Scand J Infect Dis 24: 381-385. 1992 ~
CASE REPORT
Intrauterine Fetal Death due to Echovirus 11 MATS E JOHANSSON', STEFAN HOLMSTROM?, ALMAZ ABEBE:, BJORN JACOBSSON', GUNVOR EKMAN4, AGNETA SAMUELSON' and BENITA ZWEYGBERG WIRGART' the Depurtments of 'Chnical Microbiology Sec tioii for Virology, Karolinpka Hospital. Stoi khnlnz, 'Virologyy,the Central Mic-iohiologiccil Labomtory of Stockholm C outit\ C oiiiicil Ptockholm', urid s pa tho log^ urid 'Gjnetology and Obstetric \, Danderyd Horpitd. Datirieryd, L\weden
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
Fiotii
In a case of intrauterine fetal death in the 29th week of gestation, echovirus I1 could be isolated from the umbilical cord of the fetus. The mother had no apparent signs of infection but serological evidence of current echovirus 11 infection. Enterovirus PCR performed on paraffin-embedded specimens of various tissues (myocardium, lung, liver and placenta) from the fetus yielded positive results in all cases. These findings, together with supporting serological and epidemiological findings - e.g. proven echovirus I1 infection 3 weeks before in the 18-month-old son of the woman - constituted strong evidence that echovirus 11 infection was responsible for the fetal death.
M . E . Johansson, M D , PhD, Department of Clinical Microbiology, Section for Virology, Karolinska Hospital, P.O. Box 60500, S-10401 Stockholm, Sweden
INTRODUCTION The cause of intrauterine fetal death (IUFD) often remains unknown. Physical abnormalities as well as prenatal obstetrical complications are occasionally associated with IUFD, in othcrs infections are considered. Sporadically, human viruses e.g. cytomegalovirus, herpes simplex virus, influensavirus. parvovirus. poliovirus, and rubellavirus (1-5) have been incriminated. Nevertheless, viruses have been shown to be responsible for only a minor part of IUFDs. In this report, a case of IUFD in a woman in the 29th week of pregnancy is described, which could be attributed to transplacentary infection with echovirus 11.
CASE REPORTS Mother The mother. a 30-year-old woman in the 29th week of pregnancy. noted absence of fetal movements on Mar-ch 8, 1990 about 3 wceks after onset of symptoms (February 13) of infection in her 18-month-old son. The diagnosis IUFD was made by auscultation and ultrasound examination. The woman had an uncomplicated delivery after labor induction with intracervical prostaglandin E2 and intravenous infusion of oxytocin. Stillhorri hahy At autopsy, the male fetus was found to be moderately macerated. The crown-heal length was 40 cm and the weight 1200 g. The fetus did not have any malformations. Tissue specimens from fetal myocardium. lung, thymus. liver, spleen, kidney, and adrcnals as well as from placenta were fixed in 10% formalin and processed to paraffin. The histological investigation revealed moderate to severe postmortal changes in all tissues examined. A slight focal increase in interstitial lymphocytes and exti-avasated erythrocytes was seen in the myocardium. However, n o definite proof of myocarditis could be obtained. Other tissues were microscopically normal. The placenta with a weight of 307 g showed an
3x2
M . E. Joliunsson et a/.
Sciind J Intcct 1115 74
acute chorioamnionitis. N o signs of vasculitis of the umbilical cord nor any infiltration of inflammatory cells in thc chorionic villi were observed.
METHODS 1.wlation atid identlficatiori of virus Ail umbilical cord specimen from the stillborn fetus as well as feces, throat swab, and nasopharynx aspirate specimens from the 18-month-old son werc sent to the virus laboratory for routine virus isolation. Chloroform-resistant viruses growing in grecn monkey kidney (GMK) cells were isolatcd from all localities and werc all typed by serum neutralization.
