LFS-14029; No of Pages 8 Life Sciences xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Life Sciences journal homepage: www.elsevier.com/locate/lifescie

Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy Dhanarajan Rajakumar a,⁎, Senthilnathan Senguttuvan c, Mathew Alexander b, Anna Oommen a a b c

Section of Neurochemistry, Department of Neurological Sciences, Christian Medical College, Vellore, Tamil Nadu, India Section of Neurology, Department of Neurological Sciences, Christian Medical College, Vellore, Tamil Nadu, India Center for Stem Cell Research, Christian Medical College, Vellore, Tamil Nadu, India

a r t i c l e

i n f o

Article history: Received 26 November 2013 Accepted 9 May 2014 Available online xxxx Keywords: Muscle wasting Oxidative stress NF-κBp65 E3 ligase Ubiquitin

a b s t r a c t Aims: Dysferlinopathies are autosomal recessive neuromuscular disorders arising from mutations of the protein dysferlin that preferentially affect the limbs which waste and weaken. The pathomechanisms of the diseases are not known and effective treatment is not available. Although free radicals and upstream signaling by the redox sensitive transcription factor, NF-κB, in activation of the ubiquitin pathway are shown to occur in several muscle wasting disorders, their involvement in dysferlinopathy is not known. This study analyzed the role of oxidative stress, NF-κB and the ubiquitin pathway in dysferlinopathic muscle and in dysferlin knockdown human myoblasts and myotubes. Main methods: Fourteen dysferlinopathic muscle biopsies and 8 healthy control muscle biopsies were analyzed for oxidative stress, NF-κB activation and protein ubiquitinylation and human primary myoblasts and myotubes knocked down for dysferlin were studied for their state of oxidative stress. Key findings: Dysferlinopathic muscle biopsies showed NF-κB p65 signaling induced protein ubiquitinylation in response to oxidative stress. Dysferlin knock down primary muscle cell cultures confirmed that oxidative stress is induced in the absence of dysferlin in muscle. Significance: Anti-oxidants that also inhibit nitrosative stress and NF-κB activation, might prove to be of therapeutic benefit in slowing the progression of muscle wasting that occurs with dysferlinopathy. © 2014 Elsevier Inc. All rights reserved.

Introduction Dysferlin is a 237 kDa transmembrane protein, expressed predominantly in muscle and involved in membrane repair (Bushby, 2000). Hereditary or de novo mutations of dysferlin cause the neuromuscular disorder, dysferlinopathy. Dysferlinopathies include Limb girdle muscular dystrophy 2B, (LGMD 2B) that affects proximal and distal limb muscles, Miyoshi myopathy (OMIM # 254130) that causes a preferential loss of gastrocnemius muscle, and DMAT (distal myopathy with anterior tibial involvement) (OMIM # 606678) (Amato and Brown, 2011; Bushby, 2000; Nguyen et al., 2005). The pathomechanisms that lead to progressive muscle wasting and weakness of dysferlinopathy remain elusive. Muscle atrophy or wasting is common to various conditions. Sarcopenia is wasting associated with ageing, cachexia is a muscle Abbreviations: DMD, Duchenne muscular dystrophy; DTNB, 5,5'-dithiobis(2-nitrobenzoic acid); GSH, Reduced glutathione; IKK β, Inhibitory kappa B Kinase Beta; LGMD, Limb girdle muscular dystrophy; MAFbx/Atrogin 1, Muscle atrophy F-box protein; MuRF 1, Muscle specific RING finger protein; NF-κB, Nuclear factor kappa-light-chainenhancer of activated B cell; ROS, Reactive oxygen species. ⁎ Corresponding author at: Neurochemistry Laboratory, Department of Neurological Sciences, Christian Medical College, Vellore 632 004, India. Tel.: + 91 228 2701; fax: +91 416 2232035. E-mail address: [email protected] (D. Rajakumar).

wasting syndrome associated with cancer, sepsis, HIV, congestive heart failure, renal disorders, muscular dystrophies. Muscle loss also occurs during disuse of muscle, e.g., prolonged bed rest, space travel (Franch and Price, 2005; Hasselgren and Fischer, 2001; Lexell, 1995; Tisdale, 2007a). As reviewed by Tisdale (2007), muscle wasting of various cachectic conditions is associated with the activation of the ubiquitin proteasomal pathway while inhibition of the pathway reduces skeletal muscle wasting in animal models of muscle wasting. The transcription factor NF-κB is a primary activator of the ubiquitin pathway and of muscle specific E3 ligases of the ubiquitin pathway (Eddins et al., 2011; Foletta et al., 2011; Murton et al., 2008; Wyke and Tisdale, 2005). In mice activation of the IKKβ/NF-κB pathway induces skeletal muscle atrophy through activation of the ubiquitin pathway. Inhibition of NF-κB reduces muscle degeneration and improves muscle function in mdx mice, a model of Duchenne muscular dystrophy (DMD) (Acharyya et al., 2007; Cai et al., 2004; Karin, 2006; Mourkioti et al., 2006; Tang et al., 2010). Thaloor et al. (1999), demonstrated that systemic administration of the NF-κB inhibitor, curcumin, stimulates muscle regeneration after traumatic injury in mice. NF-κB p65 is shown to reduce MyoD levels and interfere in muscle regeneration in myoblasts. In muscle damage, IKKβ depletion facilitates skeletal muscle regeneration by enhancing satellite cell activation and reducing fibrosis in mice (Mourkioti et al., 2006).

http://dx.doi.org/10.1016/j.lfs.2014.05.005 0024-3205/© 2014 Elsevier Inc. All rights reserved.

