Involvement of Stress-Related Genes polB and PA14_46880 in Biofilm Formation of Pseudomonas aeruginosa Sahar A. Alshalchi, Gregory G. Anderson Department of Biology, Indiana University—Purdue University Indianapolis, Indianapolis, Indiana, USA

C

hronic Pseudomonas aeruginosa infections in the lungs of cystic fibrosis (CF) patients are characterized by development of biofilm (1, 2). This biofilm formation protects these bacteria from stressful environmental factors, including antibiotic treatment and host defense mechanisms (1, 2). In particular, the biofilm extracellular matrix enhances the survival and persistence of P. aeruginosa by shielding the bacteria from the harsh conditions of CF patient lungs (3). Decreased growth rate, development of persisters, and expression of biofilm-specific resistance factors further enhance biofilm survival in the face of antibiotic and host stress (4, 5). This adaptation to the CF lung environment is controlled by a complex regulatory network (6). Additionally, longterm exposure to stresses during chronic infection results in accumulation of mutations that contribute to persistent survival (7, 8), suggesting that host pressures during infections actually enhance biofilm formation (9, 10). Thus, due to biofilm formation and subsequent phenotypic and genotypic adaptation to the harsh and stressful conditions, P. aeruginosa colonization often becomes lifelong in the CF lung (11), and it is a major factor contributing to CF complications, including respiratory failure and death (12). Genetic adaptation to the CF lung environment is thought to arise by a multistep process. Stress-induced DNA damage leads to mutation in DNA repair systems. Indeed, a high percentage of CF isolates have impaired DNA repair mechanisms (8, 13, 14). This initial defect then results in hypermutability and further genetic mutation (15, 16), which is particularly linked with acquired resistance to antibiotics and oxidative stress, as well as decreased production of specific virulence factors (8). All of these changes indicate that biofilm responses to stress create unique challenges for effective treatment. Numerous studies have investigated P. aeruginosa factors that impact biofilm formation, but in most of these studies, biofilms form on nonliving surfaces, and the relevance of these biofilms to infection is uncertain. We wanted to identify novel biofilm factors that clearly impacted biofilm formation on both nonliving and

4746

iai.asm.org

Infection and Immunity

living surfaces. In our study, we found, through transposon mutagenesis, several mutants that exhibited altered biofilm levels compared with the wild-type (WT) strain. Two of these mutations mapped to the stress-related genes polB and PA14_46880, which encode an alternate DNA polymerase and a putative glutathione synthase, respectively (17). To our knowledge, these two genes have not previously been associated with biofilm formation of P. aeruginosa. We demonstrate that, in addition to reduction in biofilm levels, mutation of these genes correlates with increased production of some virulence factors and resistance to ciprofloxacin. Our study indicates that these genes are involved in a common genetic pathway of biofilm formation. MATERIALS AND METHODS Bacterial strains, plasmids, growth media, and antibiotics. The strains and the plasmids used in this study are listed in Table 1. Abiotic biofilm assays were performed in LB medium at 37°C. To maintain plasmid selective pressure, bacterial strains were grown in LB medium overnight with the appropriate antibiotic concentration: 10 or 50 ␮g/ml gentamicin, 20 ␮g/ml nalidixic acid, 50 ␮g/ml kanamycin, or 50 or 250 ␮g/ml carbenicillin. Generation of a transposon mutant library. A library of P. aeruginosa strain PA14 transposon mutants was generated by conjugation of plasmid

Received 11 April 2014 Returned for modification 8 May 2014 Accepted 18 August 2014 Published ahead of print 25 August 2014 Editor: B. A. McCormick Address correspondence to Gregory G. Anderson, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /IAI.01915-14. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/IAI.01915-14

