single species of ht-i suggests that most of ht-i are probably singly interlocked. In contrast; hm-i exhibited multiple species suggesting the presence of multiply intertwined homodimers. The fact that the DNA population of ht-i (Fig. 5(B)) is less than that of hm-i (Fig. 5(B)) may be in part due to the lower copy number of pACYC-SLO. It is also possible that hm-i ase more abundant due to preferential interaction of the lac repressor complex with a pair of unsegregated daughter DNAs. When t’he parental plasmid pACYC184, which does not contain the lac repressor binding site; was used instead of pACYC-SLO, ht-i was not detected on autoradiograms hybridized with specific DXA probes (data not shown). This result is consistent with the notion that ht-i are formed due to the simultaneous binding of lac repressor to two different plasmids.

Lac Repressor-Operator

2nd

D

1111

Interaction

population i) were detected in E. CO& MC1060 harboring both pSOll0 and pAO-SLO (Fig. 6(B)). These results together suggest that the Eat repressor binding to operator is insufficient to promote the interlocking process. Interlocking of lac oper,atorcontaining plasmids must involve protein-protein interaction between lac repressor dimers.

P

4. Discussion

c, to r

(a) Mechanism of interlocking of plasmid DNAs to lac repressor-operator interactions .

interaction due to lac Figure 6. Protein-protein interlocking of repressor tetramerization promotes plasmid DPu’As. E. co& MC1060, the Zac repressor deletion strain (Casadaban & Cohen, 1980), harboring both pAOSLO and either one of the two plasmids, pSOlOl0 (A) and pSOll0 (B), was treated with novobiocin (final concn. 500 ,ug/ml) and oxolinic acid (final concn. 100 pg/ml) for 30 min during log phase growth prior to DNA isolation. DPu’As were then isolated and analyzed by Z-dimensional gel electrophoresis. Each group of DNA topoisomers is labeled with a number near the upper apex of its triangle pattern. I and II indicate the monomeric and dimerie topoisomer populations of pAOSLO DNA, respectively. Ie, indicates the monomeric topoisomers population of pSOlOl0 DNA in (A), which expresses wild-type Zac repressor or pSOll0 DPU’A in (B), which expresses mutated Zac repressor (defective only in tetramerization). The spots marked n at the left side of upper apices of each group of DNA topoisomers indicate the position of nicked DNA. Interlocked dimers of pAOSLO DNA (marked i in (A)) are distributed within the triangle pattern labeled II. The same interlocked dimer populations are not detected in the corresponding region shown in (B).

(e) Non-tetramering lac repressor does not promote interloclcing of the plasmids Our results have suggested that the interlocking of lac operator-containing plasmids requires the expression of lac repressor in trans. To show that the protein-protein interaction between lac repressors is essential for promoting these interlocking processes, we have introduced wild-type or mutated lac repressor into E. coli MC 1060 (a ZacI deletion strain) harboring pAO-SLO via one of the following pACYC-based plasmids, pSOlOl0 and pSO110. pSOlOl0 expresses wild-type Zac repressor via the synthetic promoter that is sevenfold weaker than the iq promoter (Oehler et al., 1990). The expression of Zac repressor from pSOlOl0 in E. co&i MC 1060 promoted the formation of interlocked dimers of pAO-SLO (marked i in Fig. 6(A)). pSOll0 expresses mutated lac repressor, which is defective in tetramerization but retains DNA binding activity of this (Lehming et al., 1987). The expression dimeric active Zac repressor gene on pSOl10 is also mediated by the same synthetic promoter as in pSO1010. No interlocked dimers of pAO-SLO (DNA

due

We have shown that the formation of interlocked dimers requires both the presence of a lac repressor binding site on the plasmid DNAs and the expression of the Zac repressor in the host cells. The simplest explanation for our results is that interlocked dimers are formed as a result of an interaction between lac repressor and two operators, each of which is on a plasmid DNA molecule. This type of intermolecular interaction mediated by lac repressor can be readily explained by the current model of the operator-tetrameric lac repressoroperator ternary complex (Kania & Miiller-Hill, 1977; Besse et al., 1986; Eismann et al., 1987; Kramer et al., 1987; Oehler et al., 1990). The formation of ht-i (Fig. 5) between pACYC-SLO and pAOSLO DNAs suggests that interlocking may be catalyzed by a DNA topoisomerase (e.g. gyrase) on a pair of plasmid DNAs brought together by the tetrameric Zac repressor complex (see Fig. 7 for a schematic diagram). As interlocking due to lac repressor binding has been observed in the topAdeletion E. coli strain, DM800 (H.-Y. Wu $ L. F. Liu, unpublished data), topoisomerase I is not a candidate topoisomerase for interlocking. The known activity of DNA gyrase to promote eflicient catenation and decatenation suggests a potential role of gyrase in the formation of interlocked molecules in our system. However, the discovlery of E. coli DNA topoisomerase IV has clouded this issue (Kato et al., 1990). The rather small population of interlocked plasmid DNAs could be in part due to the low copy number of lac repressor molecules. There are only five to ten copies of Zac