Please cite this article as: Rajakumar D, et al, Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy, Life Sci (2014), http://dx.doi.org/10.1016/j.lfs.2014.05.005

2

D. Rajakumar et al. / Life Sciences xxx (2014) xxx–xxx

Free radicals have been implicated as primary and secondary causes of several muscle wasting diseases (Buck and Chojkier, 1996; Rando, 2002; Sukhanov et al., 2011; Tidball and Wehling-Henricks, 2007; Tisdale, 2007). The role of reactive oxygen and nitrogen species is well documented in wasting of Duchenne muscular dystrophy, Fascioscapular muscular dystrophy, cancer, ageing, disuse induced atrophy and sepsis (Buck and Chojkier, 1996; Cui et al., 2012; Lawler, 2011; Li et al., 2011; Macaione et al., 2007; Menazza et al., 2010; Messina et al., 2006, 2011; Min et al., 2011; Ragusa et al., 1997; Rando, 2001, 2002; Sukhanov et al., 2011; Terrill et al., 2013; Whitehead et al., 2010; Yucel et al., 1998). The transcription factor NF-κB being redox sensitive could be activated by oxidative stress. Messina et al. (2006), showed that inhibition of lipid peroxidation prevented muscle wasting and improved muscle function in mdx mice. They also showed activation of NFκB in response to oxidative stress in mdx mice. Based on existing literature on muscle wasting of various conditions including several forms of muscular dystrophies, we hypothesized that absence of dysferlin might induce oxidative stress. In response to oxidant stress, NF-κB might mediate protein degradation through the ubiquitin proteasomal system. To verify the hypothesis 14 dysferlinopathic muscle biopsies and 8 healthy control muscle biopsies were analyzed for oxidative stress, NF-κB activation and protein ubiquitinylation and human primary myoblasts and myotubes knocked down for dysferlin were studied for their state of oxidative stress. The results validated the hypothesis that the absence of dysferlin leads to oxidative stress. Methods Muscle biopsies Fourteen muscle biopsies from patients aged between 9 and 35 years, confirmed for LGMD 2B and Miyoshi myopathy by clinical findings (including asymmetric calf atrophy, atrophy of hamstrings, difficulties in making a fist due to finger flexors atrophy and calf head sign, creatine kinase increase of 50–100 fold) and Western blots negative or reduced for dysferlin by more than 20% compared to healthy controls were included in the study (Cacciottolo et al., 2011; Rajakumar et al., 2011; Rajakumar et al., 2013; Renjini et al., 2012). Average normalized intensity of dysferlin band (237 kDa) of 8 healthy control biopsies was considered as 100%. Control muscles were obtained from patients undergoing orthopedic corrections of lower limb. All other muscle biopsies were obtained for routine diagnostics in the laboratory and stored at − 70 °C until analysis. The study was approved by the Institutional Review Board and Human Ethics Committee of Christian Medical College, Vellore (EC Min No IRB (EC) 4/9/2007) and all muscle samples were obtained with informed consent. Lipid peroxidation Lipid peroxidation was assayed by estimation of malondialdehyde (MDA), formed by the thiobarbituric acid reaction (TBARS reaction), in muscle homogenized in 10 vol of 1.15% KCl (Ohkawa et al., 1979). A reaction mixture of 100 μl muscle homogenate, 1.5 ml acetic acid (20% pH 3.5), 200 μl SDS (8%), 1.5 ml thiobarbituric acid (0.8%) and 700 μl of water, was heated for 1 h at 95 °C. Samples were cooled to 25 °C, spun at 12,000 g for 10 min and MDA levels in the supernatant read at 535 nm. Lipid peroxidation was expressed as nmol MDA/gm tissue using tetra methoxy propane as standard. Reduced glutathione (GSH) GSH was estimated in the protein free supernatant of muscle homogenized in 10 vol of 5% trichloroacetic acid (TCA) containing 5 mM EDTA and spun at 13,000 g for 20 min at 4 °C. A reaction mixture of 200 μl protein free supernatant, 800 μl 0.4 M Tris HCl pH 8.9 and 40 μl 10 mM 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB) in 100% methanol was

incubated in the dark for 5 min and colour developed read at 412 nm. GSH was expressed as nmol/gm tissue calculated from the molar extinction coefficient of 5-thio-2-nitrobenzoic acid of 13,600 /M/cm at 412 nm (Messina et al., 2006). Protein thiols Protein thiols were estimated in muscles homogenized in 10 vol of phosphate buffered saline (PBS) and spun at 1000 g for 10 min at 4 °C. Fifty microlitres of the supernatant was precipitated with 1 ml of 10% TCA and spun at 5000 g for 10 min. To the pellet 1 ml of 0.1 M Tris HCl pH 7.4, 2 ml of 0.2 M Tris HCl pH 8.6 and 30 μl 10 mM DTNB were added and the reaction incubated for 15 min in the dark at 25 °C. Color development was read at 412 nm. Protein thiols were expressed as nmol 5-thio-2-nitrobenzoic acid/mg non-collagen protein calculated from the molar extinction coefficient of 5-thio-2-nitrobenzoic acid of 13,600 /M/cm at 412 nm (Yucel et al., 1998). Muscle nitrite Nitric oxide (NO) was estimated in muscle from levels of nitrate, the stable end product of NO, reduced to nitrite and assayed by the Greiss reaction. Muscles were homogenized in 10 vol of PBS and spun at 5000 g for 10 min. To 50 μl supernatant, 150 mg of copper/cadmium alloy was added and incubated at 25 °C for 1 h with thorough shaking. The reaction was stopped by addition of 100 μl 0.35 N sodium hydroxide and 400 μl 120 mM zinc sulphate and spun at 2000 g for 10 min. To 500 μl supernatant 250 μl 1% sulfanilamide in 3 N HCl and 250 μl of 0.1% napthylethylene diamine were added and color development read at 545 nm (Sastry et al., 2002). Units were expressed as nmoles nitrite/mg non-collagen protein read against a NaNO2 standard. Non-Collagen protein estimation Protein was estimated as non-collagen protein, subsequent to alkaline hydrolysis of muscle, to exclude misinterpretation of fibrous proteins as muscle proteins. A known wet weight of muscle was hydrolyzed with 19 vol 0.1 N NaOH for 16 h at 25 °C, centrifuged at 5000 g for 15 min and the supernatant neutralized with 0.1 N HCl. NCP in the supernatant was estimated by the method of Lowry et al. (1951), using crystalline bovine serum albumin fraction V as standard (Rajakumar et al., 2011). Western blots for dysferlin, NF-κB/IKK β and Ubiquitin/E3 ligases Muscles were homogenized in 19 vol 0.125 M Tris/Hcl pH 7.6 containing 10% glycerol, 10% SDS, 4 M urea, 0.1 M EDTA, 10% β-mercaptoethanol and 0.05% bromophenol blue and 20 μg NCP protein subject to reducing SDS-PAGE (3.5%–12% gels). Non-collagen proteins (100 μg) were electrotransferred to polyvinylidene fluoride membranes for 1 h (80 V/4 °C) following SDS-PAGE (3.5%–12%) and separate blots probed with antibodies to dysferlin (1:100 dilution), antibodies to NF-κB p65, MuRF 1 and MAFbx, ubiquitin, IKK β, nitrotyrosine, nitrocysteine (1:2000 dilution) and loading control glyceraldehyde phosphate dehydrogenase (GAPDH) (1:20,000 dilution), secondary antibody conjugated with Biotin and developed with streptavidin peroxidase, H2O2 and diaminobenzidine hydrochloride. Densitometric image analysis of blots was performed with software developed in-house that correlated with Bio-Rad Quantity One Quantitation software version 4 (r = 0.8). Antibodies Goat anti-dysferlin, (Santcruz, Biotechnologies, USA), rabbit antiNF-κB p65, MURF 1 and MAFbx were from Abcam, USA, mouse antiubiquitin, rabbit anti-IKK β, nitrotyrosine, nitrocysteine and mouse