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
V/rii.s serology
F o r determination of enterovirus group-specific antibodies. an in house enzyme linked immunosorhent ;issay (ELISA) was performed using a mixture of coxsackievirus BS and echovirus 18 a s antigen. Eiiterovirus group-specific IgM was assessed by a k-capture technique using peroxidase-labelled antigens of coxsackie A9 and echovirus 6 ( 6 ) . Neutralizing antibodies against echovirus type I 1 isolate derived from the umbilical cord, were measured using conventional techniques. Polymerase chain reaction (PCR) Viral RNA from paraffin-embedded tissues and cell cultures, respectively, was extracted as described by others (7-9), with certain modifications (10). Reverse transcription, PCR amplification, and electrophoresis were essentially performed as described elsewhere (10). One region of complete sequence conservation was identified by computer-assisted analysis o f the genomic R N A of the 6 enterovirus serotypes that have been sequenced (data obtained from Gene Bank). This sequence was located near the 5’ end in the noncoding part of the viral genome. The 2 flanking sequences wcre chosen as primers for PCR. These 2 oligomeric strands were synthesized (381 A Applied Biosystems. Foster City. C A . USA). The upstream primer was bynthesized “sense” and the downstream primer “anti-sense”. The first primer BJent I ( 445-170; TCCTCCGGCCCCTGAATGCGGCTAAT) comprises 26 bases and the second primer BJent 2 (511 564; GAAACACGGACACCCAAAGTA) 21 bases. The amplified segment was 120 bases. The specificity of this segment was checked using a radiolabelled probe complementary to a region located between the primers (position 511L538). The PCR was run using either 30 cycles (cell culture supernatants) or 30 + 30 cycles (paraffinembedded specimens). Each run included negative control (all PCR constitutents except the sample) as well as strong and weak positive controls (6.9 TCID,,, and 2.9 TCID,,, respectively, of coxsackievirus BS). No signs of contamination were observed, neither in the experiments described nor in any of other enterovirus PCR tests run in parallel.
RESULTS Echovirus 11 was the most frequently isolated enterovirus in Stockholm during 1000, accounting for about on third of all enterovirus isolates obtained in the area; the present isolates belonged to some of the earliest obtained during this epidemic. The 18-month-old son of the woman was admitted to hospital on February 24,1990 due to fever for 11 days and atypical rash for 1 day. Echovirus 11 was isolated from fecal, throat, and nasopharyngeal specimens from the boy who recovered completely within a week after admission. At the same time, the father had a nonspecific febrile disease, whereas the mother was asymptomatic. Virus isolation and serology
Viral culture of minced umbilical cord specimen from the stillborn infant yielded growth of echovirus 11. No other fetal tissues or maternal specimens were cultured for viruses. ELISA serology on paired maternal sera, drawn in the 12th week of gestation and after delivery, respectively, showed seroconversion of IgG as well as IgM against enterovirus group-specific
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
118
t 20
Fig I . Kcsults of agarosc gel electrophoresis o f PCK-amplificd products of 4 speciincns using gener;il primers. A hand of 120 base pairs is consistent with amplification o f echovirus 1 1 : Lane I . ncgativc con1tol: liine 2. strongly positivc control (coxsackie HS. 6.9 TCID,,,); lane 3. lung: lane 3 . livei; lane 5 , placenta; liiiic 6. myocardium: lane 7. weakly positive control (coxsackie BS. 2.9 TCID,,,).The lcftmost fragments are the molecular length standard (phi X-173-RF DNA, HaeIIl digest): the band o f I I X basc5 is clcnoted.
