ISSN 00062979, Biochemistry (Moscow), 2014, Vol. 79, No. 1, pp. 6976. © Pleiades Publishing, Ltd., 2014. Original Russian Text © A. O. Mikhaylina, O. S. Kostareva, A. V. Sarskikh, R. V. Fedorov, W. Piendl, M. B. Garber, S. V. Tishchenko, 2014, published in Biokhimiya, 2014, Vol. 79, No. 1, pp. 8795.
Investigation of the Regulatory Function of Archaeal Ribosomal Protein L4 A. O. Mikhaylina1*, O. S. Kostareva1, A. V. Sarskikh1, R. V. Fedorov2, W. Piendl3, M. B. Garber1, and S. V. Tishchenko1 1 Institute of Protein Research, Russian Academy of Sciences, 142290 Pushchino, Moscow Region, Russia; fax: +7 (495) 5140218; Email: [email protected] 2 Research Division for Structural Analysis, OE8830, Hannover Medical School, CarlNeubergStrasse 1, 30625 Hannover, Germany; fax: +495115325966; Email: Fedorov.Roman@mhhannover.de 3 Biocenter, Division of Medical Biochemistry, Innsbruck Medical University, 6020 Innsbruck, Austria; fax: +43512900373110; Email: wolfgang.piendl@imed.ac.at
Received September 4, 2013 Revision received October 2, 2013 Abstract—Ribosomal protein L4 is a regulator of protein synthesis in the Escherichia coli S10 operon, which contains genes of 11 ribosomal proteins. In this work, we have investigated regulatory functions of ribosomal protein L4 of the thermophilic archaea Methanococcus jannaschii. The S10like operon from M. jannaschii encodes not 11, but only five ribosomal proteins (L3, L4, L23, L2, S19), and the first protein is L3 instead of S10. We have shown that MjaL4 and its mutant form lacking an elongated loop specifically inhibit expression of the first gene of the S10like operon from the same organism in a cou pled transcription−translation system in vitro. By deletion analysis, an L4binding regulatory site has been found on MjaL3 mRNA, and a fragment of mRNA with length of 40 nucleotides has been prepared that is necessary and sufficient for the specific interaction with the MjaL4 protein. DOI: 10.1134/S0006297914010106 Key words: ribosomal protein L4, S10like operon of mRNA, archaea, regulation of ribosomal protein synthesis, coupled transcription–translation system in vitro
domains II and V of 23S rRNA, which promotes the fold ing of rRNA during the formation of the ribosome [57]. Nevertheless, the loopfree mutant form of protein L4 continues to regulate expression of the S10 operon pro teins and is included into the large ribosomal subunit [8]. The regulation of the transcription and translation of the E. coli S10 operon depends on the noncoding leader region of mRNA from the 5′end of the first gene of ribo somal protein S10 [9]. Regions of mRNA necessary for transcriptional and translational regulation by protein L4 are overlapping but not identical [3]. Transcription is reg ulated as a result of an attenuation mechanism when pro tein L4 together with the transcription factor NusA increases the RNA polymerase pause duration on the ter mination region of the leader mRNA, which results in untimely termination [2]. As a rule, ribosomal regulatory proteins bind with the mRNA region of their operon that is homologous in structure with the specific binding site on rRNA [1]. However, the major binding site of riboso mal protein L4 on 23S rRNA does not have obvious homology with the regulatory site [10, 11].
The balanced synthesis of ribosomal proteins usually occurs on the translational level according to the feed back mechanism, when one of the ribosomal proteins encoded by the given operon, in the case of its oversyn thesis, acts as a repressor of translation of the mRNA of the operon [1]. Such regulation in E. coli is exemplified by the S10 operon, which contains genes of 11 ribosomal proteins (S10, L3, L4, L23, L2, S19, L22, S3, L16, L29, S17) [2] whose synthesis is regulated by the ribosomal protein L4 on both the translational and transcriptional levels [3]. In the ribosome, protein L4 binds mainly with domain I of 23S rRNA and is located within the peptidyl transferase center of the large ribosomal subunit. It is a singledomain protein consisting of a globular part locat ed on the 50S subunit surface and an elongated loop con taining about 50 amino acid residues (a.a.) and forming part of the ribosome exit tunnel [4]. On binding with rRNA, the unordered loop is structured and interacts with * To whom correspondence should be addressed.
69
70
MIKHAYLINA et al.
Analysis of the secondary structures of leader sequences of S10 mRNAs from various bacteria of the γ subdivision [12] revealed high structural homology with the leader region of E. coli, which carries determinants for binding protein L4. It seems that in all these species the mechanism of S10 operon regulation by ribosomal pro tein L4 is similarly to that in E. coli. However, in archaea the untranslated region of the S10like operon mRNA does not have homology with either the primary or the secondary structure of the leader sequence of the E. coli S10 operon mRNA. The first gene of the S10like operon of archaea is the gene rpl3 of the ribosomal protein L3 [12]. We studied the ribosomal protein L4 from the extremely thermophilic archaea Methanococcus jan naschii (MjaL4) and its mutant form with deleted elon gated loop (MjaL4Δloop). In the present paper, we show that proteins MjaL4 and MjaL4Δloop are able to specifi cally regulate synthesis of protein L3 of M. jannaschii (MjaL3) from a plasmid containing 25 and more nucleotides (nt) of the 5′untranslated region (5′UTR) and gene rpl3 in a coupled in vitro transcription–transla tion system. Based on this finding, we supposed that MjaL4 should be a regulatory protein of the whole S10 like operon of M. jannaschii. Deletion analysis of the 5′UTR and of the sense part of the MjaL3 mRNA was performed; the affinity of MjaL4 for specific fragments of mRNA was determined by gelshift assay, filter binding assay, and thermophore sis. A fragment of mRNA with the length of 40 nt has been prepared that is necessary and sufficient for binding with protein L4; the absence of the elongated loop is shown to lower the affinity of MjaL4Δloop for mRNA by approximately threefold.