p. 4746 – 4757

November 2014 Volume 82 Number 11

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

Chronic infections of Pseudomonas aeruginosa are generally established through production of biofilm. During biofilm formation, production of an extracellular matrix and establishment of a distinct bacterial phenotype make these infections difficult to eradicate. However, biofilm studies have been hampered by the fact that most assays utilize nonliving surfaces as biofilm attachment substrates. In an attempt to better understand the mechanisms behind P. aeruginosa biofilm formation, we performed a genetic screen to identify novel factors involved in biofilm formation on biotic and abiotic surfaces. We found that deletion of genes polB and PA14_46880 reduced biofilm formation significantly compared to that in the wild-type strain PA14 in an abiotic biofilm system. In a biotic biofilm model, wherein biofilms form on cultured airway cells, the ⌬polB and ⌬PA14_46880 strains showed increased cytotoxic killing of the airway cells independent of the total number of bacteria bound. Notably, deletion mutant strains were more resistant to ciprofloxacin treatment. This phenotype was linked to decreased expression of algR, an alginate transcriptional regulatory gene, under ciprofloxacin pressure. Moreover, we found that pyocyanin production was increased in planktonic cells of mutant strains. These results indicate that inactivation of polB and PA14_46880 may inhibit transition of P. aeruginosa from a more acute infection lifestyle to the biofilm phenotype. Future investigation of these genes may lead to a better understanding of P. aeruginosa biofilm formation and chronic biofilm infections.

Stress Genes in P. aeruginosa Biofilm

TABLE 1 Strains and plasmids used in this study Relevant genotype

Strains P. aeruginosa wild type PA14 PAO1

Wild type Wild type

20 57

Laboratory strain for cloning

20

In vivo cloning; ura3-52/ura3-52

Invitrogen

Isogenic polB deletion mutant Isogenic PA14_46880 deletion mutant Isogenic polB deletion mutant of PAO1 Isogenic PA1345 deletion mutant

This study This study This study This study

Allelic replacement vector; yeast cloning PBAD expression vector GFP expression plasmid Deletion of polB; pMQ30 backbone Deletion of PA14_46880; pMQ30 backbone Deletion of polB PAO1; pMQ30 backbone Deletion of PA1345; pMQ30 backbone Full-length gene polB; pMQ70 backbone Full-length gene PA14_46880; pMQ70 backbone

20

Escherichia coli S17-1 Saccharomyces cerevisiae InvSc1 P. aeruginosa mutant type: ⌬polB ⌬PA14_46880 ⌬polB PAO1 ⌬PA1345 Plasmids pMQ30 pMQ70 pSMC21 pM13 pM14 pM15 pM16 ppolB pPA14_46880

20 29 This study This study This study This study This study This study

pBT20 from Escherichia coli strain S17-1 into PA14. This plasmid contains the Mariner transposon (18). Arbitrary PCR. The DNA sequence flanking the transposon insertion mutants was determined using arbitrary PCR primers as previously described (19). The primers used for this procedure are listed in Table 2. Deletion and complementation experiments. Isogenic deletion mutant strains were constructed by allelic replacement, using suicide vector pMQ30 as described previously (20). Briefly, using the primer pairs M9Ufor/M9Drev and M10Ufor/M10Drev, we amplified approximately 1,000-bp fragments upstream and downstream of the target genes and transformed them into Saccharomyces cerevisiae along with BamHI-digested pMQ30 (21) for directed recombination of the fragments into plasmids pM13 and pM14 (Table 1). These plasmids were isolated and transformed into E. coli S17-1 by electroporation, and then transferred into P. aeruginosa PA14 by conjugation (22). Exconjugants were selected on LB plates containing 50 ␮g/ml gentamicin and 20 ␮g/ml nalidixic acid. Isolated colonies were cultured overnight in LB and then plated on 10% sucrose–LB agar (without NaCl) to select for spontaneous excision of the plasmid. Deletions were confirmed by PCR using the primer pairs M9for/ M9rev and M10for/M10rev (Table 2). Isogenic deletion of the corresponding polB and PA14_46880 homologs in P. aeruginosa strain PAO1 (polB and PA1345) was accomplished similarly, using primer pairs M9Ufor/M9Drev and M10Ufor/M10Drev to create deletion plasmids pM15 and pM16 (Table 1). Deletions in PAO1 were confirmed by PCR using the primer pairs M9for/M9rev and P1345for/P1345rev (Table 2).

