Intramuscular electroporation of a P1A-encoding plasmid vaccine delays P815 mastocytoma growth.

BIOJEC-06707; No of Pages 7 Bioelectrochemistry xxx (2013) xxx–xxx

Contents lists available at ScienceDirect

Bioelectrochemistry journal homepage: www.elsevier.com/locate/bioelechem

Intramuscular electroporation of a P1A-encoding plasmid vaccine delays P815 mastocytoma growth Gaëlle Vandermeulen a, Catherine Uyttenhove b, Etienne De Plaen b, Benoît J. Van den Eynde b, Véronique Préat a,⁎ a b

Louvain Drug Research Institute, Pharmaceutics and Drug Delivery, Université catholique de Louvain, 1200 Brussels, Belgium Ludwig Institute for Cancer Research, Brussels Branch and de Duve Institute, Université catholique de Louvain, 1200 Brussels, Belgium

a r t i c l e

i n f o

Article history: Received 27 June 2013 Received in revised form 20 November 2013 Accepted 23 November 2013 Available online xxxx Keywords: Electroporation Electrotransfer Cancer DNA vaccine P1A P815 mastocytoma

a b s t r a c t This study aimed to construct DNA vaccines encoding the mouse P1A tumor antigen and to generate a protective immune response against the P815 mastocytoma, as a model for vaccines against human MAGE-type tumor antigens. DNA vaccines were constructed and delivered to mice by intramuscular electroporation before tumor challenge. Immunization with a plasmid coding for the full-length P1A significantly delayed tumor growth and mice survived at least 10 days longer than untreated controls. 10% of the mice completely rejected the P815 tumors while 50% of them showed a regression phase followed by tumor regrowth. Mice immunized by electroporation of a P1A35–43 minigene-encoding plasmid failed to reject tumor and even delay tumor growth. The P1A35–43-encoding plasmid was modified and helper epitope sequences were inserted. However, these modified plasmids were not able to improve the response against P815 mastocytoma. Consistent with these results, a 12fold higher CTL activity was observed when the plasmid coding for full-length P1A was delivered as compared to the plasmid encoding the P1A35–43 epitope. Our results demonstrated that electroporation is an efficient method to deliver DNA vaccines against P815 and suggested the superiority of full-length as compared to minigene constructs for DNA vaccines. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Today, the development of efficient cancer treatments remains a priority and a real challenge. The treatment of tumors usually combines several approaches like surgical ablation, radiotherapy, chemotherapy and immunotherapy. Immune therapy for cancer includes the delivery of monoclonal antibodies, specific T cells, immune adjuvants or cytokines and vaccines [1]. The use of DNA as cancer vaccine presents several advantages [2–4]: (i) The development of DNA vaccine is easy and all plasmids can be produced by similar techniques; (ii) plasmids are very stable and allow long-term storage; (iii) different proteins or peptides can be encoded by the same plasmid and induce simultaneous immunization against several antigens; (iv) unmethylated CpG motifs promote TLR-9-dependent immune activation. However, the low immunogenicity of most tumor antigens limits the efficiency of cancer DNA vaccines. Several delivery methods have been developed in order to partly overcome this problem. Among them, electroporation has been widely used to introduce DNA into various types of cells in vitro and is one of the most efficient non-viral methods to enhance gene transfer in various tissues in vivo. It involves plasmid injection and application of high ⁎ Corresponding author at: Université catholique de Louvain, Louvain Drug Research Institute, Avenue Mounier 73, bte B1.73.12, 1200 Brussels, Belgium. Tel.: + 32 2 764 7309; fax: +32 2 764 7398. E-mail address: [email protected] (V. Préat).

voltage pulses that, on one hand, transiently disturb membranes and thus increase cell permeability and, on the other hand, promote electrophoresis of negatively charged DNA [5,6]. The muscle has been extensively studied as a delivery target for electroporation, allowing high and sustained gene expression and immune response [7–10]. A recent clinical study reported that a DNA vaccine delivered by intramuscular electroporation and coding for the fragment C of tetanus toxin linked to an HLA-A2-binding epitope from prostate-specific membrane antigen was safe, well tolerated and induced high frequency of immunological responses and promising clinical effects [11]. An important class of human tumor-specific antigens used in cancer vaccines currently in late phase of clinical development correspond to peptides derived from proteins encoded by cancer-germline genes such as the MAGE genes [12,13]. These genes are expressed in many tumors but are silent in normal tissues, with the exception of male germline cells, which do not express MHC class I molecules and therefore do not display the antigenic peptide at their surface. Gene P1A is a mouse cancer-germline gene encoding a tumor antigen that represents the best mouse model for human MAGE-type tumor antigens [14,15]. It encodes the major tumor rejection antigen of mastocytoma P815. This antigen, named P815A, is composed of a peptide (LPYLGWLVF, P1A35–43) derived from the P1A protein and presented to cytotoxic T lymphocytes (CTL) by MHC class I molecule H-2 Ld [16]. P1A is activated in several tumors but silent in normal cells except in placental trophoblasts and male germline cells. Again, because these

1567-5394/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bioelechem.2013.11.002

Please cite this article as: G. Vandermeulen, et al., Intramuscular electroporation of a P1A-encoding plasmid vaccine delays P815 mastocytoma growth, Bioelectrochemistry (2013), http://dx.doi.org/10.1016/j.bioelechem.2013.11.002