MATERIALS AND METHODS Preparation of genetic constructions carrying genes Δloop. In accordance encoding proteins MjaL4 and MjaL4Δ with the known nucleotide sequence encoding protein MjaL4 (rpl4), oligonucleotide primers 1 and 2 were syn thesized (Table 1) (Syntol, Russia). These primers con tain sites for cleavage by sitespecific restriction endonu cleases XbaI and HindIII necessary for inserting the gene into expression vector pET11a. To prepare the gene encoding protein MjaL4Δloop, partially overlapping oligonucleotide primers 3 and 4 were also used (Table 1). Genomic DNA of M. jannaschii was used as a template to prepare the gene encoding the fullsize protein MjaL4. The gene encoding the mutant MjaL4Δloop was prepared by the method of overlapping regions using four primers and three PCR reactions. Primers 1 and 4 (Table 1) were used for amplification of the DNA fragment that includ ed the region before the excised loop and the fragment after it. Primers 2 and 3 (Table 1) were used in the second
PCR for amplification of the DNA fragment that includ ed the region after the excised loop and the fragment before it. As a template for PCR, plasmid pET11a carry ing the gene encoding protein MjaL4 was used. Thus, the two amplified fragments contained the overlapping regions. The overlapping fragments were mixed, dena tured, and annealed together to prepare a heteroduplex, which was used in the third PCR where they were ampli fied to a fullsize fragment using two primers (1 and 2) to gene rpl4. Creation of genetic constructs carrying gene of MjaL3 mRNA (mRNAMja) and its fragments with different length. In the coupled in vitro transcription–translation system of E. coli, four plasmids that included 5′UTR with different lengths and gene rpl3 controlled by the T7 promoter were used as templates. Forward primers 5, 7, 8, and 9 (Table 1) also contained a sequence of the T7 pro moter, and there was one reverse primer 6 (Table 1). The M. jannaschii genomic DNA was used as a template. For creation of specific fragments of mRNAMja con taining different length regions of 5′UTR and/or of the sense part of the mRNA, oligonucleotides were synthe sized (Evrogen, Russia), and on the 5′ends of these oligonucleotides sites were inserted for cleavage by restrictases XmaI and HindIII, which are necessary for cloning mRNA genes into the pUC18 vector (Table 1). The genes were amplified using PCR and cloned into vec tor pUC18 by restriction sites XmaI and HindIII. The for ward oligonucleotide contained the promoter T7 sequence. The M. jannaschii genomic DNA was used as a template. The resulting plasmids were linearized by the SmaI site. Δloop. To pre Isolation of proteins MjaL4 and MjaL4Δ pare superproducing strains, Studier’s system was used [13]. Because the gene rpl4 contains codons for Gly, Arg, and Ile, which are infrequent in E. coli, strain BL21(DE3) cells were preliminarily transformed with the Rosetta plasmid carrying genes of tRNAs recognizing rare codons (AGG/AGA (Arg), CGG (Arg), AUA (Ile), CUA (Leu), CCC (Pro), GGA (Gly)). The E. coli strain BL21(DE3)/Rosetta was transformed with the pET11a plasmid, which included the gene encoding protein MjaL4 or MjaL4Δloop. The cells BL21(DE3)/Rosetta/pET11a_MjaL4 or BL21(DE3)/Rosetta/pET11a_MjaL4Δloop were sus pended in a solution containing 50 mM TrisHCl (pH 7.5), 1 M NaCl, 80 mM MgCl2, 5 mM βmercap toethanol (βME), and one tablet of a protease inhibitor cocktail (Roche Diagnostics, Germany). The cells were disrupted with an ultrasonic disintegrator (Sonic Dismembrator 550; Fisher Scientific, USA) and then successively precipitated by centrifugation of the cell debris (14,000g, 30 min, 4°C) and ribosomes (90,000g, 1 h, 4°C). The resulting supernatant was heated at 70°C for 20 min. Thermolabile proteins were precipitated by centrifugation (14,000g, 30 min, 4°C). The resulting BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
REGULATORY FUNCTION OF ARCHAEAL RIBOSOMAL PROTEIN L4
71
Table 1. Sequences of primers for genes encoding proteins MjaL4 and MjaL4Δloop and for different fragments of mRNA Forward primer
Reverse primer
rpl4 (MjaL4)
No. 1 5′CCGTTCCTCTAGAGAAGGAGATATACAT ATGAAGGCTGTTGTTTATAATTTAAATGG3′
No. 2 5′ATCTAGAAGCTTTTATTCAAATCTCTCTT TTA3′
rpl4Δ (MjaL4Δloop)
No. 3 5′GCCAAAAGGTAAAGTTGAGA3′
No. 4 5′TCTCAACTTTACCTTTTGGC3′
5′UTR (203 nt)_rpl3
No. 5 5′CTACTGCAAAGCTTAATACGACTCACTA TAGGACAGGTTTGCAAAATATAGT3′
No. 6 5′ATCTAGCCCGGGTTACTTACCTTGCTTT GATGTTGTACTT3′
5′UTR (150 nt)_rpl3
No. 7 5′CTACTGCAAAGCTTAATACGACTCACTA TAGACATTGAACGCCTTTAAGGCGTT3′
No. 6
5′UTR (50 nt)_rpl3
No. 8 5′CTACTGCAAAGCTTAATACGACTCACTA TAGCTCAAATAAAAGATTTTAA3′
No. 6
5′UTR (25 nt)_rpl3
No. 9 5′CTACTGCAAAGCTTAATACGACTCACTA TAGCAATAAATATGCTGGAGGTTAG3′
No. 6
Gene fragment
No. 10 5′ATCTAGCCCGGGCTTCTGGCCAGCTTC TAATTCTTCTTGG3′
mRNAMja (–203 +100) No. 5
mRNAMja (–150 +70)
No. 11 5′CTACTGCAAAGCTTAATACGACTCACTA TAGACATTGAACGCCTTTAAGGCGTTC3′
No. 12 5′ATCTAGCCCGGGGTCTTTTTGCTCTTT TTCTTGG3′
mRNAMja (–27 +7)
No. 13 5′CTACTGCAAAGCTTAATACGACTCACTA TAGGGGGATCAATAAATATGCTGGAGGTT AGA3′
No. 14 5′ATCTAGCCCGGGGGGACCCCATAATCT AACCTCCAGCA3′
mRNAMja (–100)
No. 15 5′CTACTGCAAAGCTTAATACGACTCACTA TAGTTTGAAAGACACTATAAAAAAGC3′
No. 16 5′ATCTAGCCCGGGAATCTAACCTCCTCC AGCATATT3′
mRNAMja (+90)
No. 17 5′CTACTGCAAAGCTTAATACGACTCACTA TAGATATTAACAGACCAAGAAGAGGT3′
No. 18 5′ATCTAGCCCGGGCTTCTGGCCAGCTTC TAATTCTTGGA3′
mRNAMja (–10 +40)
No. 19 5′CTACTGCAAAGCTTAATACGACTCACTA TAGAGGTTAGATTATGGGGTTAAAT3′
No. 20 5′ATCTAGCCCGGGCTAATGAACCTCTTC TTGGTCTGTTAATATTTAACCCCAT3′
Note: 5′UTR is shown with sign “–”, the sense part of mRNA is shown with sign “+”.
lysate was diluted with buffer (50 mM TrisHCl, pH 7.5, 5 mM βME) to obtain the final NaCl concentration of 150 mM, and affinity chromatography was performed on HeparinSepharose (GEHealthcare, Sweden). The pro teins were eluted with a linear NaCl gradient (150 mM 1.6 M) in 50 mM TrisHCl (pH 7.5) buffer supplemented with 5 mM βME. For additional purification, hydropho bic chromatography was performed on butylSepharose (GEHealthcare). Preparations of the ribosomal proteins MjaL4 or MjaL4Δloop were dialyzed into starting buffer: BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
50 mM TrisHCl (pH 7.5), 600 mM NaCl, 5 mM βME. Then ammonium sulfate (AS) was added into the prepa ration to final concentration 1.5 M. After placing the sample on the column, the proteins were eluted with a reverse linear gradient of AS concentration (1.50 M) in the starting buffer. The purity of the protein preparations was evaluated by SDSPAGE. Isolation of mRNAMja fragments with different length and of a specific fragment of rRNA. Fragments of mRNA were prepared by in vitro transcription using RNA poly
72
MIKHAYLINA et al.