November 2014 Volume 82 Number 11

These procedures create nonpolar isogenic deletion mutations without any “scar” (21). Additionally, polB and PA14_46880 (or PA1345) are not predicted to be in any operon or overlap any other predicted gene (17). In fact, open coding regions downstream of both of these genes are predicted to be in the opposite orientation, thus further decreasing the likelihood of nonpolar effects of mutation. For complementation experiments, the full length of each target gene was amplified from P. aeruginosa strain PA14 using the primer pairs CM9for/CM9rev and CM10for/CM10rev (Table 2). Amplification fragments were mixed with EcoRI-digested pMQ70 cloning vector (Table 1) and transformed into S. cerevisiae (21) for directed recombination of the fragments into plasmids ppolB and pPA14_46880 (Table 1). The recombinant plasmids were transformed into E. coli strain S17-1, and the constructs were confirmed by PCR using the primer pair p730/p729 (Table 2). The ⌬polB and ⌬PA14_46880 deletion mutation strains were transformed with recombinant plasmids and selected on LB medium containing 250 ␮g/ml carbenicillin. Assays were carried out in the absence of arabinose because expression from the PBAD promoter can be leaky in P. aeruginosa (23, 24), and we have previously found complete complementation of phenotypes with the use of these expression plasmids in the absence of arabinose (20). Biofilm and attachment assays in an abiotic system. Biofilm and attachment of the wild-type and isogenic mutant strains were assayed as previously described (25). Briefly, overnight cultures of tested strains were diluted 1:100 into LB medium and then dispensed into wells of 96-well polyvinyl chloride (PVC) microtiter plates (Costar 2797; Corning, NY), followed by incubation at 37°C for the time period specified for each experiment. Detection of attachment (2 h) or biofilm formation (24 h) was carried out by staining the plates with 0.1% crystal violet (CV) for 10 min. The CV was solubilized with 125 ␮l of 30% glacial acetic acid for 10 min, transferred to flat-bottom polystyrene microtiter plates (Greiner bio-one, Germany), and quantified by measuring the absorbance at 550 nm (A550) in a SpectraMaxM2 spectrophotometer (Molecular Devices, Sunnyvale, CA). A negative-control well containing medium only was included in all PVC microtiter plate biofilm assays, and the absorbance value of this well was subtracted from the values of all test wells. Biofilm assays were repeated three independent times with 3 replicate samples in each assay. Planktonic CFU of these strains in the supernatant of biofilm cultures was measured by enumeration of bacterial CFU at each time point. Biofilm, attachment, and cytotoxicity assays in a biotic system. Attachment and biofilm formation of the wild type and isogenic mutant strains on immortalized CF-derived airway epithelial (CFBE) cells were assayed as previously described (20). Briefly, CFBE cells were seeded in 24-well tissue culture plates (Falcon, Franklin, NJ) at a concentration of 2 ⫻ 105 cells/well in minimal essential medium (MEM) (Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum (Atlanta Biologicals, Lawrenceville, CA), 2 mM L-glutamine, 50 U/ml penicillin, and 50 U/ml streptomycin (Lonza, Walkersville, MD) (26). The plates were incubated for 8 to 10 days at 37°C and 5% CO2. Confluent monolayers of cells were inoculated with phosphate-buffered saline (PBS)-washed bacteria at a concentration of 1.2 ⫻ 107 CFU/ml in 0.5 ml MEM/well (without phenol red, fetal serum, or antibiotics) and incubated for 1 h at 37°C and 5% CO2. At this point, attachment to CFBE cells was measured by enumeration of the bacterial CFU attached to the epithelial cells. Each well was washed 3 or 4 times with 0.5 ml PBS and then treated with 1 ml of PBS–10% Triton X-100 for 10 min. The lysates then were harvested into microcentrifuge tubes, vortexed for 3 min, serially diluted, and plated on LB. To assay biofilm formation on CFBE cells, CFBE inoculations with P. aeruginosa were performed as described above, but after a 1-h incubation time, the supernatant was removed and 0.5 ml of fresh MEM supplemented with 0.4% arginine was added to each well. The plates were incubated at 37°C and 5% CO2 for an additional 4 h. Then, the number of CFU/well of bacterial cells was enumerated as described above. Planktonic

iai.asm.org 4747

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

Strain or plasmid

Source or reference

Alshalchi and Anderson

TABLE 2 Primers used in this study Sequence (5=¡3=)

Arbitrary PCR ARB1 ARB6 P237 P238 ARB2 P240 P241

GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC GGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG TATAATGTGTGGAATTGTGAGCGG GGCCACGCGTCGACTAGTAC ACAGGAAACAGGACTCTAGAGG CACCCAGGTTTCTTGTACAC

Deletion M9Ufor M9Urev M9Dfor M9Drev M9for M9rev M10Ufor M10Urev M10Dfor M10Drev M10for M10rev P1345for P1345rev

TCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCGGAGCTTCTGCAGCGCGGAC CGAGAGATTCGGGGTCGATGGGCTCATTGGCGGATGAGCC GGCTCATCCGCCAATGAGCCCATCGACCCC GAATCTCTCG GGAATTGTGAGCGGAAACAATTTCACACAGGAAACAGCTCACTTCCACCATTT CGCAGC ACGCCGAGCGTATCGTCATC CGGGTCGGGGAAATCCCGGA TCGACTGAGCCTTTCGTTTTATTTGAGCCTGGCAGTTCCGCTCGGGGAGCACCGCGGAG TTCAGAGGATACCGCCACTCACGGCGCGCCTCAGTCCGGC GCCGGACTGAGGCGCGCCGTGAGTGGCGGTATCCTCTGAA GGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTAGCCGCGTTCCTGAGCGGTT CTTTCCCGGTTTCGCTCCCG CGCGGCGCGGTACCCGGCGG CGTAAAGCTTGCGTAACGAG GCAGGGCATCGAGATCGATG

Complementation CM9for CM9rev CM10for CM10rev P729 P730

TACTGTTTCTCCATACCCGTTTTTTTGGGCTAGCGAATTCAGGAGGAGCGCGCTATGTCAGCAGCCTCGTTAGC CTGTATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACAGTCAGCGCAGCGCCTTGCTCA TACTGTTTCTCCATACCCGTTTTTTTGGGCTAGCGAATTCAGGAGGAGCGCGCTATGTTCGAGATCAGCGTCCA CTGTATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACAGTCAGCGGTTGA GGCGGTTGT CAGACCGCTTCTGCGTTCTG GCAACTCTCTACTGTTTCTCC

qRT-PCR QpolBfor QpolBrev Q46880for Q46880rev AlgRfor AlgRrev PA5110for PA5110rev

CTTCCAGCAGGAACTCTACC CCCACATAGTGCTCGTAGTC GGCCCAGATTCTTCTAC CGTTGACCTCGATGACCAG GCCAGCAATGGCGAAGAAGC TGGGCCGTGCAGAAGATCAC CCTACCTGTTGGTCTTCGACCCG GCTGATGTTGTCGTGGGTGAGG

CFU of the wild-type and mutant strains in the supernatant of CFBE coculture biofilms was measured by CFU enumeration from 10-␮l samples. To detect the cytotoxic effect of tested strains, lactate dehydrogenase (LDH) released from CFBE cells, upon which P. aeruginosa biofilms had formed, was measured after a 6-h incubation time, as we have previously described (20). LDH levels were determined using CytoTox 96 nonradioactive cytotoxicity assay kit (Promega, Madison, WI) according to the manufacturer’s instructions. As a positive control, we added 1% Triton X-100 to a set of uninoculated CFBE cells, which resulted in complete lysis of the epithelial cells. This value represents 100% cytotoxicity. A cytotoxicity of 0% represents the average value of the supernatant from another set of wells of uninoculated CFBE cells in the absence of Triton X-100, as a measure of spontaneous LDH release. Bacterial invasion. Bacterial invasion was assayed as described previously (27, 28). Briefly, CFBE cell monolayers were inoculated with test strains and incubated for biofilm formation as mentioned above. After a 5-h incubation time, the supernatant was removed, 0.5 ml of freshly prepared gentamicin (500 ␮g/ml) was added per well, and these samples were

4748

iai.asm.org

incubated for an additional 1 h at 37°C and 5% CO2. The CFU/well of bacterial cells then was enumerated as described above. Microscopy of biotic biofilms. For microscopic examination of biofilms on CFBE cells, wild-type and mutant strains were transformed by electroporation with plasmid pSMC21, which constitutively expresses green fluorescent protein (GFP) (29). For epifluorescence microscopy, biofilms were established on CFBE cells as described above. At 5 h, cells were washed twice with PBS to remove unattached bacteria and fluorescence, and transmitted light images were obtained by an EVOSfl microscope. For confocal microscopy, CFBE cells were seeded in 4-well chamber slides (Lab-Tek II chamber slide; Thermo Scientific) and grown as described above. Cell monolayers were then inoculated with test bacteria as described above. At 5 h, cells were washed twice with PBS to remove unattached bacteria and then fixed with 2.5% paraformaldehyde for 10 min at 37°C. Fixed cells were washed twice with PBS, stained with 5 ␮g/ml wheat germ agglutinin conjugated with Alexa Fluor 647 (Invitrogen, Eugene, OR), and incubated for 10 min at 37°C. After removal of this labeling solution, the samples were washed twice with PBS and fixed for an additional 5 min in 2.5% paraformaldehyde. Coverslips were mounted