Figure 7. A proposed mechanism for plasmid DNA interlocking due to the formation of a Zac operatorrepressor-operator ternary complex.

1112

H.-Y.

repressor molecules per cell, compared with 59 to 100 copies of plasmid DNAs in the same cell. Other factors, such as topoisomerase activity, may also limit the population of interlocked dimers. (b) A possible role of DNA replication in the ,formation of multiply interlocked homodimers The formation of multiply interlocked dimers (C,) may indicate the involvement of DNA replication in addition to the formation of tetrameric lac repressor-operator complexes. It is possible that simultaneous binding of a tetrameric lac repressor complex to two separate DNA molecules is an inefficient event. However, at the terminal stage of DNA replication, the two daughter molecules are in close proximity. The simultaneous binding of a single tetrameric lac repressor complex to both daughter molecules may thus be facilitated. The increase in the amount of multiply intertwined dimers (C,) of pAO-SLO DNA may indicate that simultaneous binding of the tetrameric lac repressor complex actually precedes their segregation into monomeric circles. The binding of lac repressor tetrameric complex to the multiply intertwined daughter molecules is expected to effect a significant decrease in their rate of segregation into monomeric circles by DNA gyrase. The tetrameric lac repressor complex may initially bind to a single operator site on the parental pAO-SLO DNA. AS soon as the operator site is replicated and before the two daughter DNA molecules are segregated, the tetrameric complex may bind simultaneously to both operator sites, one on each daughter DNA molecule. The segregation of the tetrameric lac repressor complex on the parental DNA into daughter DNA molecules during replication may be similar to that of nucleosomes (Bonne-Andrea et al., 1990). Further studies are necessary to establish the mode of segregation of this multimeric DNA binding protein. The presence of the B, series of interlocked dimers of pAO-SLO DNA is interesting. This series represents multiply intertwined dimers with one nicked or gapped molecule. It is reasonable to conceive that such multiply intertwined dimers with one daughter DNA molecule in the nicked or gapped state (B,) are initial replication products. Closure of the nick or gap converts B, into C,. The finding that B, was not converted to B, (m < n), while C, was converted to C,, in novobiocin-treated cells is intriguing. It may suggest that the conversion of B, to C, is faster than that of B, to B,. The kinetic block for the conversion of B, to 8, may indicate a unique stable structure of B,. The replication proteins may either stabilize the interlocked structure of B, or the single-stranded region in the gap may somehow stabilize B,. (c) Plasrnid DNA recombination is enhanced due to lac repressor binding to operator sites Our studies of pT03 have also revealed that the rate of plasmid DNA dimerization in recA+ cells is

wu et ai

enhanced by lac repressor-operator interaction. It seems possible that both the formation of interlocked dimers and plasmid dimerization may be due to the same interaction between the lac repressor and the operators. Although multiple pathways exist for plasmid recombination (Dohert,y et al.: 1983), the synapsis of two recombining molecules may be one of the common rate-limiting steps. Simult’aneous binding of the lac repressor to operator sites on two daughter DNA molecules may enhance the efficiency for synapsis and hence increase the rate of recombination. This is consistent with the previous findings that inter!ocked DNA is recombinogenic both in vitro and in &o (Doniger et al., 1973; Benbow et al., 1975; Kolodner, 1980). (d) Knotting