merase of T7 phage from the corresponding linearized plasmids. Plasmids based on the pUC18 vector linearized using endonuclease SmaI and containing a fragment of the gene encoding mRNAMja controlled by promoter T7 RNA polymerase were used as templates. The plasmid carrying the fragment of 23S rRNA from T. thermophilus that specifically bound with ribosomal protein L4 was presented to us earlier by Dr. U. Stelzl (Germany). The RNA transcripts were analyzed and purified by electrophoresis in 10% polyacrylamide gel in the presence of 8 M urea as described in the work by Tischenko et al. [14]. Analysis of inhibition of synthesis of protein MjaL3 in the coupled in vitro transcription–translation system. For experiments, an RTS 100 E. coli HY Kit (Roche, Germany) was used. Plasmids that carried the 5′UTR and gene rpl3 under the control of the T7 promoter were used as templates, and a plasmid that carried the gene of ribosomal protein L10 from M. jannaschii (MjaL10) was used as a negative control. To inhibit MjaL3 synthesis from the plasmid, into the reaction mixture MjaL4 or MjaL4Δloop were added in the amount of 040 μM or the same amount of protein MjaL10. For experiments with competition, the mixture was additionally supplemented with a fragment of 23S rRNA from T. thermophilus spe cific for ribosomal protein L4 or with a fragment of 23S rRNA specifically binding with protein L10, in the amount of 080 μM. For reaction termination, the mix ture was supplemented with 10 volumes of cooled ace tone, incubated for 30 min at –20°C, and then cen trifuged at 13,000 rpm for 10 min at 4°C. The precipitate was dried, dissolved in 20 μl of buffer for samples for SDSPAGE in the presence of urea, and placed onto polyacrylamide gel. Preparation of RNA–protein complexes. A solution of the RNA fragment was heated at 60°C for 10 min, cooled on ice, and supplemented with a solution of the protein dialyzed against buffer (50 mM TrisHCl, pH 7.5, 500 mM NaCl, 2 mM MgCl2) at RNA/protein molar ratio of 1 : 1. The resulting solution was incubated at room temperature for 20 min. Analysis of changes in mobility of RNA–protein com plexes in gel (gelshift). Analysis of changes in mobility in gel is based on the difference between the mobilities of RNA and RNA–protein complexes in polyacrylamide gel under native conditions [15]. Electrophoresis of RNA and RNA–protein complexes was conducted in 10% polyacrylamide gel using 90 mM TrisAc (pH 7.8) and 1 mM MgCl2 as the electrode buffer. Analysis of RNA–protein complexes by binding on nitrocellulose filters. In these experiments, traces of radiolabeled RNA were mixed with different concentra tions of the protein, and then the mixture was filtered through a nitrocellulose filter. To determine the dissociation constant of the com plexes (Kd), TMKCl buffer containing 50 mM TrisHCl
(pH 7.6), 20 mM MgCl2, 350 mM KCl, 1 mM βME, and 0.04% BSA was used. The protein and RNA were incu bated in TMKCl buffer separately for 5 min at 65°C and for 45 min at 37°C, respectively. In a total volume of 50 μl, a fixed amount of labeled RNA (12,00015,000 cpm) was mixed with an increasing quantity of the protein (1 nM 3 μM) and incubated for 15 min at 37°C and then for 15 min at 0°C. The RNA–protein complexes were adsorbed onto the nitrocellulose membranes (Protran BA83; Schleicher and Schuell, Germany) by filtration. The filters were washed with 350 μl of TMKCl buffer. Each binding curve was constructed from at least three experiments using nonlinear regression with the Qtiplot 0.9.7.8 program. −mRNA complexes by Determination of Kd of MjaL4− thermophoresis. This relatively new method is based on fixation of changes in the fluorescence of molecules under microscopic temperature gradients that are created with an infrared laser (IRlaser). Any change in the ther mophoretic features on addition of a partner molecule manifests itself as a change in fluorescence (F). The nor malized fluorescence Fnorm = Fhot/Fcold is determined, quantitative parameters of binding partner molecules can be obtained by a dilution series of one of the molecules, the Fnorm dependence on the concentration logarithm is constructed, and the complex Kd is determined from this plot. The experiments were performed using a Monolioth NT.115 device (NanoTemper, Germany). As the fluores cent molecule, the mRNAMja(–27 +7) fragment was used that was labeled with SYBR Gold dye (Invitrogen, USA). The mRNA fragment was mixed with the dye in the ratio 50 : 1 (v/v). On formation of the complexes, the concen tration of mRNA in the incubation mixture was 100 μM, and the quantity of the added protein was varied from 32 nM to 200 μM in different capillaries. The reaction was performed in hydrophilic capillar ies in 50 mM TrisHCl (pH 7.5) buffer supplemented with 300 mM NaCl and 0.1% Tween 20. The initial tem perature of incubation of MjaL4 with mRNA was 25°C, and on switching on the IRlaser the temperature inside the capillary reached 55°C.
RESULTS AND DISCUSSION Study of regulatory functions of MjaL4 and Δloop in E. coli in vitro coupled transcription– MjaL4Δ translation system. We studied the regulatory functions of the archaeal ribosomal protein MjaL4 and its mutant MjaL4Δloop lacking the 45a.a. loop. Both MjaL4 and MjaL4Δloop were found to be capable of regulating synthesis of protein MjaL3 encoded by the first gene of the S10like operon of M. jannaschii in the in vitro system of E. coli coupled transcription–trans lation. The same system was used earlier for testing regu latory functions of another archaeal ribosomal protein, BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
REGULATORY FUNCTION OF ARCHAEAL RIBOSOMAL PROTEIN L4
a 1
2
b
3
4
5
1
2
3
c 4
5
1
2
3
73
d 4
5
1
2
3
e 4
5
1
2
3
Fig. 1. Autoradiographs of protein MjaL3 synthesized in the presence of L[35S]methionine and different quantities of MjaL4 (ad): 1) 0 μM; 2) 5 μM; 3) 10 μM; 4) 20 μM; 5) 40 μM. As templates in the coupled transcription–translation system, constructions were used that carried gene rpl3 and the 5′UTR with length of 203 nt (a), 150 nt (b), 50 nt (c), and 25 nt (d). Autoradiograph of protein MjaL3 synthesized in the presence of L[35S]methionine and different quantities of MjaL4Δloop (e): 1) 0 μM; 2) 10 μM; 3) 40 μM; the construct that carried 5′UTR (25 nt) and rpl3 was used as the template.
a 1
2
3
b 4
5
1
2
3
c 4
5
1
2
3
Fig. 2. Autoradiographs of proteins MjaL3 (b, c) and MjaL10 (a) synthesized in the presence of L[35S]methionine and different amounts of MjaL4 (a), MjaL10 (b), or TmaL4 (c). a, b: 1) 0 μM; 2) 5 μM; 3) 10 μM; 4) 20 μM; 5) 40 μM. c: 1) 0 μM; 2) 40 μM MjaL4; 3) 40 μM TmaL4.
L1 [16, 17]. In our experiments templates were used that carried the rpl3 and 5′UTR with length of 20325 nt. On addition into the mixture of increasing amounts of MjaL4 or MjaL4Δloop, the synthesis of protein MjaL3 was inhibited (Fig. 1). It was shown that even at 5′UTR length of 25 nt, the inhibition of MjaL3 expression was retained (Fig. 1d). At the distance of 12 nt from the start codon, there is the Shine–Dalgarno sequence that is necessary for binding mRNA with the ribosome in both archaea and bacteria [18]; therefore, we could not use the genetic construct containing the rpl3 gene without the 5′UTR. To test the specificity of the interaction of MjaL4 pro tein with mRNA, control experiments were performed. As a negative control, a plasmid carried the gene encoding the ribosomal protein MjaL10 was used that (Fig. 2a). It was found that MjaL4 did not inhibit expression of the gene encoding a protein of another operon. To control the interaction specificity in experiments, ribosomal protein MjaL10 was used instead of protein MjaL4. The synthesis of MjaL3 was found to be virtually unchanged on addition of MjaL10 into the reaction mixture (Fig. 2b). Moreover, it was also found that the bacterial riboso mal protein L4 from Thermotoga maritima (TmaL4) also inhibited MjaL3 synthesis in the coupled system of trans lation–transcription (Fig. 2c). Because the affinity of the ribosomal regulatory pro tein L4 for mRNA is known to be weaker than for rRNA [10], we studied the competitive inhibition of MjaL3 syn BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
thesis. We found that in the presence in the incubation mixture of a 23S rRNA fragment carrying the specific binding site for protein L4, the synthesis of MjaL3 was not inhibited by proteins MjaL4 and MjaL4Δloop. And an addition into the incubation mixture of the 23S rRNA fragment specifically binding with protein L10 did not influence the inhibition of MjaL3 (Fig. 3). Thus, we have shown that protein MjaL4 can regu late MjaL3 synthesis by the principle of competition between sites of specific binding on rRNA and mRNA. Deletion analysis of MjaL3 mRNA and determination of dissociation constants of MjaL4–mRNA complexes. To more accurately determine the binding site of MjaL4 pro tein on mRNAMja, deletion analysis was performed and the affinity of shortened mRNA fragments for protein MjaL4 was determined. Fragments of mRNA containing regions of the 5′UTR and the sense part of MjaL3 mRNA with different length were obtained, and their affinities for protein MjaL4 (MjaL4Δloop) were studied by filter binding assay, gelshift assay, and thermophore sis. By the filter binding assay, we obtained the Kd of MjaL4 complexes with elongated fragments of mRNA and also with specific and nonspecific fragments of 23S rRNA (Table 2). The affinity of MjaL4 for mRNA frag ments was found to be approximately the same as the affinity of the E. coli protein L4 (EcoL4) for the specific fragment of E. coli mRNA [10]. For the 197nt specific fragment of mRNA from E. coli containing regulatory
74
MIKHAYLINA et al.
a 1
2
b
3
4
5
1
2
3
4
5
Fig. 3. Autoradiographs of protein MjaL3 synthesized in the presence of L[35S]methionine and excess of MjaL4 (a) or MjaL4Δloop (b). Moreover, the incubation mixture was supplemented with fragments of 23S rRNA specifically binding with protein L4 (rRNAL4) (3, 4) and a specific fragment of 23S rRNA binding with protein L10 (rRNAL10) (5). 1) 0 μM L4; 2) 40 μM L4; 3) 40 μM L4 + 40 μM rRNAL4; 4) 40 μM L4 + 80 μM rRNAL4; 5) 40 μM L4 + 80 μM rRNAL10.
a 1
2
b 3
1
2
c 3
1
2
L4mRNAMja
mRNAMja (+90) mRNAMja (–10 +40)
mRNAMja (–100)
Fig. 4. Electrophoresis of L4–RNA complexes under nondenaturing conditions. 1) RNA fragment; 2) MjaL4–RNA fragment; 3) MjaL4Δloop–RNA fragment. Analysis of formation of complexes of proteins MjaL4 and MjaL4Δloop: a) with mRNAMja (–10 +40) fragment; b) with mRNAMja (–100) fragment; c) with mRNAMja (+90) fragment.