Please cite this article as: Rajakumar D, et al, Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy, Life Sci (2014), http://dx.doi.org/10.1016/j.lfs.2014.05.005

D. Rajakumar et al. / Life Sciences xxx (2014) xxx–xxx

3

anti-GAPDH antibodies were from Sigma Aldrich, Bangalore, India. Biotin conjugated secondary antibodies and streptavidin peroxidase were from Bangalore Genei, Bangalore, India.

using a Leica DMI 6000 B inverted fluorescence research microscope (Ou et al., 2010).

Coomassie Blue staining of post transferred gels for dysferlin western blots

Myoblasts differentiation

Post transferred gels of dysferlin Western blots were stained with 0.01% Coomassie Brilliant Blue-R 250 in methanol:glacial acetic acid: water {50/40/10 (v/v/v)} for 1 h and destained with methanol:glacial acetic acid:water {50/40/10 (v/v/v)} for 15 min. Myosin heavy chain in the post transferred gel served as the loading control for each muscle sample. Gels and blots were image analyzed as described for Western blots. Corresponding post transferred gel intensities of each muscle sample were used for normalization of dysferlin western blots.

Primary myoblasts cultures were grown on glass bottom petri dishes at sub-confluent density. To induce fusion (differentiation) myoblasts were kept in low serum (2% horse serum medium) DMEM medium (Mancini et al., 2011). Differentiated myoblasts (myotubes) were used for the studies on myotubes.

Immunofluorescence analysis of NF-κB p65 localization Five micron paraffin sections of muscle were dewaxed at 52 °C for 4 h and washed with xylene and alcohol. Slides were trypsinized for 30 min at 28 °C, blocked with 3% BSA for 30 min at 28 °C and incubated with rabbit anti-NFκB p65 antibody (1:100 dilution) for 60 min followed by anti-rabbit IgG tagged Alexa 488 antibody (1:5000 dilution) (Invitrogen, USA) for 30 min. Sections were counter stained with DAPI for 5 min. Slides were washed with PBS containing 0.2% Triton X-100 (PBST) between each step. Images were captured using a Leica DMI 6000 B inverted fluorescence research microscope.

siRNA transfections of myoblasts Transfections using Escort transfection reagent (Sigma Aldrich, USA) were performed following the manufacturer's instructions. Primary myoblasts (8 × 104 /well) were seeded in a 24 well plate and cultured. Cells on reaching around 40% confluence were transfected with 60 nM mission predesigned siRNA for dysferlin in two parts of Escort transfection liposomes for 24 h. During the first 6 h of siRNA transfection, cultures were in opti-MEM reduced serum transfection media (Invitrogen, USA). Cells silenced with dysferlin siRNA, scrambled siRNA (Universal negative control) and normal controls were analyzed for the expression of dysferlin by RT-PCR and Western blots.

RT-PCR for dysferlin and actin of myoblasts and myotubes Reverse Transcription-Polymerase Chain Reaction for NF-κB p65 Total muscle RNA was extracted using Trizol reagent (Sigma Aldrich, USA). The quality of RNA was assessed by MOPS electrophoresis. Muscle total RNA (1 μg) was reverse transcribed with random hexamers and Moloney murine leukemia virus (Mo-MuLV) reverse transcriptase (RT). 2 μl cDNAs were amplified by polymerase chain reaction (PCR) using the following specific primers: NF-κB, sense5'TCTGCTTCCAGGTGACAGTG3' and antisense-5' GAAGATCTCATCCCCA CCAA 3', β Actin, sense-5' TCCCTGGAGAAGAGCTACG 3' and antisense5' TAGTTTCGTGGATGCCACA 3'. PCR reaction conditions were as follows: initial denaturation at 95 °C for 4 min, denaturation at 95 °C for 30 s, annealing at 61 °C for 45 s for NF-κB and 61 °C for 45 s for actin, extension at 72 °C for 1 min. Final extension was at 72 °C for 5 min. Amplified products were resolved on 2% agarose gel electrophoresis, stained with ethidium bromide and images captured using a GelStan Image analyser and analyzed using imaging software described for Western blots.

RT-PCR for dysferlin and actin of the myoblasts and myotubes were performed as described above. Dysferlin primer: Left primer: gccccagtgggatcaccatg and Right pirmer: atgctggaggggaccccacgg; product size: 216 bp.

Western blots of myoblasts for dysferlin and 4-hydroxynoneal Primary myoblasts were washed with PBS, lysed with 500 μl 0.125 M Tris HCl pH 8.8/well and 10 μl of the lysate subjected to SDS-PAGE (3.5%–12% gel) and western blots as described above. Post transferred gels of dysferlin Western blots were stained with 0.01% Coomassie Brilliant Blue-R 250 in methanol:glacial acetic acid:water {50/40/10 (v/v/v)} for 1 h and destained with methanol:glacial acetic acid:water {50/40/10 (v/v/v)} for 15 min.