2

G. Vandermeulen et al. / Bioelectrochemistry xxx (2013) xxx–xxx

cells do not bear surface MHC class I molecules, they do not present the P1A peptide, so antigen P815A is strictly tumor-specific, and immunization against this peptide does not induce autoimmune side-effects [17]. These similarities of expression between the human tumor antigens of the MAGE-type and the antigen encoded by P1A make it a relevant model to test different vaccination modalities with possible applications in human medicine [18]. Several peptide cancer vaccines have been developed and many clinical trials of peptide vaccines have been carried out [19]. One strategy to increase peptide vaccine efficiency consisted in adding helperpeptides such as VIL1 (VQGEESNDK) and PADRE (AKFVAAWTLKAAA). The VIL1 sequence codes for the IL-1β163–171 peptide which reproduces the immunostimulatory and adjuvant effects of the whole mature IL-1β but without its side effects [20]. Insertion of a VIL1 encoding sequence enabled a DNA vaccine to inhibit mammary carcinogenesis in a transgenic mouse model [21] and showed adjuvant activity for DNA vaccines against hepatitis B [22] and foot-and-mouth disease viruses [23]. The universal Pan-DR epitope (PADRE) is recognized by T helper lymphocytes [24] and, combined with DNA vaccine, led to an increase in the number of antigen-specific CD8+ T cells, resulting in potent protective and therapeutic anti-tumor effects [25–27]. Previous results demonstrated that VIL1 and PADRE peptides were able to enhance the immunogenicity of a P1A35–43 peptide vaccine [28,29] (and unpublished data). Several DNA-based approaches have already been studied to promote an immune response against P815 tumor. Semliki Forest virus (SFV), adenovirus and ALVAC poxvirus vectors expressing P1A have been evaluated for their ability to induce a CD8+ T cell response against the P815A antigen and a heterologous prime-boost comprising an adenovirus-P1A injection followed by a SFV-P1A boost resulted in the highest protection of mice against tumor challenge [30]. In another study, a P1A replicon DNA complexed with bupivacaine induced a less potent response as compared to SFV [31]. Pretreatment with cardiotoxin (another muscle-degenerating substance) enhanced the immune response induced by a P1A-expressing plasmid while gene gun failed to induce a CTL response [32]. Both viruses and myotoxins raise potential safety issues for clinical use and the development of delivery methods for cancer DNA vaccines remains critical. Here, we hypothesized that intramuscular electroporation could be a safe and efficient way to deliver DNA vaccines directed to P815 mastocytoma. This study aimed (i) to construct DNA vaccine plasmids expressing either the P1A tumor antigen or the P1A35–43 antigenic peptide and (ii) to generate an immune response against the P815 tumor by DNA electroporation.

sites and the VIL1 encoding sequence, using the following primers: 5′ATCGGCGGCCGCACCGACTCCGACGAAACTAC-3′ (IRES-Forw) and 5′TAGCGGGCCCCTATTTATCGTTACTTTCTTCACCCTGAACCATAGTGTCAATA GTAATAAAAAGG-3′ (IRESVIL1-Rew). Then, the amplified fragment was digested by NotI and ApaI and directionally inserted into the opened pVAX2-miniP1A. The pVAX2-miniP1A-IRES-PADRE plasmid was obtained in the same way using IRES-Forw and 5′-TAGCGGGCCCCTAAGCAGCA GCTTTAAGAGTCCAAGCAGCAACAAATTTAGCCATAGTGTCAATAGTAAT AAAAAGG-3′ (IRESPADRE-Rew) as primers. The resulting plasmids were sequenced using BigDye XTerminator Purification Kit (Invitrogen, Merelbeke, Belgium). In order to construct the pVAX2-P1A plasmid, pVAX2 and pEF4/V5-His-P1A plasmids were first digested by BamHI and NotI restriction endonucleases. The digested 1 kb P1A fragment was then extracted from the agarose gel and directionally subcloned into pVAX2. A summary of the plasmid constructs is provided (Table 1). Plasmids were prepared using EndoFree Plasmid Giga Kit (Qiagen, Venlo, Netherlands) according to the manufacturer's protocol. The quality of resulting plasmid was assessed by the ratio of optical densities (260 nm/280 nm) and by 0.7% agarose gel electrophoresis. Optical density at 260 nm was used to determine DNA concentration. All plasmid dilutions were done in Phosphate Buffer Saline (PBS). Plasmids were stored at −20 °C before use. 2.2. Animals DBA/2 OlaHsd-inbred female mice were obtained from Harlan Nederland. Mice were between 8 and 10 weeks old at the beginning of the experiments. Just before the electroporation procedure, mice were anesthetized with 150 μl of a solution of ketamine 10 mg/ml (Ketalar, Pfizer, Brussels, Belgium) and xylazine 1 mg/ml (Sigma, Bornem, Belgium). Before electroporation, mice were shaved using a rodent shaver (Aesculap Exacta shaver, AgnTho's, Sweden). All experimental protocols in mice were approved by the Ethical Committee for Animal Care and Use of the Medical Sector of the Université catholique de Louvain. 2.3. Cell lines

2. Materials and methods

Several clones of P815 mastocytoma were used in this study: P511 expressing the P815A antigen and P1.204 which has lost P1A expression [14]. P815B cells were used for the tumor challenge because they do not express indoleamine 2,3-dioxygenase [34]. L1210.P1A.B.7.1 is a leukemia cell line derived from a DBA/2 mouse and stably transfected to express the P1A antigen and the B7-1 costimulatory molecule [35]. All the cell lines were from the Ludwig Institute for Cancer Research and were grown as described previously [17].

2.1. Plasmids

2.4. Immunization

Several plasmids were cloned and used in this study. pVAX2 that was obtained by replacing the cytomegalovirus promoter of pVAX1 (Invitrogen) by that of pCMV-β (Clontech) and pVAX2-LUC encoding luciferase were kindly provided by Dr Pascal Bigey (Université Paris Descartes, Paris, France). The pVAX2-miniP1A and pVAX2-miniP1AVIL1 plasmids were obtained from pVAX2 by incorporating two complementary and overlapping phosphorylated oligonucleotides with BamHI and NotI restriction sites (Eurogentec, Seraing, Belgium): 5′-GATCCGCCATGCTGCC TTATCTAGGGTGGCTGGTCTTCTAGGC-3′ (miniP1A-Forw) and 5′-GGCC GCCTAGAAGACCAGCCACCCTAGATAAGGCAGCATGGCG-3′ (miniP1ARew); 5′-GATCCGCCATGCTGCCTTATCTAGGGTGGCTGGTCTTCGTTCAGGG TGAAGAAAGTAACGATAAATAGGC-3′ (miniP1AVIL1-Forw) and 5′-GGCC GCCTATTTATCGTTACTTTCTTCACCCTGAACGAAGACCAGCCACCCTAGAT AAGGCAGCATGGCG-3′ (miniP1AVIL1-Rew). To obtain the pVAX2miniP1A-IRES-VIL1 plasmid we first amplified the Theiler's virus IRES sequence [33] (kindly provided by Prof Thomas Michiels, University of Louvain, Brussels, Belgium) by PCR, adding NotI and ApaI restriction