Table 2. Dissociation constants of L4–RNA complexes obtained by the method of binding on filters Complex
Kd, nM
MjaL4/mRNAMja (–203 +100)
400 ± 15
MjaL4/mRNAMja (–150 +70)
600 ± 21
MjaL4/rRNATthL4
50 ± 3
MjaL4/rRNAMjaL10
8000 ± 287
EcoL4/rRNAEco (53 nt)*
230
EcoL4/mRNAEco (197 nt)*
800
Note: The number of 5′UTR nucleotides is shown with sign “−”, the number of nucleotides in the sense part of mRNA is shown with sign “+”. * Data from the work of Stelzl et al. [10].
Table 3. Affinity of MjaL4 for mRNAMja fragments of dif ferent length mRNAMja
Presence (+) or absence (−) of complex
Kd, nM
mRNAMja (–203 +100)
+
400 ± 15
mRNAMja (–150 +70)
+
600 ± 21
mRNAMja (–27 +7)
+
451 ± 17
mRNAMja (–100)
+
*
mRNAMja (+90)
–
mRNAMja (–10 +40)
–
* Kd of the complex was not determined.
BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
REGULATORY FUNCTION OF ARCHAEAL RIBOSOMAL PROTEIN L4
a
75
b 650
MjaL4–mRNA Kd = 451 ± 17 nM
550
450
350
Fnorm[1/1000]
101
102
103
104
105
106
MjaL4Δloop–mRNA
650
Kd = 1230 ± 34 nM 550
450
350 101
102
103
104
105
106
Concentration, nM
Fig. 5. a) Supposed secondary structure of mRNAMja (–27 +7) fragment predicted with the RNAfold WebServer (http://rna.tbi.univie.ac.at/cgibin/RNAfold); b) thermophoresis of binding of proteins MjaL4 and MjaL4Δloop with the specific mRNAMja (–27 +7) fragment.
regions for EcoL4, the Kd value determined by binding on filters is 800 nM [10], whereas for complexes MjaL4/mRNAMja it is Kd = 400600 nM. The nonspecif ic binding of MjaL4 was more than one order of magni tude weaker than the specific binding. The purpose of our further work was to determine the minimal fragment of mRNA specifically binding with pro tein MjaL4. By the gelshift assay, the mRNAMja (+90) fragment lacking the leader sequence was shown to be unable to form stable complexes with protein MjaL4, whereas the mRNAMja (–100) fragment containing 100nt 5′UTR formed a complex (Fig. 4, b and c). These find ings suggested that determinants for binding MjaL4 are located in the 5′UTR of mRNA. The mRNA (–10 +40) fragment containing a 5′UTR region shortened to 10 nt BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
did not interact with protein MjaL4 (Fig. 4a), which sug gested that the binding site should be located in the region between the 25th and 10th nucleotides from the start codon. A fragment was obtained that contained 27 nt of the 5′UTR and 7 nt of the sense part of mRNAMja. Three nucleotides were added from the 5′ and 3′ends to create the restriction site for SmaI. Thus, the length of the frag ment was 40 nt (Fig. 5a). Dissociation constants of this mRNA fragment with mRNA with MjaL4 or MjaL4Δloop were determined by thermophoresis. The affinity of MjaL4 for this short frag ment of mRNA was virtually the same as for long frag ments of mRNA (Table 3), and the absence of the elon gated loop decreased the affinity by threefold (Fig. 5b). The regulatory properties of the mutant form of bacterial
76
MIKHAYLINA et al.
ribosomal protein L4 from Thermus aquaticus lacking the corresponding loop are known to be threefold decreased [19]. It seems that the role of this loop in the stabilization of the L4–RNA complex is not high and is the same for both the bacterial and archaeal L4 proteins. The resulting minimal specific fragment of mRNA with length of 40 nt can be used in experiments for crys tallization of the regulatory archaeal complex. This work was supported by the Russian Academy of Sciences, the program “Molecular and Cellular Biology” of the Russian Academy of Sciences Presidium, and by the Russian Foundation for Basic Research (project No. 120431121 mol_a). The work of A. O. Mikhaylina was supported by grants of FEBS (Summer Fellowship) and EMBO (ASTF No. 2532011).
REFERENCES 1. 2. 3. 4.
5.
Nomura, M., Yates, J. L., Dean, D., and Post, L. E. (1980) Proc. Natl. Acad. Sci. USA, 77, 70847088. Zengel, J. M., and Lindahl, L. (1994) Prog. Nucleic Acids Res. Mol. Biol., 47, 331370. Zengel, J. M., and Lindahl, L. (1990) J. Mol. Biol., 213, 6778. Schuwirth, B. S., Borovinskaya, M. A., Hau, C. W., Zhang, W., VilaSanjurjo, A., Holton, J. M., and Cate, J. H. (2005) Science, 310, 827834. Tumminia, S. J., Hellmann, W., Wall, J. S., and Boublik, M. (1994) J. Mol. Biol., 235, 12391250.
6. Ban, N., Nissen, P., Hansen, J., Capel, M., Moore, P. B., and Steitz, T. A. (1999) Nature, 400, 841847. 7. Timsit, Y., Acosta, Z., Allemand, F., Chiaruttini, C., and Springer, M. (2009) Int. J. Mol. Sci., 10, 817834. 8. Zengel, J. M., Jerauld, A., Walke, A., Markus, R., Wahl, C., and Lindahl, L. (2003) RNA, 9, 11881197. 9. Shen, P., Zengel, J. M., and Lindahl, L. (1988) Nucleic Acids Res., 16, 89058924. 10. Stelzl, U., Zengel, J. M., Tovbina, M., Walker, M., Nierhaus, K. H., Lindahl, L., and Patel, D. J. (2003) J. Biol. Chem., 278, 2823728245. 11. Stelzl, U., and Nierhaus, K. H. (2001) RNA, 7, 598609. 12. Allen, T., Shen, P., Samsel, L., Liu, R., Lindahl, L., and Zengel, J. M. (1999) J. Bacteriol., 181, 61246132. 13. Studier, F., Rosenberg, A., Dunn, J., and Dubendorff, J. (1990) J. Methods Enzymol., 185, 6089. 14. Tishchenko, S., Gabdulkhakov, A., Nevskaya, N., Sarskikh, A., Kostareva, O., Nikonova, E., Sycheva, A., Moshkovskii, S., Garber, M., and Nikonov, S. (2012) Acta Crystallogr. D, 68, 10511057. 15. Draper, D. E., Deckman, I. C., and Vartikar, J. V. (1988) Methods Enzymol., 164, 203220. 16. Mayer, C., Kohrer, C., Grobner, P., and Piendl, W. (1998) Mol. Microbiol., 27, 455468. 17. Kraft, A., Lutz, C., Lingenhel, A., Grobner, P., and Piendl, W. (1999) Genetics, 152, 13631372. 18. Amils, R., Cammarano, P., and Londei, P. (1993) in The Biochemistry of Archaea (Archaebacteria) (Kates, M., Kushner, D. J., and Matheson, A. T., eds.) Elsevier Biomedical Press, Amsterdam, pp. 393438. 19. Zengel, J. M., Mueckl, D., and Lindahl, L. (1980) Cell, 21, 523535.
BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
Investigation of the Regulatory Function of Archaeal Ribosomal Protein L4 A. O. Mikhaylina1*, O. S. Kostareva1, A. V. Sarskikh1, R. V. Fedorov2, W. Piendl3, M. B. Garber1, and S. V. Tishchenko1 1 Institute of Protein Research, Russian Academy of Sciences, 142290 Pushchino, Moscow Region, Russia; fax: +7 (495) 5140218; Email: [email protected] 2 Research Division for Structural Analysis, OE8830, Hannover Medical School, CarlNeubergStrasse 1, 30625 Hannover, Germany; fax: +495115325966; Email: Fedorov.Roman@mhhannover.de 3 Biocenter, Division of Medical Biochemistry, Innsbruck Medical University, 6020 Innsbruck, Austria; fax: +43512900373110; Email: wolfgang.piendl@imed.ac.at
Received September 4, 2013 Revision received October 2, 2013 Abstract—Ribosomal protein L4 is a regulator of protein synthesis in the Escherichia coli S10 operon, which contains genes of 11 ribosomal proteins. In this work, we have investigated regulatory functions of ribosomal protein L4 of the thermophilic archaea Methanococcus jannaschii. The S10like operon from M. jannaschii encodes not 11, but only five ribosomal proteins (L3, L4, L23, L2, S19), and the first protein is L3 instead of S10. We have shown that MjaL4 and its mutant form lacking an elongated loop specifically inhibit expression of the first gene of the S10like operon from the same organism in a cou pled transcription−translation system in vitro. By deletion analysis, an L4binding regulatory site has been found on MjaL3 mRNA, and a fragment of mRNA with length of 40 nucleotides has been prepared that is necessary and sufficient for the specific interaction with the MjaL4 protein. DOI: 10.1134/S0006297914010106 Key words: ribosomal protein L4, S10like operon of mRNA, archaea, regulation of ribosomal protein synthesis, coupled transcription–translation system in vitro
domains II and V of 23S rRNA, which promotes the fold ing of rRNA during the formation of the ribosome [57]. Nevertheless, the loopfree mutant form of protein L4 continues to regulate expression of the S10 operon pro teins and is included into the large ribosomal subunit [8]. The regulation of the transcription and translation of the E. coli S10 operon depends on the noncoding leader region of mRNA from the 5′end of the first gene of ribo somal protein S10 [9]. Regions of mRNA necessary for transcriptional and translational regulation by protein L4 are overlapping but not identical [3]. Transcription is reg ulated as a result of an attenuation mechanism when pro tein L4 together with the transcription factor NusA increases the RNA polymerase pause duration on the ter mination region of the leader mRNA, which results in untimely termination [2]. As a rule, ribosomal regulatory proteins bind with the mRNA region of their operon that is homologous in structure with the specific binding site on rRNA [1]. However, the major binding site of riboso mal protein L4 on 23S rRNA does not have obvious homology with the regulatory site [10, 11].
The balanced synthesis of ribosomal proteins usually occurs on the translational level according to the feed back mechanism, when one of the ribosomal proteins encoded by the given operon, in the case of its oversyn thesis, acts as a repressor of translation of the mRNA of the operon [1]. Such regulation in E. coli is exemplified by the S10 operon, which contains genes of 11 ribosomal proteins (S10, L3, L4, L23, L2, S19, L22, S3, L16, L29, S17) [2] whose synthesis is regulated by the ribosomal protein L4 on both the translational and transcriptional levels [3]. In the ribosome, protein L4 binds mainly with domain I of 23S rRNA and is located within the peptidyl transferase center of the large ribosomal subunit. It is a singledomain protein consisting of a globular part locat ed on the 50S subunit surface and an elongated loop con taining about 50 amino acid residues (a.a.) and forming part of the ribosome exit tunnel [4]. On binding with rRNA, the unordered loop is structured and interacts with * To whom correspondence should be addressed.
69
70
MIKHAYLINA et al.
Analysis of the secondary structures of leader sequences of S10 mRNAs from various bacteria of the γ subdivision [12] revealed high structural homology with the leader region of E. coli, which carries determinants for binding protein L4. It seems that in all these species the mechanism of S10 operon regulation by ribosomal pro tein L4 is similarly to that in E. coli. However, in archaea the untranslated region of the S10like operon mRNA does not have homology with either the primary or the secondary structure of the leader sequence of the E. coli S10 operon mRNA. The first gene of the S10like operon of archaea is the gene rpl3 of the ribosomal protein L3 [12]. We studied the ribosomal protein L4 from the extremely thermophilic archaea Methanococcus jan naschii (MjaL4) and its mutant form with deleted elon gated loop (MjaL4Δloop). In the present paper, we show that proteins MjaL4 and MjaL4Δloop are able to specifi cally regulate synthesis of protein L3 of M. jannaschii (MjaL3) from a plasmid containing 25 and more nucleotides (nt) of the 5′untranslated region (5′UTR) and gene rpl3 in a coupled in vitro transcription–transla tion system. Based on this finding, we supposed that MjaL4 should be a regulatory protein of the whole S10 like operon of M. jannaschii. Deletion analysis of the 5′UTR and of the sense part of the MjaL3 mRNA was performed; the affinity of MjaL4 for specific fragments of mRNA was determined by gelshift assay, filter binding assay, and thermophore sis. A fragment of mRNA with the length of 40 nt has been prepared that is necessary and sufficient for binding with protein L4; the absence of the elongated loop is shown to lower the affinity of MjaL4Δloop for mRNA by approximately threefold.