Live cell imaging of mitochondrial superoxide generation Experiments on cell culture Culture of human primary skeletal myoblasts Primary myoblast cultures were as described by the standard optimized protocol (SOP) of the Euro Bio bank. Ham's F10 medium was used instead of DMEM medium mentioned in the SOP since Ham's medium favors myoblast growth over fibroblasts (Ou et al., 2010). Myoblast characterization–Desmin Immunofluoresence Primary cell cultures were grown on glass bottom petri dishes (diameter: 35 mm dish and 20 mm glass) to about 50% confluence. Cells were permeabilized with 100% cold methanol for 20 min, blocked with 3% BSA in PBST for 30 min followed by incubation with 1:100 dilution of mouse anti-human desmin IgG at 4 °C for 12 h and incubation with 1:1000 anti-mouse IgG conjugated Alexa 488 antibody for 1 h at 25 °C. Cells were counter stained with DAPI for 5 min. Cells were washed with PBST thrice between each step. Images were captured

To measure mitochondrial ROS, the fluorescent probe MitoSOX Red was used. Briefly, 3 groups of human primary myoblasts were studied: control (untreated cells), myoblasts knocked down for dysferlin (60 nM) for 24 h and myoblasts treated with scrambled siRNA (30 nM). Cells were incubated with 5 μM MitoSOX Red for 10 min at 37 °C, followed by three washes with warm PBS. Images were captured using a Leica DMI 6000 B inverted fluorescence research microscope at A514nm excitation/560nm emission (Bulua et al., 2011; Mukhopadhyay et al., 2007) The images were quantified using Image J software.

Statistical analysis Data were expressed as mean ± SD of three independent experiments of a minimum of 6 samples. 'Student t test' and 'Mann Whitney U test' were used for analysis of parametric and non-parametric data respectively. Statistical analysis was done using SPSS version 16 software. p b 0.05 was considered statistically significant.

Please cite this article as: Rajakumar D, et al, Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy, Life Sci (2014), http://dx.doi.org/10.1016/j.lfs.2014.05.005

4

D. Rajakumar et al. / Life Sciences xxx (2014) xxx–xxx

a

Dysferlin 237 kDa

205

205 97 97

66 43 29 kDa

MW 1

66

Protein nitrotyrosinylation of 56kDa

43

protein(s) in dysferlinpathic muscle.

29

2 Loading control myosin heavy chain of

kDaMW

1

2

post transferred gel

GAPDH 37 kDa

Fig. 1. Western blots for dysferlin in human skeletal muscle biopsies. Muscle lysates, prepared from human skeletal muscle biopsies, were subjected to SDS-PAGE and western blots. Blots were probed with anti dysferlin antibodies followed by secondary antibody with IgG–biotin conjugate and developed with streptavidin peroxidase, H2O2 and diaminobenzidine hydrochloride. Post transferred gels were stained with Commassie Brilliant Blue R and the major muscle protein myosin heavy chain of each sample on the post transferred gel served as the loading control. Lanes: Mw—molecular weight markers, 1—Muscle with dysferlin at 237 kDa absent, 2—Muscle with dysferlin at 237 kDa present.

b Nitrotyrosine/GAPDH Mean + SD

1 0.8

* n=6

0.6 n=6

0.4

Results

0.2

Dysferlin western blot

0 Fig. 1 is a Western blot that shows dysferlin at 237 kDa in healthy control muscle and the absence of dysferlin in dysferlinopathic muscle. Oxidative stress and nitrosative stress in dysferlinopathic muscle The status of oxidative stress in dysferlinopathic muscle was determined by estimation of tissue lipid peroxidation, a common marker of oxidative stress. Lipid peroxidation was elevated 2.8 fold in dysferlinopathic muscle compared to fresh control muscle biopsies (p b 0.005) (Table 1). Muscle total protein thiols were increased 1.3 fold in dysferlinopathic muscle in comparison to healthy control muscle (Table 1). Reduced glutathione, an important anti oxidant in muscle, was elevated 1.9 fold, in dsyferlinopathic muscle in comparison to healthy control muscle (p b 0.004) (Table 1). Nitrosative stress in dysferlinopathic muscle was estimated from muscle nitrite levels and tyrosine and cysteine nitrosylation of muscle proteins. Muscle nitrite was increased 1.9 fold in dysferlinopathic muscle compared to control muscle (p b 0.04) (Table 1). Protein nitrotyrosinylation was increased 1.8 fold in dyferlinopathic muscle compared to healthy control muscle (p b 0.04) (Fig. 2a and b). There was no difference in protein nitro-cysteinylation between dysferlinopathic and healthy control muscle (Table 1). NF-κB signaling in dysferlinopathy muscle NF-κB signaling was analyzed by IKK β/ NF-κB signaling as their combination is shown in a number of muscle wasting conditions (Cai et al., 2004; Karin, 2006; Mourkioti et al., 2006).

1

2

Fig. 2. Western blots of protein nitrosylation in dysferlinopathic muscle. Muscle lysates, prepared from human skeletal muscle biopsies, were subjected to SDS-PAGE and western blots. a) Blots were probed with anti-nitrotyrosine antibodies and anti-GAPDH antibodies followed by secondary antibody with IgG–biotin conjugate and developed with streptavidin peroxidase, H2O2 and diaminobenzidine hydrochloride. GAPDH (Molecular weight 37 kDa) a house keeping protein in muscle served as loading control. Lanes: 1— Control muscle, 2—Dysferlinopathic muscle. b) Blots were image analyzed and intensities of protein nitrotyrosinylation bands normalized with corresponding GAPDH bands. Data shown are mean ± SD. *p b 0.04 compared to health control muscles.

NF-κB p65 protein and mRNA were increased 3.5 fold and 1.5 fold respectively in dysferlinopathic muscle compared to healthy control muscle (Fig. 3a & b). IKKβ protein levels were elevated in dysferlinoapathic muscle compared to normal control muscle where they were not detected (p b 0.01) (Fig. 3c). Immunofluorescence analysis of muscle sections showed localization of NF-κB p65 to the nucleus of dysferlinopathic muscle (Fig. 4). The Ubiquitin proteasomal pathway in dysferlinopathic muscle Non collagen protein was reduced 45% in dysferlinopathic muscle compared to healthy control biopsies (p b 0.0004) (Table 2). As shown in Fig. 5, there was a 1.7 fold increase in muscle protein ubiquitinylation in dysferlinopathic muscle compared to normal control muscle (p b 0.03). Muscle specific E3 Ubiquitin ligase MAFbx and MURF 1 protein levels were not increased in dysferlinopathic muscle compared to healthy controls (Table 2).