of plasmid DXAs lac repressor

is in,dependent

uj

A significant population of pT0 and pT03 DNAs was found to exist in topologically knotted forms. However, the formation of these knotted populations appears to be independent of the interaction between the lac repressor and the operators. pA0 DXA isolated under the same conditions contained significantly less of the knotted DNA populat,ions (unpublished results), suggesting that the tetA gexte may enhance the formation of knotted DNA. Our results are consistent with previous studies, which show that the formation of knotted pBR322 D&A is dependent upon transcription of the tetA gene (Shishido et al., 1989). The nature of the knots is not known at present. However, closed-circular knot&d DNA appears to derive specifically from the highly negatively supercoiled population of pT0 and pTQ3 DEAs as the more negatively supercoiled topoisomers in the dimer regions of pT0 and pTQ3 DNAs are conspicuously missing. This occurred while a single arc (K,*‘): which presumably represents topologically knotted Dh’As in their closedcircular forms, appeared (Fig. 4(C) and (D)). It is possible that knot formation is favored at higher superhelical density (Liu et al., 1980). The presence of just, a single arc (Kz’) rather than mult.iple arcs as observed for interlocked dimers (C,) may be due to the st’rong dependency of knot formation on superhelical density. This explanation is consistent with several studies that reveal the effects of nega.tive interwound superhelix on the formation of knotted DNA (Shishido et al., 1987, 1989; Ishii et al., 1951; Wasserman & Cozzarelli, 1991). The frequency of knot, formation may also depend on the size of the plasmid DNA (Frank-Kamenetskii et al., 1975). The Kz for the monomeric population of pTO/ TO3 DNAs appears to migrate in the gel as a single spot rather than an arc close to the diagonal line formed by nicked circular DNAs (Fig. 4(C) and (D)). The K,*, which presunmbly represents monomeric forms of closed-circular knotted DNA; may be derived from monomeric pTOjTO3 DNAs with much higher super-helical density d.ue to their smaller sizes. The preferential effect of the tetA gene

Lac Repressor-Operator

over the bla gene on the formation of knotted DNA is not understood. However, transcription of the tetA gene has been shown to have a preferential effect over that of the bla gene on the hypernegative supercoiling of pBR322 DNA in E. co& DM800 (a AtopA strain) (Pruss & Drlica, 1986; Wu et al., 1988). Mapping of gyrase sites by oxolinic acid has indicated that there are more gyrase sites within and/or in the vicinity of the tetA gene during transcription (Lockshon & Morris, 1985; Koo et al., 1990). The increased gyrase activity in the tetA gene region may contribute to increased levels of knotted pT0 DNA. This possibility has been confirmed by one of our recent experiments that the plasmid pJW27011, which is a pBR322 derivative with an inducible lac UV5 promoter controlling the expression of the tetracycline resistant gene, was dependent on expression of the tetracycline resistance gene for the formation of knotted DNA (H.-Y. Wu & L. F. Liu, unpublished data). In contrast to the preferential knotting of pT0 DNA over pA0 DNA, pA0 DNA contains a much larger population of multiply interlocked dimers (B, and C,) over pT0 DNA. The presence of more gyrase sites on pT0 DNA may increase the rate of segregation of multiply interlocked daughter DNA molecules and thus decrease the steady-state level of interlocked dimers of pT0 DNA. In summary, our studies have demonstrated that accumulation of multiply interlocked dimers and the increased rate of plasmid dimerization may be due to the same interaction between lac repressor and operator sites. The various topological forms of plasmid DNAs in cells may be particularly useful in the analysis of protein-DNA and protein-protein interactions in viva. This kind of analysis of the topological structures of plasmid DNAs may be applicable to the studies of other DNA binding proteins. We are grateful to Drs Annette Bodley and Erasmus Schneider for critical reading of the manuscript, and to Dr Benno Miiller-Hill for providing their plasmid constructs. This work was supported by an NIH grant GM 27731. L.F.L. is a recipient of George Hitchings Award from the Burroughs Wellcome Co. References Benbow, R. M., Zuccarelli, A. J. & Sinsheimer, R. J. (1975). Recombinant DNA molecules of bacteriophage $X174. Proc. Nat. Alcad. Sci., U.S.A. 72, 235-239.

Besse, M., von Wilcken-Bergmann; B. & Miiller-Hill; B. (1986). Synthetic Zac operator mediates repression through lac repressor when introduced upstream and downstream from lac promoter. EMBO J. 5; 1377-1381. Bonne-Andrea, C., Wong, M. L. & Alberts, B. M. (1990). In vitro replication through nucleosomes without histone displacement Nature (London), 343, 719-726. J. & Ptashne, M. (1990). Carey, M., Leatherwood, A potent GAL4 derivative activates transcription at a distance in vitro. Science, 247, 710-712. Casadaban, M. J. & Cohen, S. N. (1980). Analysis of gene