Infection and Immunity

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

Primer

Stress Genes in P. aeruginosa Biofilm

November 2014 Volume 82 Number 11

bation at 37°C, the zone of twitching motility between the agar and petri dish interface was visualized by staining with crystal violet (0.1%) for 10 min. Twitching motilities were quantified by measuring the diameters of twitching zones. Pyocyanin production in planktonic cultures. Pyocyanin levels in LB medium were calculated as previously described (20, 34). Equal volumes of chloroform were added to cell-free culture supernatants of tested strains and mixed well. The pyocyanin then was extracted from the chloroform phase with 0.1 N HCl. The aqueous layers were diluted with 200 mM tris-HCl (pH 8), and the absorbance was measured at 390 nm. To study the physiological effect of pyocyanin in the epithelial airway cells, CFBE monolayers were prepared in 24-well tissue culture plates, as described above. Overnight culture supernatants of the wild-type and mutant strains were filter sterilized, and 125 ␮l of these cell-free supernatants was instilled directly into CFBE wells. These test wells were incubated at 37°C and 5% CO2 for 30 min, whereupon the gross morphology of the CFBE cells was examined using an EVOSfl microscope. Growth kinetics. Strains were diluted 1:100 into LB or MEM from overnight cultures, and 150 ␮l was dispensed into sterile, flat-bottom polystyrene microtiter plates (Greiner bio-one, Germany). A600 readings were taken at 30-min intervals over a 14-h time period using a SpectraMaxM2 spectrophotometer maintained at 37°C. Viable counts of ⌬polB and ⌬PA14_46880 cells were analyzed as follows. Strains were diluted 1:100 into LB medium from overnight cultures followed by incubation at 37°C with shaking. Samples were taken immediately (time zero) and every hour for 7 h. At each time point, 10-␮l samples were plated on LB medium, and bacterial CFU were enumerated after overnight incubation at 37°C. Statistical analysis. Statistical significance was determined using Student’s t test. A P value of ⬍0.05 was considered statistically significant. Error bars represent standard deviations.

RESULTS

Screening for mutants defective in biofilm formation. We sought to identify novel genes involved in P. aeruginosa biofilm formation. We screened ⬃8,000 mutants from a transposon mutant library of P. aeruginosa (created in our laboratory previously [unpublished data]) for deficiencies in biofilm formation. We identified 40 potential transposon mutants with altered biofilm level compared to that of the wild type (data not shown). We mapped the transposon insertions in two of these mutants to polB and PA14_46880 (see Fig. S1 in the supplemental material), encoding DNA polymerase II and a putative glutathione synthase, respectively (17). To confirm the involvement of these genes in biofilm, we created isogenic deletion mutant (⌬polB and ⌬PA14_46880) strains and tested them for biofilm formation. Biofilm levels were reduced significantly (P ⬍ 0.05) and ranged from 3.3% to 6.2% of wild-type levels (Fig. 1A). These levels were even lower than those reached by transposon insertional mutants, suggesting that the transposon perhaps exerted additional effects on biofilm formation (see Discussion). Our results indicate that these genes have roles in P. aeruginosa biofilm development directly or indirectly. Also we found by qRT-PCR that polB and PA14_46880 are not expressed in our deletion mutant strains (Fig. 1B and C). Similar results were obtained after deletion of the corresponding genes in P. aeruginosa strain PAO1 (⌬polB and ⌬PA1345) (see Fig. S2 in the supplemental material). Importantly, reduced biofilm levels were not the result of fewer bacteria present in the biofilm culture. In fact, we found slightly increased numbers of planktonic cells of the mutant strains in supernatants of biofilms, compared to the number of the wild type (see Fig. S3 in the supplemental material). Complementation of the isogenic mutants with plasmids car-