We injected 50 μg pVAX2-P1A or equimolar amounts of pVAX2miniP1A, pVAX2-miniP1AVIL1, pVAX2-miniP1A-IRES-VIL1 or pVAX2miniP1A-IRES-PADRE diluted in 30 μl of PBS into the left tibial cranial muscle. As a negative control, mice were injected with either pVAX2 empty vector or pVAX2-LUC plasmid. Then, we placed the left leg between plate electrodes and we delivered 8 square-wave rectangular Table 1 Plasmid constructs and encoded protein/peptide(s). Plasmid

Size (bp)

Encoded protein/peptide(s)

pVAX2-empty pVAX2-LUC pVAX2-P1A pVAX2-miniP1A pVAX2-miniP1AVIL1 pVAX2-miniP1A-IRES-VIL1 pVAX2-miniP1A-IRES-PADRE

2933 4626 3937 2926 2953 3606 3619

– Luciferase Tumor rejection antigen P1A LPYLGWLVF LPYLGWLVFVQGEESNDK LPYLGWLVF and VQGEESNDK LPYLGWLVF and AKFVAAWTLKAAA



3

Scheme 1. Immunization schedule and tumor challenge.

electric pulses (200 V/cm, 20 ms with 480 ms pause between pulses) [8]. Conductive gel was used to ensure electrical contact with the skin (EKO-GEL, ultrasound transmission gel, Egna, Italy). The pulses were delivered by a Cliniporator system (Cliniporator, IGEA, Carpi, Italy) using 4 mm plate electrodes (IGEA, Carpi, Italy). Two boosts (i.e. second and third administrations of the vaccine) were similarly applied two and four weeks after the priming [8] (Scheme 1). As a positive control, mice were immunized by two intra-peritoneal injections of L1210.P1A.B.7.1 cells (106 living cells) in 500 μl of PBS at two weeks of interval. 2.5. Luciferase expression and immune response To measure luciferase expression, mice were anesthetized with ketamine/xylazine. Optical imaging was acquired, 10 min after i.p. injection of 3 mg luciferin in 100 μl of PBS, using an IVIS50 system (Xenogen Corporation, Alameda, CA, USA). Sera were sampled every two weeks and anti-luciferase total immunoglobulin G titers were determined by ELISA [8]. Briefly, 96-well plates were coated overnight at room temperature with 100 ng per well of recombinant luciferase (Promega, Leiden, The Netherlands). After washing and blocking with BSA, samples were loaded, 3-fold diluted and incubated for 2 h at 37 °C. LO-MGCOC-2 labeled with peroxidase (IMEX, UCL, Brussels, Belgium) were used to determine total immunoglobulin titers, defined as dilution factor giving an optical density equal to the limit of quantification at 492 nm after OPDA (o-phenylenediamine) substrate revelation.

were cultured for 7 days in 48-well plates with 1.5 × 105 irradiated (10,000 rad) stimulating L1210.P1A.B.7.1 cells and 2 × 106 irradiated (3000 rad) syngeneic splenocytes as feeder cells. Lytic activity was then measured in a chromium release assay as previously described [17,30]. Briefly, effector cells were collected, 3-fold diluted in duplicate in V-shaped 96-well plates and mixed with 1000 51Cr-labeled P511 or P1.204 cells and 1 × 105 unlabeled P1.204 competitor cells in a final volume of 150 μl DMEM 5% FCS. Radioactivity was measured with a Wizard 1470 Automatic gamma counter (Wallac) after 4 h incubation at 37 °C from 100 μl of supernatant mixed with 150 μl of scintillation fluid. Specific lytic unit (LU) was defined as the number of cells that lyse 50% of 104 target cells in 4 h. This number was estimated by the means of the regression (1 − e−kx), from the specific release obtained at 3 different effector-to-target ratios chosen in the linear range of the lysis curve. The results are expressed in specific lytic units/106 effector cells. 2.7. Tumor challenge 3 to 4 weeks after the second boost, mice were challenged with P1Aexpressing P815B. Cells were counted using a Bürker cell counting chamber and 106 cells diluted in 100 μl PBS were injected subcutaneously into the flank of each mouse [30]. The tumor size was measured twice per week with an electronic digital caliper and tumor volume was calculated as the length × width × height (in mm3). Mice were sacrificed when the volume of the tumor grew larger than 1500 mm3 or when they were in poor condition and expected to die shortly.

2.6. Chromium release assay

2.8. Statistical analyses

Blood (500 to 800 μl) was collected from retro-orbital sinus two weeks after the last boost and the peripheral blood lymphocytes (PBLs) were isolated using a Ficoll-Paque gradient. The lymphocytes

Statistical analyses were performed using the software GraphPad Prism 5 for Windows. 3. Results and discussion 3.1. Immunization by electroporation into the muscle induced a potent antibody response against luciferase

Fig. 1. Luciferase expression and antibody response after electroporation. Luciferase expression and immune response after electroporation of pVAX2-LUC as a function of time (day) (n = 3). Empty circle represent the mean ± SEM of luciferase expression and each black circle represents the anti-luciferase total immunoglobulin titers (mean ± SEM).