Table 1 Oxidative and nitrosative stress in dysferlinopathic muscle. Parameter

Lipid peroxidation Reduced glutathione Protein thiol Nitrite

Unit

nmoles MDA/g tissue μmoles/g tissue nmoles DTNB/mg protein nmoles/mg protein

Healthy control muscle

Dysferlinopathic muscle

Mean ± SD

Mean ± SD

119 ± 47 (n = 8) 419 ± 155 (n = 8) 22.0 ± 4.2 (n = 8) 8.4 ± 4.3 (n = 8)

333 ± 128 (n = 6) 800 ± 436 (n = 13); 29 ± 7.0 (n = 6); 15.6 ± 12.2 (n = 14);

p value a

p p p p

b b b b

0.004 0.004 0.03 0.04

P b 0.05 was considered statistically significant. a p value compared to healthy control muscle.

Please cite this article as: Rajakumar D, et al, Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy, Life Sci (2014), http://dx.doi.org/10.1016/j.lfs.2014.05.005

D. Rajakumar et al. / Life Sciences xxx (2014) xxx–xxx

a

NF-κB p65 56 kDa

1.4 * 1.2 1 0.8 0.6 n = 8 0.4 0.2 0 1 2

Mw

d NF-κBp65/Actin Mean + SD

NF-κBp65/ GAPDH Mean + SD

IKK β 85 kDa

e 1

2 GAPDH 37 kDa

b

NF-κB p65 164 bp

n=9

1

Actin 130bp

f

0.5 0.4

n=5

** n=5

0.3 0.2 0.1 0 1

2 GAPDH 37 kDa

2

IKKβ/GAPDH Mean + SD

1

c

5

1.4 1.2 1 0.8 0.6 0.4 0.2 0

*"

n=6 n=8 1

2

2

Fig. 3. Western blots and RT-PCR of NF-κB/IKK β pathway in dysferlinopathic muscle. Muscle lysates, prepared from human skeletal muscle biopsies, were subjected to SDS-PAGE and western blots. Blots were probed with a) anti NF-κB p65 and e) anti-IKK β antibodies and anti-GAPDH antibodies followed by secondary antibody with IgG–biotin conjugate and developed with streptavidin peroxidase, H2O2 and diaminobenzidine hydrochloride. GAPDH served as the loading control. b) and f) Blots were image analyzed and intensities of NF-κB p65 and IKK β bands normalized with corresponding GAPDH bands of 1—Control and 2—Dysferlinopathic muscle. Data shown are mean ± SD. NF-κB * p b 0.01 and IKK β *” p b 0.01 compared to healthy control muscle. c) Agarose gel electrophoresis of RT-PCR products of NF-κB p65 and Actin d) Image analysis of RT-PCR gels of NF-κB p65 normalized to Actin. Actin a stably expressed major muscle protein served as loading control for RT-PCR experiments. Mw—100 bp ladder, 1— Control muscle, 2—Dysferlinopathic muscle. Data shown are mean ± SD. ** p b 0.04 compared to healthy control muscle.

4-hydroxynonenal and mitochondrial superoxide generation in dysferlin knockdown primary muscle cells Myoblasts were characterized by presence of desmin visualized by immunofluorescence and knockdown efficiency of dysferlin was shown by RT-PCR and Western blots (Suppl. Figs. 1 and 2). Dysferlin knockdown induced oxidative stress in human primary myoblasts as shown by 2.6 fold increase in oxidative stress marker 4-hydroxynonenal compared to normal myoblasts (Fig. 6). Dysferlin knock down also increased free radical generation, specifically mitochondrial superoxide, two fold in human primary myoblasts and four fold in myotubes (Figs. 7 and 8).

Bright Field

DAPI

Discussion Free radical mediated muscle wasting is well documented in several pathologies including some forms of muscular dystrophy (Buck and Chojkier, 1996; Franch and Price, 2005; Hasselgren and Fischer, 2001; Ragusa et al., 1997; Rajakumar et al., 2013; Terrill et al., 2013; Tidball and Wehling-Henricks, 2007). In the current study we found lipid peroxidation, a commonly studied marker of oxidative damage to biomolecules and indicative of oxidative stress in several muscle wasting conditions, was associated with muscle wasting in dysferlinopathy (Messina et al., 2006; Rando et al., 1998; Wyke and Tisdale, 2005). Further the high levels of the tripeptide glutathione (reduced) (GSH), a non

Alexa (NF- κB p65)

Merge

Control muscle

Dysferlinopathic muscle

Negative control (No primary antibody)

Fig. 4. Immunofluoresence images for NF-κBp65 localization to the nucleus in dysferlinopathic muscle. Paraffin embedded sections of muscle were probed with anti NF-κB p65 antibodies (1:100 dilutions) and secondary antibodies tagged with Alexa 488. Sections were counter stained with DAPI for nucleus. Negative controls were probed only with Alexa 488. Images were taken at 63× magnification using a Leica DMI 6000 B inverted fluorescence research microscope. Scale bar = 10 μm.

Please cite this article as: Rajakumar D, et al, Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy, Life Sci (2014), http://dx.doi.org/10.1016/j.lfs.2014.05.005

6

D. Rajakumar et al. / Life Sciences xxx (2014) xxx–xxx

Table 2 Ubiquitin pathway in dysferlinopathic muscles. Parameter

Method/Unit

Non-collagen protein MAFbx/GAPDH MURF1/GAPDH a b

mg/g tissue Western Blot/Arbitrary Units Western Blot/Arbitrary Units

Healthy control muscle

Dysferlinopathic muscle

Mean ± SD

Mean ± SD

229 ± 54 (n = 8) 0.30 ± 0.17 (n = 8) 0.18 ± 0.16 (n = 8)

126 ± 49 (n = 37) 0.65 ± 0.4 (n = 8) 0.19 ± 0.19 (n = 8)

p valuea

p b 0.0004 NSb NSb

p value compared to healthy control muscle. Not significant; P b 0.05 was considered statistically significant.

protein thiol and primary anti-oxidant in muscle, are indicative of prolonged oxidative stress in these muscle biopsies. Similar observations were made in animal models and biopsies of muscular dystrophies (Kar and Pearson, 1979; Ragusa et al., 1997). Total protein thiols, which are crucial in maintaining the redox status of the muscle, were also increased in dysferlinopathy providing further support of oxidant stress in the dysferlinopathic muscle.