iai.asm.org 4749

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

with 1 drop of SlowFade Diamond antifade mountant (Life Technologies), cured for 24 h in the dark, and then stored at 4°C. Confocal microscopic observations and image acquisitions were performed in the Indiana Center for Biological Microscopy at the Indiana University School of Medicine (Indianapolis, IN), using an Olympus FV1000MPE multiphoton laser scanning microscope. Image analysis was done using Image J software. Ciprofloxacin sensitivity experiments. Ciprofloxacin sensitivity was assayed as described previously (30, 31). Briefly, overnight cultures of tested strains were subcultured 1:100 into LB medium. At the mid-exponential phase (A600, 0.5), tested cultures were treated with ciprofloxacin at a final concentration of 200 ng/ml, followed by incubation at 37°C for 3 h with gentle shaking. Samples were taken immediately before drug addition (time zero) and every hour for 3 h. To enumerate surviving cells, 100-␮l samples were collected from ciprofloxacin-treated cultures at each time point mentioned above, washed with PBS, and plated on LB medium. The number of CFU/ml was calculated after overnight incubation at 37°C. The MIC of ciprofloxacin for P. aeruginosa was determined by Etest strips (bioMérieux, France) on LB agar. We used LB as the medium to maintain the same growth condition as the ciprofloxacin sensitivity assays, which also used LB. Etest strips were placed on freshly streaked bacterial lawns, and these were incubated overnight at 37°C. The MIC was recorded as the antibiotic concentration at which the bacterial growth was inhibited. qRT-PCR. Gene expression of polB and PA14_46880 was measured by quantitative reverse transcription-PCR (qRT-PCR) in the wild-type and deletion mutant strains as follows. Overnight cultures of tested strains were diluted 1:100 into LB medium and incubated to mid-exponential growth phase (A600, 0.5). Total RNA of tested strains was isolated using the Qiagen RNeasy isolation kit (Qiagen, Valencia, CA). One milliliter of bacterial cells in the mid-log phase of growth was centrifuged at 4°C for 5 min and resuspended in 100 ␮l of Tris-EDTA (TE) buffer (pH 8) with 1 ␮g/ml lysozyme. From this point, we followed the manufacturer’s protocol for bacterial RNA isolation, including on-column DNase digestion. A second DNase treatment was performed on the total eluted RNA, in which RNA preparations were incubated with DNase I (Roche Diagnostics, Germany) for 1 h at 37°C. Following the treatment, RNA preparations were purified with Qiagen RNeasy columns, according to the manufacturer’s instructions. The purity of extracted RNA was checked by PCR using the PA5110for/rev primer pair (Table 2) to test for the absence of contaminating DNA. The concentrations and purity of prepared RNAs were further measured using a NanoDrop spectrophotometer. cDNA synthesis was performed using the SuperScript III first-strand synthesis system for RT-PCR kit (Invitrogen, Carlsbad, CA) with 1 ␮g of RNA, following the manufacturer’s instructions. Real-time analysis was performed with SYBR green PCR master mix (Applied Biosystems, CA) in a total volume of 25 ␮l, using primer pairs corresponding to the polB and PA14_46880 genes (Table 2). Expression values were normalized to fbp gene transcript levels (PA5110for/rev primers), the expression of which remains unchanged under different conditions (20). PCRs were carried out using an Applied Biosystems 7300 realtime PCR system as follows: 1 cycle of 50°C for 2 min and then 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 1 min, and 70°C for 1 min. The dissociation step was 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s. The transcriptional levels of algR were also tested, by qRT-PCR, in planktonic cultures of wild-type and isogenic mutant strains in the presence of 200 ng/ml ciprofloxacin and in untreated cultures. Overnight cultures of tested strains were diluted 1:100 into LB medium in the absence and presence of 200 ng/ml ciprofloxacin and incubated to the midexponential growth phase (A600, 0.5). RNA isolation, cDNA synthesis, and qRT-PCR were performed as described above. Twitching motility assay. Twitching motility was assayed as described previously (32, 33). Briefly, test strains were stab inoculated through a thin LB agar (1%) layer to the bottom of the petri dish. After overnight incu-