To define the immunization schedule, we first used a pVAX2-LUC plasmid which carries the luciferase reporter gene. This plasmid allows simultaneous assessment of transgene expression and immune response without having to sacrifice mice [8,36]. Electroporation of pVAX2-LUC into the muscle was performed by injection to the tibial cranial muscle and immediately followed by the application of 8 squarewave electric pulses (200 V/cm, 20 ms, 2 Hz). This delivery method induced high and sustained luciferase expression (Fig. 1). Electroporation has been widely studied in the past for drug delivery and DNA electrotransfer (i.e. the in vivo transfer of DNA mediated by electric pulses). It was previously reported that electroporation allowed up to ~ 100-fold increase of gene expression [7,8,37] and expression of the transgene was observed up to one year after treatment [38]. No anti-luciferase antibodies were detected two weeks after the first delivery and at least one boost was required to generate an immune response (Fig. 1). Anti-luciferase antibody titers were further increased after the second boost. Based on these results, the P1A-based plasmids


4


Fig. 3. P815 challenge after immunization with plasmid encoding the P1A antigenic peptide and helper-peptides. Mice immunized (i) by electroporation of pVAX2-miniP1A fused to VIL1 peptide (n = 10), (ii) co-expressed with VIL1 (n = 10), (iii) co-expressed with PADRE (n = 10) or (iv) by intra-peritoneal injections of L1210.P1A.B.7.1 cells (n = 9). Survival curves representing the percentage of mice alive (%) as a function of time (day). Statistical analysis: Log-Rank (Mantel–Cox) test (**p value b 0.01).

Fig. 2. P815 challenge after pVAX2-miniP1A immunization. Mice immunized by electroporation of pVAX2-miniP1A (n = 10) or by intra-peritoneal injections of L1210.P1A.B.7.1 cells (n = 9). Panel A: Survival curves representing the percentage of mice alive (%) as a function of time (day). Statistical analysis: Log-Rank (Mantel–Cox) test (**p value b 0.01). Panel B: Evolution of tumor volumes after P815 challenge (mm3) as a function of time (day) (mean ± SEM).

constructed to immunize mice against the P815 mastocytoma were delivered by intramuscular electroporation following a “one priming–two boosts” schedule with a two-week interval between each administration (Scheme 1). 3.2. Mini-gene constructs encoding the P1A35–43 antigenic peptide failed to generate an antitumor response Proteins often contain immunodominant epitopes and mice challenged with several antigens only respond to a single or very few antigens [39]. The antigenic peptide P1A35–43, LPYLGWLVF, binds to the H2Ld molecule to form an important target of rejection responses against P815 mastocytoma [40]. It was proposed that an epitope vaccine may be more effective than a whole protein vaccine because it would contain a higher proportion of the most relevant peptide [41]. Moreover an epitope-based strategy, able to display efficient immune response without a need to express the entire gene, would be particularly useful for designing vaccines against potentially deleterious proteins. Furthermore it was demonstrated that plasmid size was correlated with electroporation efficacy as a decrease in transgene expression was observed when the size of the plasmid increased [42]. Accordingly, it has been suggested that the higher efficiency of plasmids devoid of antibiotic resistance markers (such as pFAR [43] or minicircles [44]) delivered by electroporation could be notably attributed to their smaller sizes (approximately 0.9 and 1.2 kb shorter than conventional plasmid vectors, respectively). A possible explanation has recently emerged as it was demonstrated in vitro that vector size influenced DNA/permeabilized membrane interaction [44]. We thus hypothesized that a small-sized plasmid encoding the antigenic peptide P1A35–43 could generate an immune response against the P815 tumor. A pVAX2-miniP1A plasmid encoding nonapeptide LPYLGWLVF35–43 was constructed and used to immunize DBA/2 mice. After priming and

two boosts, each consisting in intramuscular injection of the plasmid immediately followed by electroporation, mice were challenged with P1A-expressing P815B cells. Mice immunized by electroporation of pVAX2-miniP1A failed to reject P815B cells or even delay tumor growth. Both survival curves and tumor volumes of pVAX2-miniP1A treated mice were similar to untreated animals (Fig. 2). As previously described, mice immunized with L1210 cells expressing P1A and B7.1 were efficiently protected against a P815 challenge [40]. This experiment was repeated once with similar trends (Table 2). In an attempt to enhance the immunogenicity of pVAX2-miniP1A and based on the result that helper-peptides were able to increase the efficacy of a P1A35–43 peptide vaccine [28,29] (and unpublished data), we first constructed a plasmid encoding the P1A35–43 antigenic peptide fused with VIL1 peptide. This mini-gene construct was not able to significantly improve mice survival after P815B challenge (Fig. 3). We then constructed a bicistronic vector which allowed the expression of P1A35–43 and VIL1 peptides separately but it also appeared inefficient. To verify if the lack of efficiency could be attributed to the choice of the helper-peptide, another helper-peptide (i.e. PADRE) was selected and cloned into the bicistronic vector but its efficiency has not been proven against the P815 mastocytoma (Table 2). 3.3. Electroporation of a DNA vaccine coding for full-length P1A delayed P815 growth A DNA vaccine encoding the P1A full-length protein was constructed and delivered to DBA/2 mice by intramuscular electroporation. In two independent experiments, tumor growth was delayed and the pVAX2Table 2 Tumor regressors (number of mice alive 90 days after challenge/total number of mice) and median survival (days) against P815 challenge after DNA immunization, from two independent experiments. If the mice globally survived for a longer period of time in experiment A, the same trends were observed for the two experiments. The graphs provided in this paper are related to experiment A.