Interaction control

1113

signals

fusion and cloning in 138, 179-207. Chang, A. C. Y. & Cohen, S. N. (1978). Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacterial. 134, 1141-1156. Doherty, M. J., Morrison, P. T. & Kolodner, R. (1983). Genetic recombination of bacterial plasmid DNA: Physical and genetic analysis of the products of plasmid recombination in Escherichia coli. J. Mol. Biol. 167, 539-560. Doniger, J.; Warner, R. C. & Tessman, I. (1973). Role of circular dimer DNA in the primary recombination mechanism of bacteriophage S13. Nature (London), 242, 9-12. Dunn, T. M., Hahn, S.; Ogden, S. & Schleif, R. F. ((1984). An operator at -280 base pairs that is required for repression of araBAD operon promoter: addition of DNA helical turns between the operator and promoter cyclically hinders repression. Proc. Nat. Acad. Sci., U.S.A. 81, 5017-5020. Eismann, E., von Wilcken-Bergmann, B. & Miiller-Hill, B. (1987). Specific destruction of the second Zac operator decreases repression of the lac operon in Escherichia coli fivefold. J. Mol. Biol. 195, 94!1-952. Frank-Kamenetskii, J. D., Lukashin, A. V. 85 Vologodskii, A. V. (1975). Statistical mechanics and topology of polymer chains. Nature (London), 258, Escherichia

by

DNA

coli. J. Mol.

Biol.

398402.

Griffith, J., Hochschild, A. & Ptashne, M. (1986). DNA loops induced by cooperative binding of i repressor. Nature (London), 322, 750-752. Halligan, B. D., Edward, K. A. & Liu, L. F. (1985). Purification and characterization of a type 1-CDNA topoisomerase from bovine calf thymus. J. Biol. Chem.

260,

2475-2482.

Hochschild, A. & Ptashne, M. (1986). Cooperative binding of i repressors to sites separated by integral turns of the DNA helix. Cell, 44, 681-687. Hochschild, A. & Ptashne, M. (1988). Interaction at a distance between lambda repressors disrupts gene 336, 353-357. activation. Nature (London), Hofmann, J. F.-X., Laroche, T., Brand, A. H. & Gasser, S. M. (1989). RAP-l factor is necessary for DNA loop formation in vitro at the silent mating type locus HML. Cell, 57, 725-737. Hsieh, W.-T., Whitson, P. A., Matthews, K. S. &. Wells, R. D. (1987). Influence of sequence and distance between two operators on interaction with the lac repressor. J. Biol. Chem. 262, 14583314591. Ishii, S., Murakami, T. & Shishido K. (1991). Gyrase inhibitors increase the content of knotted DNA species of plasmid pBR322 in Escherichia coli. J. Bacterial. 173, 5551-5553. Jacob, F. & Monod, J. (1961). Genetic regulatory mechanisms in the synthesis of proteins. J. Mol. Biol. 3; 318-356.

Kania, J. & Miiller-Hill, B. (1977). Construction, isolation and implications of repressor-galactosidase. fi-galactosidase hybrid molecules, Eur. J. Biochem. 79, 381-386.

Kato, J., Nishimura, Y., Imamura, R., Niki, H., Hiraga, S. & Suzuki, H. (1990). New topoisomerase essential for chromosome segregation in E. coli. Cell, 63, 393404.

Kolodner, R. (1980). Genetic recombination plasmid DNA: electron microscopic in vitro intramolecular recombination. Acad. Sci., U.S.A. 77, 4847-4851.

of bacterial analysis of Proc.

Nat.

1114

H.-Y.