MATERIALS AND METHODS Preparation of genetic constructions carrying genes Δloop. In accordance encoding proteins MjaL4 and MjaL4Δ with the known nucleotide sequence encoding protein MjaL4 (rpl4), oligonucleotide primers 1 and 2 were syn thesized (Table 1) (Syntol, Russia). These primers con tain sites for cleavage by sitespecific restriction endonu cleases XbaI and HindIII necessary for inserting the gene into expression vector pET11a. To prepare the gene encoding protein MjaL4Δloop, partially overlapping oligonucleotide primers 3 and 4 were also used (Table 1). Genomic DNA of M. jannaschii was used as a template to prepare the gene encoding the fullsize protein MjaL4. The gene encoding the mutant MjaL4Δloop was prepared by the method of overlapping regions using four primers and three PCR reactions. Primers 1 and 4 (Table 1) were used for amplification of the DNA fragment that includ ed the region before the excised loop and the fragment after it. Primers 2 and 3 (Table 1) were used in the second
PCR for amplification of the DNA fragment that includ ed the region after the excised loop and the fragment before it. As a template for PCR, plasmid pET11a carry ing the gene encoding protein MjaL4 was used. Thus, the two amplified fragments contained the overlapping regions. The overlapping fragments were mixed, dena tured, and annealed together to prepare a heteroduplex, which was used in the third PCR where they were ampli fied to a fullsize fragment using two primers (1 and 2) to gene rpl4. Creation of genetic constructs carrying gene of MjaL3 mRNA (mRNAMja) and its fragments with different length. In the coupled in vitro transcription–translation system of E. coli, four plasmids that included 5′UTR with different lengths and gene rpl3 controlled by the T7 promoter were used as templates. Forward primers 5, 7, 8, and 9 (Table 1) also contained a sequence of the T7 pro moter, and there was one reverse primer 6 (Table 1). The M. jannaschii genomic DNA was used as a template. For creation of specific fragments of mRNAMja con taining different length regions of 5′UTR and/or of the sense part of the mRNA, oligonucleotides were synthe sized (Evrogen, Russia), and on the 5′ends of these oligonucleotides sites were inserted for cleavage by restrictases XmaI and HindIII, which are necessary for cloning mRNA genes into the pUC18 vector (Table 1). The genes were amplified using PCR and cloned into vec tor pUC18 by restriction sites XmaI and HindIII. The for ward oligonucleotide contained the promoter T7 sequence. The M. jannaschii genomic DNA was used as a template. The resulting plasmids were linearized by the SmaI site. Δloop. To pre Isolation of proteins MjaL4 and MjaL4Δ pare superproducing strains, Studier’s system was used [13]. Because the gene rpl4 contains codons for Gly, Arg, and Ile, which are infrequent in E. coli, strain BL21(DE3) cells were preliminarily transformed with the Rosetta plasmid carrying genes of tRNAs recognizing rare codons (AGG/AGA (Arg), CGG (Arg), AUA (Ile), CUA (Leu), CCC (Pro), GGA (Gly)). The E. coli strain BL21(DE3)/Rosetta was transformed with the pET11a plasmid, which included the gene encoding protein MjaL4 or MjaL4Δloop. The cells BL21(DE3)/Rosetta/pET11a_MjaL4 or BL21(DE3)/Rosetta/pET11a_MjaL4Δloop were sus pended in a solution containing 50 mM TrisHCl (pH 7.5), 1 M NaCl, 80 mM MgCl2, 5 mM βmercap toethanol (βME), and one tablet of a protease inhibitor cocktail (Roche Diagnostics, Germany). The cells were disrupted with an ultrasonic disintegrator (Sonic Dismembrator 550; Fisher Scientific, USA) and then successively precipitated by centrifugation of the cell debris (14,000g, 30 min, 4°C) and ribosomes (90,000g, 1 h, 4°C). The resulting supernatant was heated at 70°C for 20 min. Thermolabile proteins were precipitated by centrifugation (14,000g, 30 min, 4°C). The resulting BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
REGULATORY FUNCTION OF ARCHAEAL RIBOSOMAL PROTEIN L4
71
Table 1. Sequences of primers for genes encoding proteins MjaL4 and MjaL4Δloop and for different fragments of mRNA Forward primer
Reverse primer
rpl4 (MjaL4)
No. 1 5′CCGTTCCTCTAGAGAAGGAGATATACAT ATGAAGGCTGTTGTTTATAATTTAAATGG3′
No. 2 5′ATCTAGAAGCTTTTATTCAAATCTCTCTT TTA3′
rpl4Δ (MjaL4Δloop)
No. 3 5′GCCAAAAGGTAAAGTTGAGA3′
No. 4 5′TCTCAACTTTACCTTTTGGC3′
5′UTR (203 nt)_rpl3
No. 5 5′CTACTGCAAAGCTTAATACGACTCACTA TAGGACAGGTTTGCAAAATATAGT3′
No. 6 5′ATCTAGCCCGGGTTACTTACCTTGCTTT GATGTTGTACTT3′
5′UTR (150 nt)_rpl3
No. 7 5′CTACTGCAAAGCTTAATACGACTCACTA TAGACATTGAACGCCTTTAAGGCGTT3′
No. 6
5′UTR (50 nt)_rpl3
No. 8 5′CTACTGCAAAGCTTAATACGACTCACTA TAGCTCAAATAAAAGATTTTAA3′
No. 6
5′UTR (25 nt)_rpl3
No. 9 5′CTACTGCAAAGCTTAATACGACTCACTA TAGCAATAAATATGCTGGAGGTTAG3′
No. 6
Gene fragment
No. 10 5′ATCTAGCCCGGGCTTCTGGCCAGCTTC TAATTCTTCTTGG3′
mRNAMja (–203 +100) No. 5
mRNAMja (–150 +70)
No. 11 5′CTACTGCAAAGCTTAATACGACTCACTA TAGACATTGAACGCCTTTAAGGCGTTC3′
No. 12 5′ATCTAGCCCGGGGTCTTTTTGCTCTTT TTCTTGG3′
mRNAMja (–27 +7)
No. 13 5′CTACTGCAAAGCTTAATACGACTCACTA TAGGGGGATCAATAAATATGCTGGAGGTT AGA3′
No. 14 5′ATCTAGCCCGGGGGGACCCCATAATCT AACCTCCAGCA3′
mRNAMja (–100)
No. 15 5′CTACTGCAAAGCTTAATACGACTCACTA TAGTTTGAAAGACACTATAAAAAAGC3′
No. 16 5′ATCTAGCCCGGGAATCTAACCTCCTCC AGCATATT3′
mRNAMja (+90)
No. 17 5′CTACTGCAAAGCTTAATACGACTCACTA TAGATATTAACAGACCAAGAAGAGGT3′
No. 18 5′ATCTAGCCCGGGCTTCTGGCCAGCTTC TAATTCTTGGA3′
mRNAMja (–10 +40)
No. 19 5′CTACTGCAAAGCTTAATACGACTCACTA TAGAGGTTAGATTATGGGGTTAAAT3′
No. 20 5′ATCTAGCCCGGGCTAATGAACCTCTTC TTGGTCTGTTAATATTTAACCCCAT3′
Note: 5′UTR is shown with sign “–”, the sense part of mRNA is shown with sign “+”.
lysate was diluted with buffer (50 mM TrisHCl, pH 7.5, 5 mM βME) to obtain the final NaCl concentration of 150 mM, and affinity chromatography was performed on HeparinSepharose (GEHealthcare, Sweden). The pro teins were eluted with a linear NaCl gradient (150 mM 1.6 M) in 50 mM TrisHCl (pH 7.5) buffer supplemented with 5 mM βME. For additional purification, hydropho bic chromatography was performed on butylSepharose (GEHealthcare). Preparations of the ribosomal proteins MjaL4 or MjaL4Δloop were dialyzed into starting buffer: BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
50 mM TrisHCl (pH 7.5), 600 mM NaCl, 5 mM βME. Then ammonium sulfate (AS) was added into the prepa ration to final concentration 1.5 M. After placing the sample on the column, the proteins were eluted with a reverse linear gradient of AS concentration (1.50 M) in the starting buffer. The purity of the protein preparations was evaluated by SDSPAGE. Isolation of mRNAMja fragments with different length and of a specific fragment of rRNA. Fragments of mRNA were prepared by in vitro transcription using RNA poly
72
MIKHAYLINA et al.