Naive mice L1210.P1A.B.7.1 pVAX2-P1A pVAX2-miniP1A pVAX2-miniP1AVIL1 pVAX2-miniP1A-IRES-VIL1 pVAX2-miniP1A-IRES-PADRE pVAX2 empty vector

Experiment A

Experiment B

Median survival

Long-term survivors

Median survival

Long-term survivors

29 days – 41 days 31 days 30 days 31 days 28 days 27 days

0/5 5/9 1/10 1/10 2/10 0/10 1/10 0/8

17 days 42 days 27 days 17 days 21 days 20 days 21 days 18 days

0/5 2/10 1/10 0/9 0/9 1/9 2/9 1/10



5

Fig. 4. P815 challenge after pVAX2-P1A immunization. Mice immunized by electroporation of pVAX2-P1A (n = 10) or by intra-peritoneal injections of L1210.P1A.B.7.1 cells (n = 9). Panel A: Survival curve representing the percentage of mice alive (%) as a function of time (day). Statistical analysis: Log-Rank (Mantel–Cox) test (**p value b 0.01). Panel B: Evolution of tumor volumes after P815 challenge (mm3) as a function of time (day) (mean ± SEM).

P1A-treated mice survived at least ten days longer than untreated controls (Table 2). Survival curves for mice immunized by electroporation of pVAX2-P1A differed significantly from untreated mice (Fig. 4A) and P815B grew more slowly when injected subcutaneously (Fig. 4B). Interestingly, in both experiments 10% of the mice completely rejected the P815 tumors while 50% of them showed a regression phase during the second week post-challenge which was followed by tumor regrowth (Fig. 5A–C).

3.4. Electroporation of DNA vaccine encoding full-length P1A induced a higher CTL activity than the plasmid encoding P1A35–43 epitope CTLs are described as key mediators of antitumor immune responses. To measure the specific CTL response, PBLs were collected, restimulated in vitro for 7 days, and tested in a chromium release assay. Immunization by intraperitoneal injection of the L1210.P1A.B.7.1 cells or by intramuscular electroporation of the pVAX2-P1A DNA vaccine significantly increased the CTL response while mice immunized using the pVAX2-miniP1A plasmid showed a slight but not significant increase of lytic activity (Fig. 6). In accordance with this result, mice treated with L1210.P1A.B.7.1 cells or pVAX2-P1A electroporation showed an increased survival after P815 challenge. However, analysis of the individual data revealed a lack of perfect correlation between the lytic activity observed after immunization and protection against a tumor challenge. This can be explained by the fact that CTL activity in the peripheral circulation does not actually reflect the activity in the lymph nodes. This is particularly true for a local delivery of vaccine such as muscle electroporation because antigen-specific CTLs will be mainly located in the inguinal lymph nodes.

Fig. 5. Evolution of tumor volumes for each individual mouse after pVAX2-P1A immunization. Mice were classified as progressors (Panel A, fast tumor growth), slow progressors (Panel B, regression followed by regrowth) or regressors (Panel C, complete regression of the tumor).

4. Conclusion The low immunogenicity of tumor antigens currently limits the development of cancer vaccines and, in particular, DNA vaccines require potent delivery methods. This study aimed to assess whether electroporation could be an efficient delivery method for a DNA vaccine against the P815 tumor, as a model for vaccines directed against human MAGE-type tumor antigens. Here, electroporation resulted in expression of the luciferase reporter gene by the treated muscle. Luciferase expression lasted for several weeks and antibodies directed against luciferase were measured in sera two weeks after the first boost and further enhanced after the second boost (Fig. 1). Five DNA vaccines encoding either P1A or the P1A35–43 antigenic peptide with or without immunostimulatory peptides were constructed and delivered by intramuscular electroporation. All the minigene constructs failed to generate


6


Fig. 6. P1A-specific CTL responses after immunization by DNA electroporation. Mice immunized by electroporation of pVAX2-P1A (n = 10), pVAX2-miniP1A (n = 10), pVAX2 vector without gene inserted after the CMV promoter (n = 8) or by intra-peritoneal injections of L1210.P1A.B.7.1 cells (n = 9). Bars represent the mean of specific lytic units/106 effector cells. Specific lytic unit (LU) was defined as the number of cells that lyse 50% of 104 target cells in 4 h. Statistical analysis: Dunn's Multiple Comparison Test, **p value b 0.01 and ***p value b 0.001.

protective immune responses (Fig. 2–3) while the plasmid encoding the full-length P1A was able to generate a specific CTL response (Fig. 6) and, more interestingly, to significantly delay P815 tumor growth (Fig. 4–5). The DNA vaccine encoding P1A was able to delay tumor growth but only a few mice survived to a P815B challenge. The higher effectiveness of the full-length P1A construct as opposed to the minigene constructs was not expected. The better tumor protection obtained with the fulllength construct likely results in part from ten-fold higher specific CTL response induced (Fig. 5). A potential explanation might be the presence of helper epitopes within the P1A protein, which may favor the induction of CTL against the P1A35–43 epitope. However, simply adding the PADRE helper epitope to the minigene construct was not sufficient to induce tumor protection (Fig. 3). It is therefore likely that other factors play also a role. One possibility is that the full-length P1A protein contains additional epitopes, undefined so far, against which an immune response is triggered by the full-length construct. Because P815 tumor cells also contain the full-length P1A, they would express these epitopes and be sensitive to the immune response against them. Even though they should be confirmed with other antigens, our results already suggest the superiority of full-length as compared to minigene constructs for DNA vaccines. Future studies will evaluate the combination of the full-length P1A DNA vaccine with other therapies, such as chemotherapy or antiangiogenic compounds, in order to achieve complete tumor regression. Acknowledgments The authors thank Bernard Ucakar, Dominique Donckers and Nathalie Lecouturier for their excellent technical assistance. We are also grateful to Pascal Bigey and Daniel Scherman for the gift of pVAX2 plasmid and to Thomas Michiels for providing us with Theiler's virus IRES. Gaëlle Vandermeulen is a postdoctoral researcher of the Fonds de la Recherche Scientifique—FNRS. References [1] M. Dougan, G. Dranoff, Immune therapy for cancer, Annu. Rev. Immunol. 27 (2009) 83–117. [2] H.L. Robinson, C.A. Torres, DNA vaccines, Semin. Immunol. 9 (5) (1997) 271–283. [3] M. Schleef, DNA Pharmaceutical — Formulation and Delivery in Gene Therapy, DNA Vaccination and Immunotherapy, 2005. [4] M. Yu, O.J. Finn, DNA vaccines for cancer too, Cancer Immunol. Immunother. 55 (2) (2006) 119–130.