a 205 Ubiquitinylated muscle proteins

97 66 43 29 20 kDa

MW

1

2 GAPDH 37 kDa

Ubiquitin/GAPDH Mean + SD

b

25

Nitric oxide (NO) is a freely diffusible free radical produced mainly by nNOS in muscle. nNOS is attached to the sarcolemma with dystrophin glycoprotein complex (DGC) and displacement of DGC in muscular dystrophy increases nNOS NO production. NO can also arise from iNOS when inflammatory macrophages infiltrate muscle damaged during muscular dystrophy (Brenman et al., 1995; Li et al., 2011; Rando, 2001). In addition to oxidative stress elevated nitrite levels in muscle indicate the occurrence of nitrosative stress in dysferlinopathy. However, the source of NO in dysferlinopathy needs to be identified. Peroxynitrite, a product of NO and superoxide, is a primary effector of nitrosative damage and may be responsible for the significant nitro-tyrosinylation of protein(s) of 56 kDa in dysferlinopathic muscle. The redox sensitive transcription factor NF-κB, activated by both oxidative and nitrosative stress, is shown in mice to be activated in calpainopathy, facioscapulohumeral dystrophy and dystrophinopathy (Baghdiguian et al., 2001, 1999; Macaione et al., 2007; Messina et al., 2006). Inhibitors of NF-κB, such as curcumin, and disruption of NF-κB signaling through knockdown of IKKβ, reduced muscle wasting of mdx mice and prevented disuse induced muscle wasting in mice (Acharyya et al., 2007; Alamdari et al., 2009; Bakkar and Guttridge, 2010; Cai et al., 2004; Karin, 2006; Mourkioti et al., 2006; Pan et al., 2008; Poylin et al., 2008). In our study NF-κB signaling also correlated with increased protein degradation through the ubiquitin proteasome pathway in human dsyferlionpathic muscle. Protein degradation through NF-κB activation of the ubiquitin proteasome pathway is one mechanism suggested to underlie muscle wasting. Our studies on human precursor and differentiated cultured muscle cells (myoblasts and myotubes) confirmed that the reduction of dysferlin induces oxidative stress in the muscle and that the mitochondria are a source of ROS generation in absence of dysferlin. The

*

20

4-hydroxynonenal of human primary myoblasts

n=9

n=6 15

10 3 2 1 Post transferred gel stainedwith Commassie Brilliant Blue R. Proteins of each whole lane serve as loading control of corresponding lane in the blot.

5

0 1

2

Fig. 5. Representative Western blots of protein ubiquitinylation in dysferlinopathic muscle. a) Muscle lysates, prepared from human skeletal muscle biopsies, were subjected to SDS-PAGE and western blots. Blots were probed with a) anti ubiquitin antibodies and anti-GAPDH antibodies followed by secondary antibody with IgG–biotin conjugate and developed with streptavidin peroxidase, H2O2 and diaminobenzidine hydrochloride. GAPDH served as the loading control. Lanes: 1—Control and 2—Dysferlinopathic muscles. b) Blots were image analyzed and intensities of protein ubiquitinylated bands normalized with corresponding GAPDH bands. Data shown are mean ± SD of dysferlinopathic muscle compared to healthy control muscles *p b 0.03.

Fig. 6. Western blots of 4-hydroxynonenal (HNE) in human primary myoblasts. Cell lysates were prepared from human primary myoblasts silenced for 24 h with 60 nM siRNA for dysferlin or scrambled siRNA and from control myoblasts. Lysates were subjected to SDS-PAGE and western blots. Blots were probed with anti 4 HNE antibodies followed by secondary antibody with IgG–biotin conjugate, developed with streptavidin peroxidase, H2O2 and diaminobenzidine hydrochloride and image analyzed. Post transferred gels were stained with Commassie Brilliant Blue R and image analyzed. HNE blot intensities of each sample were normalized with intensities of corresponding lanes in the post transferred gels. Lane 1: Control cells, Lane 2: Myoblasts silenced for dysferlin, Lane 3: Myoblasts treated with scrambled siRNA.

Please cite this article as: Rajakumar D, et al, Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy, Life Sci (2014), http://dx.doi.org/10.1016/j.lfs.2014.05.005

D. Rajakumar et al. / Life Sciences xxx (2014) xxx–xxx

a

7

Mitochondrial O2-

Control

Scrambled siRNA

Dysferlin knockdown

b 25000

Arbitrary units

20000 15000 n = 11

10000

n = 12

n = 18

5000 0 1

2

3

Fig. 7. Live cell imaging of mitochondrial ROS generation in human primary myoblasts. a) Representative live cell imaging of mitochondrial superoxide in human primary myoblasts. Human primary myoblasts silenced for 24 h with 60 nM siRNA for dysferlin or scrambled siRNA and control myoblasts were incubated with MitoSOX Red and washed with PBS. The fluorescent probe MitoSOX Red was used to detect and measure mitochondrial ROS in myoblasts. b) Images of mitochondrial superoxide were captured using a Leica DMI 6000 B inverted fluorescence research microscope and quantified with Image J software of myoblasts of 1. Normal human myoblasts, 2. Myoblasts silenced for dysferlin, 3. Myoblasts treated with scrambled siRNA.

contribution of other ROS generating pathways in dysferlinopathy and the link between dysferlin and mitochondrial ROS generation requires study.

a

In conclusion dysferlinopathic muscle is associated with oxidative and nitrosative stress. Mitochondrial superoxide contributes to the oxidative stress of dysferlinopathy which with nitric oxide can potentially

b Mitochondrial O2

250000 200000 150000 100000

n = 11

Control myotubes 50000 n = 20

0 1

2

50000 100000

Dysferlin knockdown myotubes

Fig. 8. Live cell imaging of mitochondrial ROS generation in human primary myotubes. a) Representative live cell imaging of mitochondrial superoxide in human primary myotubes. Human primary myotubes silenced for 24 h with 60 nM siRNA for dysferlin and control myotubes were incubated with MitoSOX Red and washed with PBS. The fluorescent probe MitoSOX Red was used to measure the mitochondrial ROS of normal human myotubes and myotubes silenced for dysferlin. b) Images of the mitochondrial ROS were captured using a Leica DMI 6000 B inverted fluorescence research microscope and quantified with Image J software of 1. Normal human myotubes, 2. Myotubes silenced for dysferlin.