antigens. whereas analyses for antibodies against cytomegalovirus, herpes simplex virus, and ruhcllavirus showed stationary IgG antibody titers and absence of IgM antibody reactivity. Seroconversion of echovirus type 11 neutralizing antibodies (from < 2 to 32) was found a s well. ELISA serology o n a third serum drawn 11 weeks post-delivery, revealed an additional slight increase of enterovirus IgG antibodies, whereas the IgM reactivity had decreased significantly but was still weakly positive. PC'R arriplificatiorr Pieces were cut out from the paraffin blocks of fetal tissues of lung, liver, myocardium and placenta. and were processed for PCR amplification. Following PCR amplification. all 4 histopathological specimens, i.e. myocardium, lung. liver, and placenta as well as the positive controls (coxsackie B5) yielded electrophoretic bands of 120 bases in length (Fig. 1). whereas the negative control was negative. Also the cell culture specimens from which echovirus 1 1 had been isolated. yielded an elcctrophoretic band of 120 bases (Table I ) . The reitson why the throat specimen failed t o give positive result was probably unsuccessful extraction of nucleic acid. DISCUSSION Among non-polio cnteroviruses, coxsackieviruses of subgroup B have been reported by
384 M . E. Johansson et ul.
Scdnd J Infect Dis 24
Table I. Virus growth and PCR amplification on samples ,from various specimens a = nucleic acid extracted from formalin fixed and paraffin-embedded histopathological tissue block. b = supernatants of cell culture inoculated with umbilical cord suspension from thc stillborn baby, and feces. nasopharyngeal aspirate. and throat swab from the 18-month-old boy. ND = not done. Specimen
Virus culture
PCR amplification
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
Sample
Result
Lung Liver Myocardium Placenta
ND ND ND ND
+ + +
Umbilical cord Feces Nasopharynx aspirate Throat swab
+ +
+ + +
Positive control Weak positive control Negative control
i
+
-c
-
+ + -
other investigators to be associated with IUFDs. Burch et al. (11) found coxsackievirus B2, B3, or B4 by immunofluorescence in myocardial tissues from 3 stillborn babies with gestational ages ranging from 5 to 8 months. Using similar techniques, Bates (12) found coxsackievirus B3 in heart tissues of a stillborn infant near term, who had pancarditis and hydrops fetalis. A transplacentary transmission mode of echovirus 11 has been suggested by Modlin (13) and has been confirmed by recovery of echovirus 11 from amniotic fluid of a stillborn infant with gestational age of 38 weeks (14) and from cord blood of an infant with signs of infection at birth (15). We have described a case of I U F D early in the third trimester apparently due to intrauterine infection with echovirus 11. Results obtained by virus isolation, serology, and PCR on nucleic acid from various fetal tissues, implied echovirus 11 as the responsible agent. The time when the mother became infected could not be determined with certainty. However, the features of simultaneous community outbreak, infection in the family, a further slight increase of enterovirus IgG antibodies in a late serum as well as a corresponding decrease of IgM antibody reactivity, strongly suggested that the maternal echovirus 11 infection was ensuing o r accompanying the infection of her 18-month-old son. It is noteworthy that the histopathological examination only revealed discrete signs of a possible but not definite myocarditis in addition to the acute chorioamnionitis. Similarly, in the maternal echovirus 11 infection presented by Freedman (16), no significant histopathological changes were seen in the stillborn fetus. Since isolation of virus from fetal tissues failed, this case of IUFD was interpreted to be a consequence of maternal fever and intense dehydration. This interpretation seems questionable since transplacentary enterovirus was not excluded by alternative virus detection techniques. In our case, we found enteroviral RNA in several tissues of the fetus indicative of a generalized infection that could be directly responsible for the IUFD. The present study demonstrated the usefulness of PCR for the detection of enteroviral RNA in clinical specimens. PCR has previously been used to detect enteroviruses in cerebrospinal fluid (17, 18) and in muscle biopsies (19, 20). Our results showed that enterovirus PCR can also be applied on paraffin-embedded specimens. This finding expands
Scand J Infect Dis 23
Fetal deuth due to echovirus 11 385
the possibility of making retrospective diagnosis o f enteroviral infections in cases where such infection is not initially suspected. The impact of echovirus I 1 and other enteroviruses in causation of IUFD is still unclear. Since this is a matter of considerable importance, extended studies are warranted. PCR is a technique with a tremendous potential in diagnostic virology and provides a feasible method for further studies on this subject.