[5] M.F. Bureau, J. Gehl, V. Deleuze, L.M. Mir, D. Scherman, Importance of association between permeabilization and electrophoretic forces for intramuscular DNA electrotransfer, Biochim. Biophys. Acta 1474 (3) (2000) 353–359. [6] S. Satkauskas, F. Andre, M.F. Bureau, D. Scherman, D. Miklavcic, L.M. Mir, Electrophoretic component of electric pulses determines the efficacy of in vivo DNA electrotransfer, Hum. Gene Ther. 16 (10) (2005) 1194–1201. [7] L.M. Mir, M.F. Bureau, J. Gehl, R. Rangara, D. Rouy, J.M. Caillaud, P. Delaere, D. Branellec, B. Schwartz, D. Scherman, High-efficiency gene transfer into skeletal muscle mediated by electric pulses, Proc. Natl. Acad. Sci. U. S. A. 96 (8) (1999) 4262–4267. [8] G. Vandermeulen, E. Staes, M.L. Vanderhaeghen, M.F. Bureau, D. Scherman, V. Preat, Optimisation of intradermal DNA electrotransfer for immunisation, J. Control. Release 124 (1–2) (2007) 81–87. [9] C. Bloquel, C. Trollet, E. Pradines, J. Seguin, D. Scherman, M.F. Bureau, Optical imaging of luminescence for in vivo quantification of gene electrotransfer in mouse muscle and knee, BMC Biotechnol. 6 (2006) 16. [10] G. Vandermeulen, T. Athanasopoulos, A. Trundley, K. Foster, V. Preat, R.J. Yanez-Munoz, G. Dickson, Highly potent delivery method of gp160 envelope vaccine combining lentivirus-like particles and DNA electrotransfer, J. Control. Release 159 (3) (2012) 376–383. [11] L. Chudley, K. McCann, A. Mander, T. Tjelle, J. Campos-Perez, R. Godeseth, A. Creak, J. Dobbyn, B. Johnson, P. Bass, C. Heath, P. Kerr, I. Mathiesen, D. Dearnaley, F. Stevenson, C. Ottensmeier, DNA fusion-gene vaccination in patients with prostate cancer induces high-frequency CD8 + T-cell responses and increases PSA doubling time, Cancer Immunol. Immunother. 61 (11) (2012) 2161–2170. [12] P. van der Bruggen, C. Traversari, P. Chomez, C. Lurquin, P.E. De, B. Van den Eynde, A. Knuth, T. Boon, A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma, Science 254 (5038) (1991) 1643–1647. [13] T. Boon, P.G. Coulie, B.J. Van den Eynde, P. van der Bruggen, Human T cell responses against melanoma, Annu. Rev. Immunol. 24 (2006) 175–208. [14] C. Uyttenhove, J. Maryanski, T. Boon, Escape of mouse mastocytoma P815 after nearly complete rejection is due to antigen-loss variants rather than immunosuppression, J. Exp. Med. 157 (3) (1983) 1040–1052. [15] B. Van den Eynde, B. Lethe, P.A. Van, P.E. De, T. Boon, The gene coding for a major tumor rejection antigen of tumor P815 is identical to the normal gene of syngeneic DBA/2 mice, J. Exp. Med. 173 (6) (1991) 1373–1384. [16] B. Van den Eynde, H. Mazarguil, B. Lethe, F. Laval, J.E. Gairin, Localization of two cytotoxic T lymphocyte epitopes and three anchoring residues on a single nonameric peptide that binds to H-2Ld and is recognized by cytotoxic T lymphocytes against mouse tumor P815, Eur. J. Immunol. 24 (11) (1994) 2740–2745. [17] C. Uyttenhove, C. Godfraind, B. Lethe, A. mar-Costesec, J.C. Renauld, T.F. Gajewski, M.T. Duffour, G. Warnier, T. Boon, B.J. Van den Eynde, The expression of mouse gene P1A in testis does not prevent safe induction of cytolytic T cells against a P1A-encoded tumor antigen, Int. J. Cancer 70 (3) (1997) 349–356. [18] A. Rosato, G. Milan, D. Collavo, P. Zanovello, DNA-based vaccination against tumors expressing the P1A antigen, Methods 19 (1) (1999) 187–190. [19] A. Yamada, T. Sasada, M. Noguchi, K. Itoh, Next-generation peptide vaccines for advanced cancer, Cancer Sci. 104 (1) (2013) 15–21. [20] D. Boraschi, A. Tagliabue, Interleukin-1 and interleukin-1 fragments as vaccine adjuvants, Methods 19 (1) (1999) 108–113. [21] S. Rovero, K. Boggio, C.E. Di, A. Amici, E. Quaglino, P. Porcedda, P. Musiani, G. Forni, Insertion of the DNA for the 163–171 peptide of IL1beta enables a DNA vaccine encoding p185(neu) to inhibit mammary carcinogenesis in Her-2/neu transgenic BALB/c mice, Gene Ther. 8 (6) (2001) 447–452. [22] H.J. Shao, L. Chen, M.S. Shen, G.F. Yu, Enhancement of immune responses to the hepatitis B virus core protein through DNA vaccines with a DNA fragment encoding human IL-1beta 163–171 peptide, Acta Virol. 47 (4) (2003) 217–221. [23] H.J. Shao, L. Chen, Y.B. Su, DNA fragment encoding human IL-1beta 163–171 peptide enhances the immune responses elicited in mice by DNA vaccine against foot-and-mouth disease, Vet. Res. Commun. 29 (1) (2005) 35–46. [24] J. Alexander, J. Sidney, S. Southwood, J. Ruppert, C. Oseroff, A. Maewal, K. Snoke, H.M. Serra, R.T. Kubo, A. Sette, Development of high potency universal DR-restricted helper epitopes by modification of high affinity DR-blocking peptides, Immunity 1 (9) (1994) 751–761. [25] C.F. Hung, Y.C. Tsai, L. He, T.C. Wu, DNA vaccines encoding Ii-PADRE generates potent PADRE-specific CD4+ T-cell immune responses and enhances vaccine potency, Mol. Ther. 15 (6) (2007) 1211–1219. [26] L. Li, J.M. Herndon, S.M. Truscott, T.H. Hansen, T.P. Fleming, P. Goedegebuure, W.E. Gillanders, Engineering superior DNA vaccines: MHC class I single chain trimers bypass antigen processing and enhance the immune response to low affinity antigens, Vaccine 28 (8) (2010) 1911–1918. [27] G.Y. Ishioka, J. Fikes, G. Hermanson, B. Livingston, C. Crimi, M. Qin, M.F. del Guercio, C. Oseroff, C. Dahlberg, J. Alexander, R.W. Chesnut, A. Sette, Utilization of MHC class I transgenic mice for development of minigene DNA vaccines encoding multiple HLA-restricted CTL epitopes, J. Immunol. 162 (7) (1999) 3915–3925. [28] J. Bilsborough, C. Uyttenhove, D. Colau, P. Bousso, C. Libert, B. Weynand, T. Boon, B.J. Van den Eynde, TNF-mediated toxicity after massive induction of specific CD8+ T cells following immunization of mice with a tumor-specific peptide, J. Immunol. 169 (6) (2002) 3053–3060. [29] I.J. Huijbers, S.M. Soudja, C. Uyttenhove, M. Buferne, E.M. Inderberg-Suso, D. Colau, L. Pilotte, C.G. Powis de Tenbossche, P. Chomez, F. Brasseur, A.M. Schmitt-Verhulst, B.J. Van den Eynde, Minimal tolerance to a tumor antigen encoded by a cancer-germline gene, J. Immunol. 188 (1) (2012) 111–121. [30] T.I. Naslund, C. Uyttenhove, E.K. Nordstrom, D. Colau, G. Warnier, M. Jondal, B.J. Van den Eynde, P. Liljestrom, Comparative prime-boost vaccinations using Semliki Forest virus, adenovirus, and ALVAC vectors demonstrate differences in the generation