Please cite this article as: Rajakumar D, et al, Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy, Life Sci (2014), http://dx.doi.org/10.1016/j.lfs.2014.05.005

8

D. Rajakumar et al. / Life Sciences xxx (2014) xxx–xxx

form peroxynitirte and underlie degradation of muscle proteins by the activation of the ubiquitin proteasomal pathway through the IKK β/NF-κB pathway. Anti-oxidants that also inhibit nitrosative stress and NF-κB activation, such as curcumin, might prove to be of therapeutic benefit in slowing the progression of muscle wasting that occurs with dysferlinopathy. Conflict of interest The authors declare no conflict of interests.

Acknowledgements The studies were supported in part by a grant from the Indian Council of Medical Research (New Delhi), (Project No 5/4 -5/2/Neuro/2008) and in part by a grant from the Association Française contre Myopathie, (AFM) (SB/NF/2010/0968/15018). Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.lfs.2014.05.005. References Acharyya S, Villalta SA, Bakkar N, Bupha-Intr T, Janssen PML, Carathers M, et al. Interplay of IKK/NF-kappaB signaling in macrophages and myofibers promotes muscle degeneration in Duchenne muscular dystrophy. J Clin Invest 2007;117:889–901. Alamdari N, O'Neal P, Hasselgren PO. Curcumin and muscle wasting: A new role for an old drug? Nutrition 2009;25:125–9. Amato AA, Brown Jr RH. Dysferlinopathies. Handb Clin Neurol 2011;101:111–8. Baghdiguian S, Martin M, Richard I, Pons F, Astier C, Bourg N, et al. Calpain 3 deficiency is associated with myonuclear apoptosis and profound perturbation of the IkappaB alpha/NF-kappaB pathway in limb-girdle muscular dystrophy type 2A. Nat Med 1999;5:503–11. Baghdiguian S, Richard I, Martin M, Coopman P, Beckmann JS, Mangeat P, et al. Pathophysiology of limb girdle muscular dystrophy type 2A: Hypothesis and new insights into the IkappaBalpha/NF-kappaB survival pathway in skeletal muscle. J Mol Med 2001;79:254–61. Bakkar N, Guttridge DC. NF-kappaB signaling: A tale of two pathways in skeletal myogenesis. Physiol Rev 2010;90:495–511. Brenman JE, Chao DS, Xia H, Bredt DS. Nitric oxide synthase complexed with dystrophin and absent from skeletal muscle sarcolemma in Duchenne muscular dystrophy. Cell 1995;82(5):743–52. Buck M, Chojkier M. Muscle wasting and dedifferentiation induced by oxidative stress in a murine model of cachexia is prevented by inhibitors of nitric oxide synthesis and antioxidants. EMBO J 1996;15:1753–65. Bulua AC, Simon A, Maddipati R, Pelletier M, Park H, Kim K-Y, et al. Mitochondrial reactive oxygen species promote production of proinflammatory cytokines and are elevated in TNFR1-associated periodic syndrome (TRAPS). J Exp Med 2011;208:519–33. Bushby KM. Dysferlin and muscular dystrophy. Acta Neurol Belg 2000;100:142–5. Cacciottolo M, Numitone G, Aurino S, Caserta IR, Fanin M, Politano L, et al. Muscular dystrophy with marked dysferlin deficiency is consistently caused by primary dysferlin gene mutations. Eur J Hum Genet 2011;19:974–80. Cai D, Frantz JD, Tawa Jr NE, Melendez PA, Oh B-C, Lidov HGW, et al. IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 2004;119:285–98. Cui H, Kong Y, Zhang H. Oxidative stress, mitochondrial dysfunction, and aging. J Signal Transduct 2012:646354. Eddins MJ, Marblestone JG, Suresh Kumar KG, Leach CA, Sterner DE, Mattern MR, et al. Targeting the ubiquitin E3 ligase MuRF1 to inhibit muscle atrophy. Cell Biochem Biophys 2011;60:113–8. Foletta VC, White LJ, Larsen AE, Léger B, Russell AP. The role and regulation of MAFbx/ atrogin-1 and MuRF1 in skeletal muscle atrophy. Pflugers Arch 2011;461:325–35. Franch HA, Price SR. Molecular signaling pathways regulating muscle proteolysis during atrophy. Curr Opin Clin Nutr Metab Care 2005;8:271–5. Hasselgren PO, Fischer JE. Muscle cachexia: Current concepts of intracellular mechanisms and molecular regulation. Ann Surg 2001;233:9–17. Kar NC, Pearson CM. Catalase, superoxide dismutase, glutathione reductase and thiobarbituric acid-reactive products in normal and dystrophic human muscle. Clin Chim Acta 1979;94:277–80. Karin M. Role for IKK2 in muscle: Waste not, want not. J Clin Invest 2006;116:2866–8. Lawler JM. Exacerbation of pathology by oxidative stress in respiratory and locomotor muscles with Duchenne muscular dystrophy. J Physiol (Lond) 2011;589:2161–70. Lexell J. Human aging, muscle mass, and fiber type composition. J Gerontol A Biol Sci Med Sci 1995;50:11–6. [Spec No]. Li D, Yue Y, Lai Y, Hakim CH, Duan D. Nitrosative stress elicited by nNOSμ delocalization inhibits muscle force in dystrophin-null mice. J Pathol 2011;223:88–98. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265–75.