ACKNOWLEDGEMENTS
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
We wish t o thank Dr Janis Abens for synthesis o f the primers used in the PCR. Wc also thank Dr Bo Johansson for advice in the computer-assisted analysis of enteroviral genomes and selection of primers.
REFERENCES 1. Griffiths PD, Baboonian C. A prospective study of primary cytomegalovirus infection during pregnancy: final report. Br J Obstet Gynaecol 91: 307-315, 1984. 2. Nahmias AJ. Keyserling HL. Kerrick RN. Herpes simplex. In: Rcmington JS, Klein JO. eds. Infectious diseases of the fetus and newborn infant. Philadelphia: WB Saunders. 636-678, 1983. 3 . Bond PR. Caul EO. Usher J. ct al. Intrauterine infection with human parvovirus. Lancet 1: 448-449, 1986. 4. Horn P. Poliomyelitis in pregnancy. A twenty-year report from Los Angeles County, California. Obstet Gynecol 6: 121-137, 1955. 5 . Miller E. Cradock-Watson JE. Pollock TM. Consequences of confirmed maternal rubella at successive stages of pregnancy. Lancet 2: 781-784, 1982. 6. Samuelson A , Skoog E, Forsgren M. Aspects on the diagnosis of enterovirus infection5 by ELISA. Serodiagn lmmunother Infect Dis 4: 395406. 199I. 7. Kawasaki ES. Sample preparation from blood, cells. and other fluids. In: Innis MA. Gclfand DH. Sninsky JJ. White TJ. cds. PCR protocols: A guide to methods and applications. San Diego: Academic Press. 144-152, 1990. 8. Wright DK, Manos MM. Sample preparation from paraffin-embedded tissues. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: A guide to methods and applications. San Diego: Academic Press. 153-158. 1990. 9. Rotbart H A . PCR amplification of enteroviruses. In: Innis MA, Gelfand DH, Sninsky JJ. White TJ. eds. PCR protocols: A guide to methods and applications. San Diego: Academic Press. 372-377, 1990. 10. Abebc A , Johansson B. Abcns J . StrannegBrJ 0. Detection of enteroviruscs in faeces by polynierase chain reaction. Scand J Infect Dis 24: 265-273, 1992. 1 I. Burch GE, Sun S-C, Chu K-C, et al. Interstitial and coxsackievirus B myocarditis in infants and children. JAMA 203: 55-62. IY68. 12. Bates HR. Coxsackie virus B3 calcific pancarditis and hydrops fetalis. Am J Obstet Gynecol 106: 62Y-630. 1970. 13. Modlin JF. Fatal echovirus 1 1 disease in premature neonates. Pediatrics 66: 775-780, 1980. 14. Skeels MR, Williams JJ. Ricker FM. Perinatal cchovirus infection. N Engl J Med 305: 1529-1530, 1981. 15. Jones MJ, Kolb M. Votava HJ. et al. Intrauterine echovirus type 11 infection. Mayo Clin Proc 55: 509-5 12, 1980. 16. Freedman PS. Echovirus 11 infection and intrautcrine death. Lancet 1: 9 6 9 7 , 1979. 17. Rotbart H A . Enzymatic RNA amplification of the enteroviruses. J Clin Microbiol 28: 438-442, 1990. 18. Rotbart HA. Diagnosis of enteroviral meningitis with the polymerase chain reaction. J Pediatr 117: 85-89. 1990. 1Y. Gin 0. Sole MJ, Butany JW, Chia WK, McLaughlin PR, Liew CC. Detection of enterovirus RNA in myocardial biopsies from patients with myocarditis and cardiomyopathy using gene amplification by polymerase chain reaction. Circulation 82: 8-16, 1990. 20. Cow JW. Behan WMH, Clements GB, Woodall C. Riding M. Behan PO. Enteroviral RNA sequences detected by polymerase chain reaction i n muscle of patients with postviral fatigue syndrome. BMJ 302: 692-696, 1991.