[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39] [40]

[41]

[42]

[43]

[44]

of a protective central memory CTL response against the P815 tumor, J. Immunol. 178 (11) (2007) 6761–6769. B. Ni, Z. Lin, L. Zhou, L. Wang, Z. Jia, W. Zhou, D.P. Diciommo, J. Zhao, R. Bremner, Y. Wu, Induction of P815 tumor immunity by DNA-based recombinant Semliki Forest virus or replicon DNA expressing the P1A gene, Cancer Detect. Prev. 28 (6) (2004) 418–425. A. Rosato, A. Zoso, G. Milan, B. Macino, S.S. Dalla, V. Tosello, C.E. Di, P. Musiani, R.G. Whalen, P. Zanovello, Individual analysis of mice vaccinated against a weakly immunogenic self tumor-specific antigen reveals a correlation between CD8 T cell response and antitumor efficacy, J. Immunol. 171 (10) (2003) 5172–5179. C. Shaw-Jackson, T. Michiels, Absence of internal ribosome entry site-mediated tissue specificity in the translation of a bicistronic transgene, J. Virol. 73 (4) (1999) 2729–2738. C. Uyttenhove, L. Pilotte, I. Theate, V. Stroobant, D. Colau, N. Parmentier, T. Boon, B.J. Van den Eynde, Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase, Nat. Med. 9 (10) (2003) 1269–1274. T.F. Gajewski, J.C. Renauld, P.A. Van, T. Boon, Costimulation with B7-1, IL-6, and IL-12 is sufficient for primary generation of murine antitumor cytolytic T lymphocytes in vitro, J. Immunol. 154 (11) (1995) 5637–5648. L. Daugimont, G. Vandermeulen, F. Defresne, C. Bouzin, L.M. Mir, C. Bouquet, O. Feron, V. Preat, Antitumoral and antimetastatic effect of antiangiogenic plasmids in B16 melanoma: higher efficiency of the recombinant disintegrin domain of ADAM 15, Eur. J. Pharm. Biopharm. 78 (3) (2011) 314–319. J. Hartikka, L. Sukhu, C. Buchner, D. Hazard, V. Bozoukova, M. Margalith, W.K. Nishioka, C.J. Wheeler, M. Manthorp, M. Sawdey, Electroporation-facilitated delivery of plasmid DNA in skeletal muscle: plasmid dependence of muscle damage and effect of poloxamer 188, Mol. Ther. 4 (5) (2001) 407–415. G. Tevz, D. Pavlin, U. Kamensek, S. Kranjc, S. Mesojednik, A. Coer, G. Sersa, M. Cemazar, Gene electrotransfer into murine skeletal muscle: a systematic analysis of parameters for long-term gene expression, Technol. Cancer Res. Treat. 7 (2) (2008) 91–101. H. Schreiber, T.H. Wu, J. Nachman, W.M. Kast, Immunodominance and tumor escape, Semin. Cancer Biol. 12 (1) (2002) 25–31. D. Brandle, J. Bilsborough, T. Rulicke, C. Uyttenhove, T. Boon, B.J. Van den Eynde, The shared tumor-specific antigen encoded by mouse gene P1A is a target not only for cytolytic T lymphocytes but also for tumor rejection, Eur. J. Immunol. 28 (12) (1998) 4010–4019. B.Y. Lee, M.A. Horwitz, T-cell epitope mapping of the three most abundant extracellular proteins of Mycobacterium tuberculosis in outbred guinea pigs, Infect. Immun. 67 (5) (1999) 2665–2670. C. Bloquel, E. Fabre, M.F. Bureau, D. Scherman, Plasmid DNA electrotransfer for intracellular and secreted proteins expression: new methodological developments and applications, J. Gene Med. 6 (Suppl. 1) (2004) S11–S23. C. Marie, G. Vandermeulen, M. Quiviger, M. Richard, V. Preat, D. Scherman, pFARs, plasmids free of antibiotic resistance markers, display high-level transgene expression in muscle, skin and tumour cells, J. Gene Med. 12 (4) (2010) 323–332. S. Chabot, J. Orio, M. Schmeer, M. Schleef, M. Golzio, J. Teissie, Minicircle DNA electrotransfer for efficient tissue-targeted gene delivery, Gene Ther. 20 (1) (2013) 62–68.