Alshalchi and Anderson

FIG 1 Isogenic deletion of target genes leads to reduced biofilm levels. (A) Biofilm levels of the ⌬polB and ⌬PA14_46880 mutant strains were quantified by

rying full-length copies of the genes, ⌬polB/ppolB and ⌬PA14_ 46880/p46880, restored biofilm production significantly (P ⬍ 0.05), to levels indistinguishable from that of the wild type (Fig. 2). Moreover, overexpression of each of these genes in the wild-type strain resulted in significant enhancement of biofilm formation at 24 h compared to that in the wild-type control with an empty vector (WT/pMQ70). Next, we questioned whether the defects in biofilm formation of our mutants were due to initial attachment. Accordingly, we monitored the adhesion to PVC microtiter plates after 2 h of incubation, a time point that is often used to assess P. aeruginosa attachment levels in this biofilm model (35). Adhesion of the wild type was much greater than that of the mutant strains, and complementation almost completely restored wild-type biofilm attachment levels (Fig. 3). Mutant strains are defective for attachment to airway cells. We wondered if our isogenic mutant strains were also defective for interaction with CF-derived airway cells, similar to the abiotic system. To address this issue, we quantified bacteria attached to the epithelial airway cells after 1 h, and our results showed a significantly (P ⬍ 0.05) reduced level of binding by ⌬polB/pMQ70 and ⌬PA14_46880/pMQ70 cells, compared with the wild type (Fig. 4A). Complementation of the mutants reverses the phenotype and led to slightly increased CFU compared to the wild type

with vector control (Fig. 4A). This finding indicated that mutant strains had a decreased ability to bind in the biotic system. To add additional proof to our observations, confluent monolayers of CFBE airway cells were inoculated with the ⌬polB/ pMQ70 and ⌬PA14_46880/pMQ70 strains for 5 h. Using this method, we have previously found that P. aeruginosa forms biofilm on the CFBE cells, and biofilm levels have been measured by enumerating bacterial CFU (20). Notably, we observed a significant decrease in the total number of mutant cells in the biofilm biomass, and complementation was able to restore CFU to the same levels as the wild type (Fig. 4B). Additionally, we transformed the wild-type and mutant strains with pSMC21, which constitutively expresses GFP (29). CFBE coculture biofilms were formed with these strains, and epifluorescence microscopy revealed that wild-type cells were clustered in microcolonies across the CFBE monolayer after 5 h, while the mutant strains were dispersed as single cells across the monolayer (see Fig. S4 in the supplemental material). In previous studies, we have found, by confocal microscopy, that these microcolony clusters formed by wild-type P. aeruginosa on CFBE cells are primarily attached to the apical surface of the cells (36, 37). However, other recent studies have found that P.

FIG 2 Isogenic mutations can be complemented by expression of the genes in

trans. Biofilm levels were determined at 24 h for the ⌬polB (A) and ⌬PA14_46880 (B) strains, as described in Materials and Methods. Complementation with ppolB and p46880 significantly rescued biofilm defects (*, P ⬍ 0.05), compared with the empty vector control (pMQ70). ppolB and p46880 are polB and PA14_46880 full-length complementation plasmids, respectively. The wild-type (WT) strain with recombinant plasmids ppolB and p46880 exhibited significantly more biofilm than the wild-type strain with the empty vector control (pMQ70). Error bars represent standard deviations from 3 replicate samples. The results are representative of three independent experiments carried out in triplicate.

4750

iai.asm.org

FIG 3 Isogenic mutant strains are defective in adhesion. The ⌬polB/pMQ70

and ⌬PA14_46880/pMQ70 mutant strains were assayed for binding to PVC wells for 2 h, as described in Materials and Methods. Both of these strains were defective in adhesion compared to WT/pMQ70. Complementation with fulllength genes (ppolB and p46880) restored the impairment. pMQ70 is the empty cloning vector. *, P ⬍ 0.05 compared to the wild type; #, P ⬍ 0.05 compared to mutants. The results are the average from three independent experiments carried out in triplicate, and error bars represent standard deviations.

Infection and Immunity

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

measuring the intensity of CV staining compared to that of the wild type (WT). Absorbance was measured at 550 nm (A550) in a spectrophotometer, as described in Materials and Methods. The results are representative of three independent experiments carried out in triplicate, and error bars represent standard deviations. The wild-type value represents the average of three independent experiments carried out in triplicate. (B and C) Transcript levels of the polB and PA14_46880 were measured by qRT-PCR in the WT and isogenic mutant strains. Mutation of polB and PA14_46880 results in a significant decrease in gene expression in the mutant strains compared to the WT. *, P ⬍ 0.05 compared to the WT. The results are representative of three independent experiments carried out in triplicate, and error bars represent standard deviations.