CASE REPORT
Intrauterine Fetal Death due to Echovirus 11 MATS E JOHANSSON', STEFAN HOLMSTROM?, ALMAZ ABEBE:, BJORN JACOBSSON', GUNVOR EKMAN4, AGNETA SAMUELSON' and BENITA ZWEYGBERG WIRGART' the Depurtments of 'Chnical Microbiology Sec tioii for Virology, Karolinpka Hospital. Stoi khnlnz, 'Virologyy,the Central Mic-iohiologiccil Labomtory of Stockholm C outit\ C oiiiicil Ptockholm', urid s pa tho log^ urid 'Gjnetology and Obstetric \, Danderyd Horpitd. Datirieryd, L\weden
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
Fiotii
In a case of intrauterine fetal death in the 29th week of gestation, echovirus I1 could be isolated from the umbilical cord of the fetus. The mother had no apparent signs of infection but serological evidence of current echovirus 11 infection. Enterovirus PCR performed on paraffin-embedded specimens of various tissues (myocardium, lung, liver and placenta) from the fetus yielded positive results in all cases. These findings, together with supporting serological and epidemiological findings - e.g. proven echovirus I1 infection 3 weeks before in the 18-month-old son of the woman - constituted strong evidence that echovirus 11 infection was responsible for the fetal death.
M . E . Johansson, M D , PhD, Department of Clinical Microbiology, Section for Virology, Karolinska Hospital, P.O. Box 60500, S-10401 Stockholm, Sweden
INTRODUCTION The cause of intrauterine fetal death (IUFD) often remains unknown. Physical abnormalities as well as prenatal obstetrical complications are occasionally associated with IUFD, in othcrs infections are considered. Sporadically, human viruses e.g. cytomegalovirus, herpes simplex virus, influensavirus. parvovirus. poliovirus, and rubellavirus (1-5) have been incriminated. Nevertheless, viruses have been shown to be responsible for only a minor part of IUFDs. In this report, a case of IUFD in a woman in the 29th week of pregnancy is described, which could be attributed to transplacentary infection with echovirus 11.
CASE REPORTS Mother The mother. a 30-year-old woman in the 29th week of pregnancy. noted absence of fetal movements on Mar-ch 8, 1990 about 3 wceks after onset of symptoms (February 13) of infection in her 18-month-old son. The diagnosis IUFD was made by auscultation and ultrasound examination. The woman had an uncomplicated delivery after labor induction with intracervical prostaglandin E2 and intravenous infusion of oxytocin. Stillhorri hahy At autopsy, the male fetus was found to be moderately macerated. The crown-heal length was 40 cm and the weight 1200 g. The fetus did not have any malformations. Tissue specimens from fetal myocardium. lung, thymus. liver, spleen, kidney, and adrcnals as well as from placenta were fixed in 10% formalin and processed to paraffin. The histological investigation revealed moderate to severe postmortal changes in all tissues examined. A slight focal increase in interstitial lymphocytes and exti-avasated erythrocytes was seen in the myocardium. However, n o definite proof of myocarditis could be obtained. Other tissues were microscopically normal. The placenta with a weight of 307 g showed an
3x2
M . E. Joliunsson et a/.
Sciind J Intcct 1115 74
acute chorioamnionitis. N o signs of vasculitis of the umbilical cord nor any infiltration of inflammatory cells in thc chorionic villi were observed.
METHODS 1.wlation atid identlficatiori of virus Ail umbilical cord specimen from the stillborn fetus as well as feces, throat swab, and nasopharynx aspirate specimens from the 18-month-old son werc sent to the virus laboratory for routine virus isolation. Chloroform-resistant viruses growing in grecn monkey kidney (GMK) cells were isolatcd from all localities and werc all typed by serum neutralization.