Gaëlle Vandermeulen is a postdoctoral researcher of the Fonds de la Recherche Scientifique—FNRS. After completing a Master's degree in Pharmacy, she joined the Pharmaceutics and Drug Delivery group at the Louvain Drug Research Institute of the Université catholique de Louvain (UCL). Her PhD work was part of a European project and she spent several months at the Université Paris Descartes. She completed a PhD on skin DNA electroporation in 2008 and performed a postdoctoral stay focused on HIV DNA vaccine at the Royal Holloway University of London. She aims to develop novel delivery systems, in particular for nucleic acid-based drugs.

7 Catherine Uyttenhove obtained her Bachelor's degree in Biology in 1976 and her PhD degree in Immunology in 1981, from the Université catholique de Louvain (UCL), concentrating in tumor immunology. She joined the Ludwig Institute for Cancer Research, Brussels Branch for a postdoctoral training and was then appointed as a scientist and now as a senior investigator in the same lab, moving from tumor immunology to cytokine research. She participated to the discovery of murine IL-6 and identified another new cytokine, IL-9. Her main present interest is the modulation of cytokine activity in different tumoral or autoimmune murine models by anti-cytokine auto-vaccination.

Etienne De Plaen obtained a PhD in Chemistry at the Université catholique de Louvain (UCL) in 1979. He joined the Brussels Branch of the Ludwig Institute for Cancer Research in 1981 as a post-doc, and he is still working in the Institute as a permanent scientist. One of the goals of the Ludwig Institute for Cancer Research in Brussels is to develop cancer immunotherapy. The main contribution of Etienne De Plaen was to set up genetic approaches to characterize tumor antigens recognized by cytolytic T lymphocytes. Etienne De Plaen is in addition a visiting lecturer at the Faculty of Pharmacy and Biomedical Sciences of the UCL.

Benoît Van den Eynde holds a medical doctor degree and a PhD in Immunology from the Université catholique de Louvain, where he is now a full professor. He is also the Director of the Brussels Branch of the Ludwig Institute for Cancer Research. He is a world expert in tumor immunology, with a focus on the characterization of tumor antigens. He identified some of the very first tumor antigens, and contributed to the development of cancer vaccines based on such antigens. He is also renowned for his work on the processing of tumor antigens and the mechanisms of tumoral immune resistance.

Véronique Préat received a Master's degree and a PhD in Pharmaceutical Sciences from the Université catholique de Louvain (UCL). She is currently a full professor at the Faculty of Pharmacy and Biomedical Sciences and head of the laboratory of Pharmaceutics and Drug Delivery at the Louvain Drug Research Institute of the UCL. The research of her team focuses on new delivery systems for poorly soluble drugs, biotech-drugs and vaccines for unmet medical or pharmaceutical needs. Véronique Préat is widely regarded for her contributions to transdermal drug delivery and more recently to gene delivery by electroporation and to targeted nanomedicines.


Codon-Optimized P1A-Encoding DNA Vaccine: Toward a Therapeutic Vaccination against P815 Mastocytoma.

Production of tumour necrosis factor by mastocytoma P815 cells.

Adriamycin-induced inhibition of arachidonate incorporation into phospholipids of mastocytoma P815 cells.

Distribution pattern and enzymic hypermethylation of inverted repetitive DNA sequences in P815 mastocytoma cells.

Electroporation as a vaccine delivery system and a natural adjuvant to intradermal administration of plasmid DNA in macaques.

Enhanced immunogenicity of an HIV-1 DNA vaccine delivered with electroporation via combined intramuscular and intradermal routes.

Electrotransfer: direct transfer of bacterial plasmid DNA by electroporation.

Transferring plasmid DNA between different bacterial species with electroporation.

Influenza A Viruses Replicate Productively in Mouse Mastocytoma Cells (P815) and Trigger Pro-inflammatory Cytokine and Chemokine Production through TLR3 Signaling Pathway.

Electroporation of a suicide plasmid bearing a transposon into Brucella abortus.

Optimization of a plasmid electroporation protocol for Aeromonas salmonicida subsp. salmonicida.

LL-37 host defense peptide promotes wound healing.

Dog mastocytoma cells produce transforming growth factor beta 1.

Safety of intramuscular injection of hepatitis B vaccine in haemophiliacs.

H-2K(d) -specific CD8+ T cells.

Enhancement of cytotoxic T lymphocyte growth from spleens of P815-tumor-bearing host mice with mafosfamide.

Skin Transfection Patterns and Expression Kinetics of Electroporation-Enhanced Plasmid Delivery Using the CELLECTRA-3P, a Portable Next-Generation Dermal Electroporation Device.

Electroporation of Haemophilus influenzae is effective for transformation of plasmid but not chromosomal DNA.

Transformation of Staphylococcus epidermidis and other staphylococcal species with plasmid DNA by electroporation.

Electroporation and expression of the broad host-range plasmid pRK2501 in Azotobacter vinelandii.

In vivo electroporation and stable transformation of skin cells of newborn mice by plasmid DNA.

Phase IIb trial of in vivo electroporation mediated dual-plasmid hepatitis B virus DNA vaccine in chronic hepatitis B patients under lamivudine therapy.

Intradermal delivery of plasmid VEGF(165) by electroporation promotes wound healing.

Plasmid transformation of Ruminococcus albus by means of high-voltage electroporation.