merase of T7 phage from the corresponding linearized plasmids. Plasmids based on the pUC18 vector linearized using endonuclease SmaI and containing a fragment of the gene encoding mRNAMja controlled by promoter T7 RNA polymerase were used as templates. The plasmid carrying the fragment of 23S rRNA from T. thermophilus that specifically bound with ribosomal protein L4 was presented to us earlier by Dr. U. Stelzl (Germany). The RNA transcripts were analyzed and purified by electrophoresis in 10% polyacrylamide gel in the presence of 8 M urea as described in the work by Tischenko et al. [14]. Analysis of inhibition of synthesis of protein MjaL3 in the coupled in vitro transcription–translation system. For experiments, an RTS 100 E. coli HY Kit (Roche, Germany) was used. Plasmids that carried the 5′UTR and gene rpl3 under the control of the T7 promoter were used as templates, and a plasmid that carried the gene of ribosomal protein L10 from M. jannaschii (MjaL10) was used as a negative control. To inhibit MjaL3 synthesis from the plasmid, into the reaction mixture MjaL4 or MjaL4Δloop were added in the amount of 040 μM or the same amount of protein MjaL10. For experiments with competition, the mixture was additionally supplemented with a fragment of 23S rRNA from T. thermophilus spe cific for ribosomal protein L4 or with a fragment of 23S rRNA specifically binding with protein L10, in the amount of 080 μM. For reaction termination, the mix ture was supplemented with 10 volumes of cooled ace tone, incubated for 30 min at –20°C, and then cen trifuged at 13,000 rpm for 10 min at 4°C. The precipitate was dried, dissolved in 20 μl of buffer for samples for SDSPAGE in the presence of urea, and placed onto polyacrylamide gel. Preparation of RNA–protein complexes. A solution of the RNA fragment was heated at 60°C for 10 min, cooled on ice, and supplemented with a solution of the protein dialyzed against buffer (50 mM TrisHCl, pH 7.5, 500 mM NaCl, 2 mM MgCl2) at RNA/protein molar ratio of 1 : 1. The resulting solution was incubated at room temperature for 20 min. Analysis of changes in mobility of RNA–protein com plexes in gel (gelshift). Analysis of changes in mobility in gel is based on the difference between the mobilities of RNA and RNA–protein complexes in polyacrylamide gel under native conditions [15]. Electrophoresis of RNA and RNA–protein complexes was conducted in 10% polyacrylamide gel using 90 mM TrisAc (pH 7.8) and 1 mM MgCl2 as the electrode buffer. Analysis of RNA–protein complexes by binding on nitrocellulose filters. In these experiments, traces of radiolabeled RNA were mixed with different concentra tions of the protein, and then the mixture was filtered through a nitrocellulose filter. To determine the dissociation constant of the com plexes (Kd), TMKCl buffer containing 50 mM TrisHCl
(pH 7.6), 20 mM MgCl2, 350 mM KCl, 1 mM βME, and 0.04% BSA was used. The protein and RNA were incu bated in TMKCl buffer separately for 5 min at 65°C and for 45 min at 37°C, respectively. In a total volume of 50 μl, a fixed amount of labeled RNA (12,00015,000 cpm) was mixed with an increasing quantity of the protein (1 nM 3 μM) and incubated for 15 min at 37°C and then for 15 min at 0°C. The RNA–protein complexes were adsorbed onto the nitrocellulose membranes (Protran BA83; Schleicher and Schuell, Germany) by filtration. The filters were washed with 350 μl of TMKCl buffer. Each binding curve was constructed from at least three experiments using nonlinear regression with the Qtiplot 0.9.7.8 program. −mRNA complexes by Determination of Kd of MjaL4− thermophoresis. This relatively new method is based on fixation of changes in the fluorescence of molecules under microscopic temperature gradients that are created with an infrared laser (IRlaser). Any change in the ther mophoretic features on addition of a partner molecule manifests itself as a change in fluorescence (F). The nor malized fluorescence Fnorm = Fhot/Fcold is determined, quantitative parameters of binding partner molecules can be obtained by a dilution series of one of the molecules, the Fnorm dependence on the concentration logarithm is constructed, and the complex Kd is determined from this plot. The experiments were performed using a Monolioth NT.115 device (NanoTemper, Germany). As the fluores cent molecule, the mRNAMja(–27 +7) fragment was used that was labeled with SYBR Gold dye (Invitrogen, USA). The mRNA fragment was mixed with the dye in the ratio 50 : 1 (v/v). On formation of the complexes, the concen tration of mRNA in the incubation mixture was 100 μM, and the quantity of the added protein was varied from 32 nM to 200 μM in different capillaries. The reaction was performed in hydrophilic capillar ies in 50 mM TrisHCl (pH 7.5) buffer supplemented with 300 mM NaCl and 0.1% Tween 20. The initial tem perature of incubation of MjaL4 with mRNA was 25°C, and on switching on the IRlaser the temperature inside the capillary reached 55°C.
RESULTS AND DISCUSSION Study of regulatory functions of MjaL4 and Δloop in E. coli in vitro coupled transcription– MjaL4Δ translation system. We studied the regulatory functions of the archaeal ribosomal protein MjaL4 and its mutant MjaL4Δloop lacking the 45a.a. loop. Both MjaL4 and MjaL4Δloop were found to be capable of regulating synthesis of protein MjaL3 encoded by the first gene of the S10like operon of M. jannaschii in the in vitro system of E. coli coupled transcription–trans lation. The same system was used earlier for testing regu latory functions of another archaeal ribosomal protein, BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
REGULATORY FUNCTION OF ARCHAEAL RIBOSOMAL PROTEIN L4
a 1
2
b
3
4
5
1
2
3
c 4
5
1
2
3
73
d 4
5
1
2
3
e 4
5
1
2
3
Fig. 1. Autoradiographs of protein MjaL3 synthesized in the presence of L[35S]methionine and different quantities of MjaL4 (ad): 1) 0 μM; 2) 5 μM; 3) 10 μM; 4) 20 μM; 5) 40 μM. As templates in the coupled transcription–translation system, constructions were used that carried gene rpl3 and the 5′UTR with length of 203 nt (a), 150 nt (b), 50 nt (c), and 25 nt (d). Autoradiograph of protein MjaL3 synthesized in the presence of L[35S]methionine and different quantities of MjaL4Δloop (e): 1) 0 μM; 2) 10 μM; 3) 40 μM; the construct that carried 5′UTR (25 nt) and rpl3 was used as the template.
a 1
2
3
b 4
5
1
2
3
c 4
5
1
2
3
Fig. 2. Autoradiographs of proteins MjaL3 (b, c) and MjaL10 (a) synthesized in the presence of L[35S]methionine and different amounts of MjaL4 (a), MjaL10 (b), or TmaL4 (c). a, b: 1) 0 μM; 2) 5 μM; 3) 10 μM; 4) 20 μM; 5) 40 μM. c: 1) 0 μM; 2) 40 μM MjaL4; 3) 40 μM TmaL4.
L1 [16, 17]. In our experiments templates were used that carried the rpl3 and 5′UTR with length of 20325 nt. On addition into the mixture of increasing amounts of MjaL4 or MjaL4Δloop, the synthesis of protein MjaL3 was inhibited (Fig. 1). It was shown that even at 5′UTR length of 25 nt, the inhibition of MjaL3 expression was retained (Fig. 1d). At the distance of 12 nt from the start codon, there is the Shine–Dalgarno sequence that is necessary for binding mRNA with the ribosome in both archaea and bacteria [18]; therefore, we could not use the genetic construct containing the rpl3 gene without the 5′UTR. To test the specificity of the interaction of MjaL4 pro tein with mRNA, control experiments were performed. As a negative control, a plasmid carried the gene encoding the ribosomal protein MjaL10 was used that (Fig. 2a). It was found that MjaL4 did not inhibit expression of the gene encoding a protein of another operon. To control the interaction specificity in experiments, ribosomal protein MjaL10 was used instead of protein MjaL4. The synthesis of MjaL3 was found to be virtually unchanged on addition of MjaL10 into the reaction mixture (Fig. 2b). Moreover, it was also found that the bacterial riboso mal protein L4 from Thermotoga maritima (TmaL4) also inhibited MjaL3 synthesis in the coupled system of trans lation–transcription (Fig. 2c). Because the affinity of the ribosomal regulatory pro tein L4 for mRNA is known to be weaker than for rRNA [10], we studied the competitive inhibition of MjaL3 syn BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
thesis. We found that in the presence in the incubation mixture of a 23S rRNA fragment carrying the specific binding site for protein L4, the synthesis of MjaL3 was not inhibited by proteins MjaL4 and MjaL4Δloop. And an addition into the incubation mixture of the 23S rRNA fragment specifically binding with protein L10 did not influence the inhibition of MjaL3 (Fig. 3). Thus, we have shown that protein MjaL4 can regu late MjaL3 synthesis by the principle of competition between sites of specific binding on rRNA and mRNA. Deletion analysis of MjaL3 mRNA and determination of dissociation constants of MjaL4–mRNA complexes. To more accurately determine the binding site of MjaL4 pro tein on mRNAMja, deletion analysis was performed and the affinity of shortened mRNA fragments for protein MjaL4 was determined. Fragments of mRNA containing regions of the 5′UTR and the sense part of MjaL3 mRNA with different length were obtained, and their affinities for protein MjaL4 (MjaL4Δloop) were studied by filter binding assay, gelshift assay, and thermophore sis. By the filter binding assay, we obtained the Kd of MjaL4 complexes with elongated fragments of mRNA and also with specific and nonspecific fragments of 23S rRNA (Table 2). The affinity of MjaL4 for mRNA frag ments was found to be approximately the same as the affinity of the E. coli protein L4 (EcoL4) for the specific fragment of E. coli mRNA [10]. For the 197nt specific fragment of mRNA from E. coli containing regulatory
74
MIKHAYLINA et al.
a 1
2
b
3
4
5
1
2
3
4
5
Fig. 3. Autoradiographs of protein MjaL3 synthesized in the presence of L[35S]methionine and excess of MjaL4 (a) or MjaL4Δloop (b). Moreover, the incubation mixture was supplemented with fragments of 23S rRNA specifically binding with protein L4 (rRNAL4) (3, 4) and a specific fragment of 23S rRNA binding with protein L10 (rRNAL10) (5). 1) 0 μM L4; 2) 40 μM L4; 3) 40 μM L4 + 40 μM rRNAL4; 4) 40 μM L4 + 80 μM rRNAL4; 5) 40 μM L4 + 80 μM rRNAL10.
a 1
2
b 3
1
2
c 3
1
2
L4mRNAMja
mRNAMja (+90) mRNAMja (–10 +40)
mRNAMja (–100)
Fig. 4. Electrophoresis of L4–RNA complexes under nondenaturing conditions. 1) RNA fragment; 2) MjaL4–RNA fragment; 3) MjaL4Δloop–RNA fragment. Analysis of formation of complexes of proteins MjaL4 and MjaL4Δloop: a) with mRNAMja (–10 +40) fragment; b) with mRNAMja (–100) fragment; c) with mRNAMja (+90) fragment.