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
V/rii.s serology
F o r determination of enterovirus group-specific antibodies. an in house enzyme linked immunosorhent ;issay (ELISA) was performed using a mixture of coxsackievirus BS and echovirus 18 a s antigen. Eiiterovirus group-specific IgM was assessed by a k-capture technique using peroxidase-labelled antigens of coxsackie A9 and echovirus 6 ( 6 ) . Neutralizing antibodies against echovirus type I 1 isolate derived from the umbilical cord, were measured using conventional techniques. Polymerase chain reaction (PCR) Viral RNA from paraffin-embedded tissues and cell cultures, respectively, was extracted as described by others (7-9), with certain modifications (10). Reverse transcription, PCR amplification, and electrophoresis were essentially performed as described elsewhere (10). One region of complete sequence conservation was identified by computer-assisted analysis o f the genomic R N A of the 6 enterovirus serotypes that have been sequenced (data obtained from Gene Bank). This sequence was located near the 5’ end in the noncoding part of the viral genome. The 2 flanking sequences wcre chosen as primers for PCR. These 2 oligomeric strands were synthesized (381 A Applied Biosystems. Foster City. C A . USA). The upstream primer was bynthesized “sense” and the downstream primer “anti-sense”. The first primer BJent I ( 445-170; TCCTCCGGCCCCTGAATGCGGCTAAT) comprises 26 bases and the second primer BJent 2 (511 564; GAAACACGGACACCCAAAGTA) 21 bases. The amplified segment was 120 bases. The specificity of this segment was checked using a radiolabelled probe complementary to a region located between the primers (position 511L538). The PCR was run using either 30 cycles (cell culture supernatants) or 30 + 30 cycles (paraffinembedded specimens). Each run included negative control (all PCR constitutents except the sample) as well as strong and weak positive controls (6.9 TCID,,, and 2.9 TCID,,, respectively, of coxsackievirus BS). No signs of contamination were observed, neither in the experiments described nor in any of other enterovirus PCR tests run in parallel.
RESULTS Echovirus 11 was the most frequently isolated enterovirus in Stockholm during 1000, accounting for about on third of all enterovirus isolates obtained in the area; the present isolates belonged to some of the earliest obtained during this epidemic. The 18-month-old son of the woman was admitted to hospital on February 24,1990 due to fever for 11 days and atypical rash for 1 day. Echovirus 11 was isolated from fecal, throat, and nasopharyngeal specimens from the boy who recovered completely within a week after admission. At the same time, the father had a nonspecific febrile disease, whereas the mother was asymptomatic. Virus isolation and serology
Viral culture of minced umbilical cord specimen from the stillborn infant yielded growth of echovirus 11. No other fetal tissues or maternal specimens were cultured for viruses. ELISA serology on paired maternal sera, drawn in the 12th week of gestation and after delivery, respectively, showed seroconversion of IgG as well as IgM against enterovirus group-specific
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
118
t 20
Fig I . Kcsults of agarosc gel electrophoresis o f PCK-amplificd products of 4 speciincns using gener;il primers. A hand of 120 base pairs is consistent with amplification o f echovirus 1 1 : Lane I . ncgativc con1tol: liine 2. strongly positivc control (coxsackie HS. 6.9 TCID,,,); lane 3. lung: lane 3 . livei; lane 5 , placenta; liiiic 6. myocardium: lane 7. weakly positive control (coxsackie BS. 2.9 TCID,,,).The lcftmost fragments are the molecular length standard (phi X-173-RF DNA, HaeIIl digest): the band o f I I X basc5 is clcnoted.