Koo, H.-S., Wu, H.-Y. 8: Liu: F. L. (1990). Effect of transcription and translation on gyrase-mediated DNA cleavage in Escherichia co&. J. Biol. Chem. 265: 1230&12305. Kramer, H., Niemoller, M., Amouyal, M., Revet, B., von Wilcken-Bergmann, B. & Miiller-Hill, B. (1987). Zac repressor forms loops with linear DNA carrying two spaced lac operators. EM30 J. 6, suitably 1481-1491. Lehming, N., Sartorius, J., Niemoller, M., Genenger, G., von Wilcken-Bergmen, B. & Miiller-Hill, B. (1987). The interaction of the recognition helix of lac repressor with Eat operator. EMBO J. 6, 31453153. Liu, L. F., Liu, C. C. & Alberts, B. M. (1980). Type II DNA topoisomerases. Enzymes that can unknot a topologically knotted DNA molecule via a reversible double-&and break. Cell, 19, 697-707. Lobell, R. B. & Schleif, R. F. (1990). DNA looping and unlooping by AraC protein. Science, 250: 528-532. Lobell; R. B. 85 Schleif, R. F. (1991). AraC -DNA looping: orientation and distance-dependent loop breaking by the cyclic AMP receptor protein. J. Mol. Biol. 218; 45-54. Lockshon, D. & Morris, D. R. (1985). Site of reaction of Escherichia coli DNA gyrase on PBR322 in vivo as revealed by oxolinic acid-induced plasmid linearization. J. Mol. Biol. 181, 63-74. Martin, K., Huo, L. & Schleif, R. (1986). The DNA loop model for ara repression: AraC protein occupies the proposed loop sites in vivo and repression-negative mutations lie in these same sites. Proc. Nat. Acad. Sci., U.S.A. 83, 3654-3658. Miron, A., Mukherjee, S. & Bastia, D. (1992). Activation of distant replication origins in vivo by DNA looping as revealed by a novel mutant form of an initiator protein defective in cooperativity at a distance. EMBO J. 11, 1205-1216. Mossing, M. C. & Record, M. T. J. (1986). Upstream operators enhance repression of the Zac promoter. Science, 233, 889892. Muller, H., Sogo, J. M. & Schaffner, W. (1989). An enhancer stimulates transcription in trans when attached to the promoter via a protein bridge. Cell, 58, 767-777. O’Gorman, R. B., Dunaway, M. & Matthews, K. S. (1980). DNA binding characteristics of lactose repressor and the trypsin-resistant core repressor. J. Biol. Chem. 255, 10100~10106. Oehler. S., Eismann, E. R., Kramer, H. & Miiller-Hill, B. (1990). The three operators of the Zac operon cooperate in repression. EMBO J. 9, 973-979. Pruss, G. J. & Drlica, K. (1986). Topoisomerase I mutants: the gene on pBR322 that encodes resistance to tetracycline affects plasmid DNA supercoiling. Proc. Nat. Acad. Sci., U.S.A. 83, 8952-8956.

Edited by Xas

Wu

et a!.

Ptashne, M. (1986). Gene regulation by prot’eins acting nearby and at a distance. Nature (London), 322, 697-701. Ptashne; M. (1988). How eukaryotic transcriptional a&ivators work. Nature (London)? 335, 683-689. Saldanha, R., Flanagan, P. & Fennewald, M. (1987). Recombination by resolvase is inhibited by lac repressor simultaneously binding operators between r-essites. J. Mol. Biol. 196, 505-516. Schatt, M. D., Rusconi, S. & Schaffner, W. (1990). A single DNA-binding transcription factor is suflicient for activation from a distant enhancer and or from a promoter position. EMBO J. 9, 481487. Schleif, R. (1987). Why should DNA loop? Nature (London), 327, 369-370. Sekiguchi, M. 8 Iida, S. (1967). Mutants of Escherichia coli permeable to actinomyein. Proc. Nat. Acad. Sei.; G.S.A. 58, 2315-2320. Shishido, K.; Komiyama. N. & Ikawa, S. (1987). Increased production of a knotted form of plasmid pBR,322 DNA in Escherichia coli DNA topoisomerase mutants, J. Mol. Biol. 195: 215-218. Shishido, K., Ishii, S. & Komiyama, N. (1989). The presence of the region on pBR322 that encodes resistance to tetracycline is responsible for high levels of plasmid DNA knotting in Escherichia coli DNA topoisomerase I deletion mutant. Nucl. Acids Res. 17; 9749-9759. Stiiber D. $ Bujard H. (1981). Organization of transcriptional signals in plasmids pBR322 and pACYC184. Proc. Nat. Acad. Sci., U.S.A. 78; 167-171. Sundin, 0. & Varshavsky, A. (1981). $rrest of segregation leads to accumulation of highiy intertwined catenated dimers: dissection of the final stages of $1’40 DNA replication. Cell, 25, 659-669. Wasserman, S. A. & Cozzarelli, N. R. (1991). Supercoiled DNA-directed knotting by T4 topoisomerase. J. Biol. Chem. 266, 20567-20573. Whitson, P. A. & Matthews, K. S. (1986). Dissociation of the lactose repressor-operator DNA complex: effects of size and sequence context of operator-containing DNA. Biochemistry, 25, 3845-3852. Whitson, P. A., Olson, J. S. & Matthews, K. S. (1986). Thermodynamic analysis of the lactose repressoroperator DNA interaction. Biochemistry, 25, 385223858. Wu; H.-Y. & Liu, L. F. (1991). DNA looping alters local DNA4 conformation during transcription. J. Mol. Biol. 219, 615-622. Wu, H. Y., Shyy, S. H., Wang, J. C. & Liu, L. F. (1988). Transcription generates positively and negatively supercoiled domains in the template. CeZl, 53, 433440.

E. Qottesman