Macaione V, Aguennouz M, Rodolico C, Mazzeo A, Patti A, Cannistraci E, et al. RAGE-NFkappaB pathway activation in response to oxidative stress in facioscapulohumeral muscular dystrophy. Acta Neurol Scand 2007;115:115–21. Mancini A, Sirabella D, Zhang W, Yamazaki H, Shirao T, Krauss R. Regulation of myotube formation by the actin-binding factor drebrin. Skelet Muscle 2011;1:36. Menazza S, Blaauw B, Tiepolo T, Toniolo L, Braghetta P, Spolaore B, et al. Oxidative stress by monoamine oxidases is causally involved in myofiber damage in muscular dystrophy. Hum Mol Genet 2010;19:4207–15. Messina S, Altavilla D, Aguennouz M, Seminara P, Minutoli L, Monici MC, et al. Lipid peroxidation inhibition blunts nuclear factor-kappaB activation, reduces skeletal muscle degeneration, and enhances muscle function in mdx mice. Am J Pathol 2006;168: 918–26. Messina S, Vita GL, Aguennouz M, Sframeli M, Romeo S, Rodolico C, et al. Activation of NF-kappaB pathway in Duchenne muscular dystrophy: Relation to age. Acta Myol 2011;30:16–23. Min K, Smuder AJ, Kwon O-S, Kavazis AN, Szeto HH, Powers SK. Mitochondrial-targeted antioxidants protect the skeletal muscle against immobilization-induced muscle atrophy. J Appl Physiol 2011;111:1459–66. [Bethesda, Md.: 1985]. Mourkioti F, Kratsios P, Luedde T, Song Y-H, Delafontaine P, Adami R, et al. Targeted ablation of IKK2 improves skeletal muscle strength, maintains mass, and promotes regeneration. J Clin Invest 2006;116:2945–54. Mukhopadhyay P, Rajesh M, Haskó G, Hawkins BJ, Madesh M, Pacher P. Simultaneous detection of apoptosis and mitochondrial superoxide production in live cells by flow cytometry and confocal microscopy. Nat Protoc 2007;2:2295–301. Murton AJ, Constantin D, Greenhaff PL. The involvement of the ubiquitin proteasome system in human skeletal muscle remodelling and atrophy. Biochim Biophys Acta 2008; 1782:730–43. Nguyen K, Bassez G, Bernard R, Krahn M, Labelle V, Figarella-Branger D, et al. Dysferlin mutations in LGMD2B, Miyoshi myopathy, and atypical dysferlinopathies. Hum Mutat 2005;26:165. Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 1979;95:351–8. Ou M, Kim T, Yockman JW, Borden BA, Bull DA, Kim SW. Polymer transfected primary myoblasts mediated efficient gene expression and angiogenic proliferation. J Control Release 2010;142:61–9. Pan Y, Chen C, Shen Y, Zhu C-H, Wang G, Wang X-C, et al. Curcumin alleviates dystrophic muscle pathology in mdx mice. Mol Cells 2008;25:531–7. Poylin V, Fareed MU, O'Neal P, Alamdari N, Reilly N, Menconi M, et al. The NF-κB inhibitor curcumin blocks sepsis-induced muscle proteolysis. Mediators Inflamm 2008;2008. Ragusa RJ, Chow CK, Porter JD. Oxidative stress as a potential pathogenic mechanism in an animal model of Duchenne muscular dystrophy. Neuromuscul Disord 1997;7: 379–86. Rajakumar Dhanarajan, Anilkumar B Patil, Mathew Alexander, Chacko Geeta, Oommen Anna. Degradation of myofibrillar proteins and inadequate antioxidants in selective muscle wasting of limb girdle muscular dystrophy. Int J Case Reports Images 2011; 2:6–11. Rajakumar D, Alexander M, Oommen A. Oxidative stress, NF-κB and the ubiquitin proteasomal pathway in the pathology of calpainopathy. Neurochem Res 2013;38: 2009–18. Rando TA. Role of nitric oxide in the pathogenesis of muscular dystrophies: A “two hit” hypothesis of the cause of muscle necrosis. Microsc Res Tech 2001;55:223–35. Rando TA. Oxidative stress and the pathogenesis of muscular dystrophies. Am J Phys Med Rehabil 2002;81:S175–86. Rando TA, Crowley RS, Carlson EJ, Epstein CJ, Mohapatra PK. Overexpression of copper/ zinc superoxide dismutase: A novel cause of murine muscular dystrophy. Ann Neurol 1998;44:381–6. Renjini R, Gayathri N, Nalini A, Srinivas Bharath M. Oxidative damage in muscular dystrophy correlates with the severity of the pathology: Role of glutathione metabolism. Neurochem Res 2012;37:885–98. Sastry KVH, Moudgal RP, Mohan J, Tyagi JS, Rao GS. Spectrophotometric determination of serum nitrite and nitrate by copper–cadmium alloy. Anal Biochem 2002;306:79–82. Sukhanov S, Semprun-Prieto L, Yoshida T, Michael Tabony A, Higashi Y, Galvez S, et al. Angiotensin II, oxidative stress and skeletal muscle wasting. Am J Med Sci 2011;342: 143–7. Tang Y, Reay DP, Salay MN, Mi MY, Clemens PR, Guttridge DC, et al. Inhibition of the IKK/NF-κB pathway by AAV gene transfer improves muscle regeneration in older mdx mice. Gene Ther 2010;17:1476–83. Terrill JR, Radley-Crabb HG, Iwasaki T, Lemckert FA, Arthur PG, Grounds MD. Oxidative stress and pathology in muscular dystrophies: Focus on protein thiol oxidation and dysferlinopathies. FEBS J 2013;280:4149–64. Thaloor D, Miller KJ, Gephart J, Mitchell PO, Pavlath GK. Systemic administration of the NF-kappaB inhibitor curcumin stimulates muscle regeneration after traumatic injury. Am J Physiol 1999;277:C320–9. Tidball JG, Wehling-Henricks M. The role of free radicals in the pathophysiology of muscular dystrophy. J Appl Physiol 2007;102:1677–86. Tisdale MJ. Is there a common mechanism linking muscle wasting in various disease types? Curr Opin Support Palliat Care 2007;1:287–92. Whitehead NP, Yeung EW, Froehner SC, Allen DG. Skeletal muscle NADPH oxidase is increased and triggers stretch-induced damage in the mdx mouse. PLoS One 2010;5: e15354. Wyke SM, Tisdale MJ. NF-kappaB mediates proteolysis-inducing factor induced protein degradation and expression of the ubiquitin–proteasome system in skeletal muscle. Br J Cancer 2005;92:711–21. Yucel D, Aydogdu S, Cehreli S, Saydam G, Canatan H, Senes M, et al. Increased oxidative stress in dilated cardiomyopathic heart failure. Clin Chem 1998;44:148–54.

Please cite this article as: Rajakumar D, et al, Involvement of oxidative stress, Nuclear Factor kappa B and the Ubiquitin proteasomal pathway in dysferlinopathy, Life Sci (2014), http://dx.doi.org/10.1016/j.lfs.2014.05.005