antigens. whereas analyses for antibodies against cytomegalovirus, herpes simplex virus, and ruhcllavirus showed stationary IgG antibody titers and absence of IgM antibody reactivity. Seroconversion of echovirus type 11 neutralizing antibodies (from < 2 to 32) was found a s well. ELISA serology o n a third serum drawn 11 weeks post-delivery, revealed an additional slight increase of enterovirus IgG antibodies, whereas the IgM reactivity had decreased significantly but was still weakly positive. PC'R arriplificatiorr Pieces were cut out from the paraffin blocks of fetal tissues of lung, liver, myocardium and placenta. and were processed for PCR amplification. Following PCR amplification. all 4 histopathological specimens, i.e. myocardium, lung. liver, and placenta as well as the positive controls (coxsackie B5) yielded electrophoretic bands of 120 bases in length (Fig. 1). whereas the negative control was negative. Also the cell culture specimens from which echovirus 1 1 had been isolated. yielded an elcctrophoretic band of 120 bases (Table I ) . The reitson why the throat specimen failed t o give positive result was probably unsuccessful extraction of nucleic acid. DISCUSSION Among non-polio cnteroviruses, coxsackieviruses of subgroup B have been reported by
384 M . E. Johansson et ul.
Scdnd J Infect Dis 24
Table I. Virus growth and PCR amplification on samples ,from various specimens a = nucleic acid extracted from formalin fixed and paraffin-embedded histopathological tissue block. b = supernatants of cell culture inoculated with umbilical cord suspension from thc stillborn baby, and feces. nasopharyngeal aspirate. and throat swab from the 18-month-old boy. ND = not done. Specimen
Virus culture
PCR amplification
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
Sample
Result
Lung Liver Myocardium Placenta
ND ND ND ND
+ + +
Umbilical cord Feces Nasopharynx aspirate Throat swab
+ +
+ + +
Positive control Weak positive control Negative control
i
+
-c
-
+ + -
other investigators to be associated with IUFDs. Burch et al. (11) found coxsackievirus B2, B3, or B4 by immunofluorescence in myocardial tissues from 3 stillborn babies with gestational ages ranging from 5 to 8 months. Using similar techniques, Bates (12) found coxsackievirus B3 in heart tissues of a stillborn infant near term, who had pancarditis and hydrops fetalis. A transplacentary transmission mode of echovirus 11 has been suggested by Modlin (13) and has been confirmed by recovery of echovirus 11 from amniotic fluid of a stillborn infant with gestational age of 38 weeks (14) and from cord blood of an infant with signs of infection at birth (15). We have described a case of I U F D early in the third trimester apparently due to intrauterine infection with echovirus 11. Results obtained by virus isolation, serology, and PCR on nucleic acid from various fetal tissues, implied echovirus 11 as the responsible agent. The time when the mother became infected could not be determined with certainty. However, the features of simultaneous community outbreak, infection in the family, a further slight increase of enterovirus IgG antibodies in a late serum as well as a corresponding decrease of IgM antibody reactivity, strongly suggested that the maternal echovirus 11 infection was ensuing o r accompanying the infection of her 18-month-old son. It is noteworthy that the histopathological examination only revealed discrete signs of a possible but not definite myocarditis in addition to the acute chorioamnionitis. Similarly, in the maternal echovirus 11 infection presented by Freedman (16), no significant histopathological changes were seen in the stillborn fetus. Since isolation of virus from fetal tissues failed, this case of IUFD was interpreted to be a consequence of maternal fever and intense dehydration. This interpretation seems questionable since transplacentary enterovirus was not excluded by alternative virus detection techniques. In our case, we found enteroviral RNA in several tissues of the fetus indicative of a generalized infection that could be directly responsible for the IUFD. The present study demonstrated the usefulness of PCR for the detection of enteroviral RNA in clinical specimens. PCR has previously been used to detect enteroviruses in cerebrospinal fluid (17, 18) and in muscle biopsies (19, 20). Our results showed that enterovirus PCR can also be applied on paraffin-embedded specimens. This finding expands
Scand J Infect Dis 23
Fetal deuth due to echovirus 11 385
the possibility of making retrospective diagnosis o f enteroviral infections in cases where such infection is not initially suspected. The impact of echovirus I 1 and other enteroviruses in causation of IUFD is still unclear. Since this is a matter of considerable importance, extended studies are warranted. PCR is a technique with a tremendous potential in diagnostic virology and provides a feasible method for further studies on this subject.
ACKNOWLEDGEMENTS
Scand J Infect Dis Downloaded from informahealthcare.com by Mcgill University on 12/09/14 For personal use only.