Table 2. Dissociation constants of L4–RNA complexes obtained by the method of binding on filters Complex
Kd, nM
MjaL4/mRNAMja (–203 +100)
400 ± 15
MjaL4/mRNAMja (–150 +70)
600 ± 21
MjaL4/rRNATthL4
50 ± 3
MjaL4/rRNAMjaL10
8000 ± 287
EcoL4/rRNAEco (53 nt)*
230
EcoL4/mRNAEco (197 nt)*
800
Note: The number of 5′UTR nucleotides is shown with sign “−”, the number of nucleotides in the sense part of mRNA is shown with sign “+”. * Data from the work of Stelzl et al. [10].
Table 3. Affinity of MjaL4 for mRNAMja fragments of dif ferent length mRNAMja
Presence (+) or absence (−) of complex
Kd, nM
mRNAMja (–203 +100)
+
400 ± 15
mRNAMja (–150 +70)
+
600 ± 21
mRNAMja (–27 +7)
+
451 ± 17
mRNAMja (–100)
+
*
mRNAMja (+90)
–
mRNAMja (–10 +40)
–
* Kd of the complex was not determined.
BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
REGULATORY FUNCTION OF ARCHAEAL RIBOSOMAL PROTEIN L4
a
75
b 650
MjaL4–mRNA Kd = 451 ± 17 nM
550
450
350
Fnorm[1/1000]
101
102
103
104
105
106
MjaL4Δloop–mRNA
650
Kd = 1230 ± 34 nM 550
450
350 101
102
103
104
105
106
Concentration, nM
Fig. 5. a) Supposed secondary structure of mRNAMja (–27 +7) fragment predicted with the RNAfold WebServer (http://rna.tbi.univie.ac.at/cgibin/RNAfold); b) thermophoresis of binding of proteins MjaL4 and MjaL4Δloop with the specific mRNAMja (–27 +7) fragment.
regions for EcoL4, the Kd value determined by binding on filters is 800 nM [10], whereas for complexes MjaL4/mRNAMja it is Kd = 400600 nM. The nonspecif ic binding of MjaL4 was more than one order of magni tude weaker than the specific binding. The purpose of our further work was to determine the minimal fragment of mRNA specifically binding with pro tein MjaL4. By the gelshift assay, the mRNAMja (+90) fragment lacking the leader sequence was shown to be unable to form stable complexes with protein MjaL4, whereas the mRNAMja (–100) fragment containing 100nt 5′UTR formed a complex (Fig. 4, b and c). These find ings suggested that determinants for binding MjaL4 are located in the 5′UTR of mRNA. The mRNA (–10 +40) fragment containing a 5′UTR region shortened to 10 nt BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
did not interact with protein MjaL4 (Fig. 4a), which sug gested that the binding site should be located in the region between the 25th and 10th nucleotides from the start codon. A fragment was obtained that contained 27 nt of the 5′UTR and 7 nt of the sense part of mRNAMja. Three nucleotides were added from the 5′ and 3′ends to create the restriction site for SmaI. Thus, the length of the frag ment was 40 nt (Fig. 5a). Dissociation constants of this mRNA fragment with mRNA with MjaL4 or MjaL4Δloop were determined by thermophoresis. The affinity of MjaL4 for this short frag ment of mRNA was virtually the same as for long frag ments of mRNA (Table 3), and the absence of the elon gated loop decreased the affinity by threefold (Fig. 5b). The regulatory properties of the mutant form of bacterial
76
MIKHAYLINA et al.
ribosomal protein L4 from Thermus aquaticus lacking the corresponding loop are known to be threefold decreased [19]. It seems that the role of this loop in the stabilization of the L4–RNA complex is not high and is the same for both the bacterial and archaeal L4 proteins. The resulting minimal specific fragment of mRNA with length of 40 nt can be used in experiments for crys tallization of the regulatory archaeal complex. This work was supported by the Russian Academy of Sciences, the program “Molecular and Cellular Biology” of the Russian Academy of Sciences Presidium, and by the Russian Foundation for Basic Research (project No. 120431121 mol_a). The work of A. O. Mikhaylina was supported by grants of FEBS (Summer Fellowship) and EMBO (ASTF No. 2532011).
REFERENCES 1. 2. 3. 4.
5.
Nomura, M., Yates, J. L., Dean, D., and Post, L. E. (1980) Proc. Natl. Acad. Sci. USA, 77, 70847088. Zengel, J. M., and Lindahl, L. (1994) Prog. Nucleic Acids Res. Mol. Biol., 47, 331370. Zengel, J. M., and Lindahl, L. (1990) J. Mol. Biol., 213, 6778. Schuwirth, B. S., Borovinskaya, M. A., Hau, C. W., Zhang, W., VilaSanjurjo, A., Holton, J. M., and Cate, J. H. (2005) Science, 310, 827834. Tumminia, S. J., Hellmann, W., Wall, J. S., and Boublik, M. (1994) J. Mol. Biol., 235, 12391250.
6. Ban, N., Nissen, P., Hansen, J., Capel, M., Moore, P. B., and Steitz, T. A. (1999) Nature, 400, 841847. 7. Timsit, Y., Acosta, Z., Allemand, F., Chiaruttini, C., and Springer, M. (2009) Int. J. Mol. Sci., 10, 817834. 8. Zengel, J. M., Jerauld, A., Walke, A., Markus, R., Wahl, C., and Lindahl, L. (2003) RNA, 9, 11881197. 9. Shen, P., Zengel, J. M., and Lindahl, L. (1988) Nucleic Acids Res., 16, 89058924. 10. Stelzl, U., Zengel, J. M., Tovbina, M., Walker, M., Nierhaus, K. H., Lindahl, L., and Patel, D. J. (2003) J. Biol. Chem., 278, 2823728245. 11. Stelzl, U., and Nierhaus, K. H. (2001) RNA, 7, 598609. 12. Allen, T., Shen, P., Samsel, L., Liu, R., Lindahl, L., and Zengel, J. M. (1999) J. Bacteriol., 181, 61246132. 13. Studier, F., Rosenberg, A., Dunn, J., and Dubendorff, J. (1990) J. Methods Enzymol., 185, 6089. 14. Tishchenko, S., Gabdulkhakov, A., Nevskaya, N., Sarskikh, A., Kostareva, O., Nikonova, E., Sycheva, A., Moshkovskii, S., Garber, M., and Nikonov, S. (2012) Acta Crystallogr. D, 68, 10511057. 15. Draper, D. E., Deckman, I. C., and Vartikar, J. V. (1988) Methods Enzymol., 164, 203220. 16. Mayer, C., Kohrer, C., Grobner, P., and Piendl, W. (1998) Mol. Microbiol., 27, 455468. 17. Kraft, A., Lutz, C., Lingenhel, A., Grobner, P., and Piendl, W. (1999) Genetics, 152, 13631372. 18. Amils, R., Cammarano, P., and Londei, P. (1993) in The Biochemistry of Archaea (Archaebacteria) (Kates, M., Kushner, D. J., and Matheson, A. T., eds.) Elsevier Biomedical Press, Amsterdam, pp. 393438. 19. Zengel, J. M., Mueckl, D., and Lindahl, L. (1980) Cell, 21, 523535.
BIOCHEMISTRY (Moscow) Vol. 79 No. 1 2014