We wish t o thank Dr Janis Abens for synthesis o f the primers used in the PCR. Wc also thank Dr Bo Johansson for advice in the computer-assisted analysis of enteroviral genomes and selection of primers.
REFERENCES 1. Griffiths PD, Baboonian C. A prospective study of primary cytomegalovirus infection during pregnancy: final report. Br J Obstet Gynaecol 91: 307-315, 1984. 2. Nahmias AJ. Keyserling HL. Kerrick RN. Herpes simplex. In: Rcmington JS, Klein JO. eds. Infectious diseases of the fetus and newborn infant. Philadelphia: WB Saunders. 636-678, 1983. 3 . Bond PR. Caul EO. Usher J. ct al. Intrauterine infection with human parvovirus. Lancet 1: 448-449, 1986. 4. Horn P. Poliomyelitis in pregnancy. A twenty-year report from Los Angeles County, California. Obstet Gynecol 6: 121-137, 1955. 5 . Miller E. Cradock-Watson JE. Pollock TM. Consequences of confirmed maternal rubella at successive stages of pregnancy. Lancet 2: 781-784, 1982. 6. Samuelson A , Skoog E, Forsgren M. Aspects on the diagnosis of enterovirus infection5 by ELISA. Serodiagn lmmunother Infect Dis 4: 395406. 199I. 7. Kawasaki ES. Sample preparation from blood, cells. and other fluids. In: Innis MA. Gclfand DH. Sninsky JJ. White TJ. cds. PCR protocols: A guide to methods and applications. San Diego: Academic Press. 144-152, 1990. 8. Wright DK, Manos MM. Sample preparation from paraffin-embedded tissues. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: A guide to methods and applications. San Diego: Academic Press. 153-158. 1990. 9. Rotbart H A . PCR amplification of enteroviruses. In: Innis MA, Gelfand DH, Sninsky JJ. White TJ. eds. PCR protocols: A guide to methods and applications. San Diego: Academic Press. 372-377, 1990. 10. Abebc A , Johansson B. Abcns J . StrannegBrJ 0. Detection of enteroviruscs in faeces by polynierase chain reaction. Scand J Infect Dis 24: 265-273, 1992. 1 I. Burch GE, Sun S-C, Chu K-C, et al. Interstitial and coxsackievirus B myocarditis in infants and children. JAMA 203: 55-62. IY68. 12. Bates HR. Coxsackie virus B3 calcific pancarditis and hydrops fetalis. Am J Obstet Gynecol 106: 62Y-630. 1970. 13. Modlin JF. Fatal echovirus 1 1 disease in premature neonates. Pediatrics 66: 775-780, 1980. 14. Skeels MR, Williams JJ. Ricker FM. Perinatal cchovirus infection. N Engl J Med 305: 1529-1530, 1981. 15. Jones MJ, Kolb M. Votava HJ. et al. Intrauterine echovirus type 11 infection. Mayo Clin Proc 55: 509-5 12, 1980. 16. Freedman PS. Echovirus 11 infection and intrautcrine death. Lancet 1: 9 6 9 7 , 1979. 17. Rotbart H A . Enzymatic RNA amplification of the enteroviruses. J Clin Microbiol 28: 438-442, 1990. 18. Rotbart HA. Diagnosis of enteroviral meningitis with the polymerase chain reaction. J Pediatr 117: 85-89. 1990. 1Y. Gin 0. Sole MJ, Butany JW, Chia WK, McLaughlin PR, Liew CC. Detection of enterovirus RNA in myocardial biopsies from patients with myocarditis and cardiomyopathy using gene amplification by polymerase chain reaction. Circulation 82: 8-16, 1990. 20. Cow JW. Behan WMH, Clements GB, Woodall C. Riding M. Behan PO. Enteroviral RNA sequences detected by polymerase chain reaction i n muscle of patients with postviral fatigue syndrome. BMJ 302: 692-696, 1991.