Stress Genes in P. aeruginosa Biofilm

enumeration of the total number of wild-type, ⌬polB/pMQ70, ⌬PA14_46880/pMQ70, and complemented mutants after 1 h of incubation. (B) Biofilm biomass of the wild-type strain, the ⌬polB/pMQ70 and ⌬PA14_46880/pMQ70 mutants, and the complemented mutants on CFBE cells was determined after 5 h of incubation. pMQ70 is the empty cloning vector. *, P ⬍ 0.05 compared to WT/pMQ70. The results are representative of three independent experiments carried out in triplicate, and error bars represent standard deviations. The wild-type values represent the average from three independent experiments carried out in triplicate. (C) Confocal microscopy of CFBE cocultures. Biofilm microcolonies of wild-type strain PA14/pSMC21 were evident as clusters attached to CFBE cells. However, ⌬polB/pSMC21 and ⌬PA14_46880/pSMC21 cells were attached to CFBE monolayers as small groupings of 1 to 5 bacteria. Orthogonal views accompany each image panel, and the yellow lines indicate the position from which the view was generated. Bacteria expressing GFP are green, and membranes stained with wheat germ agglutinin conjugated with Alexa Fluor 647 are magenta. No intracellular ⌬polB and ⌬PA14_46880 cells were observed (data not shown).

aeruginosa can invade epithelial cells (27, 38–40). Thus, we performed gentamicin protection assays to monitor bacterial invasion of CFBE cells. The CFU of the wild type exhibited a nearly 3-log10-unit reduction, while the ⌬polB and ⌬PA14_46880 CFU were almost completely eliminated (see Fig. S5A in the supplemental material), compared to levels in biofilm cultures before treatment (Fig. 4B). To further explore bacterial positioning with respect to the airway cells, we performed confocal microscopy of 5-h cocultures. As found in previous studies, wild-type microcolony clusters were bound to the apical surface of the airway cells (Fig. 4C, left panel), although we did observe occasional intracellular wild-type bacteria (see Fig. S5B). Importantly, ⌬polB and ⌬PA14_46880 cells were found exclusively as individual bacteria or occasionally as small groupings of 2 to 5 bacteria attached to the apical surface of the CFBE cells (Fig. 4C, middle and right panels); we did not find any intracellular ⌬polB and ⌬PA14_46880 bacteria (data not shown). Together, these observations support the previous CFU data (Fig. 4A and B) and suggest that our mutants are defective in biofilm formation compared with the wild type. Moreover, these results correlated well with the previous abiotic biofilm data (Fig. 2 and 3) and confirm that the deletion mutants display decreased biofilm levels. Twitching motility of mutant strains. The above results suggest an initial attachment inhibition as well as a subsequent biofilm maturation block in the ⌬polB and ⌬PA14_46880 mutants.

November 2014 Volume 82 Number 11

Twitching motility has been proven to be crucial for initial attachment of the pathogen to host epithelial tissue and for development of biofilm (35, 41). Thus, we investigated the ability of our mutant strains to twitch, using an agar plate method. We found significantly reduced twitching zones in our mutants compared to the wild type (Fig. 5). Mutant strains exhibited the same growth kinetics as the WT. We also wondered if biofilm repression in mutant strains was due to a reduction in growth rate. To explore this idea, the growth kinetics of planktonic cells was examined in LB medium. The

FIG 5 Mutants exhibit decreased twitching compared to the wild type. No significant differences were observed between mutant strains. The results are representative of three independent experiments carried out in triplicate. Error bars represent standard deviations from 3 replicate samples. *, P ⬍ 0.05 compared to the wild type.

iai.asm.org 4751

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

FIG 4 Isogenic mutation strains are defective for binding and biofilm formation on CFBE airway cells. (A) Initial attachment to CFBE was assessed by

Alshalchi and Anderson

kinetics of the ⌬polB/pMQ70 (A) and ⌬PA14_46880/pMQ70 (B) strains were measured by spectrophotometry. No differences were observed in the growth of mutant strains compared those of the wild-type and complemented strains. Absorbance was measured at 600 nm (A600). pMQ70 is the empty cloning vector.

⌬polB/pMQ70 and ⌬PA14_46880/pMQ70 mutant strains did not display impaired growth compared to the wild type (Fig. 6A and B). To confirm this observation, we determined the viable count of deletion mutant strains in LB medium, as mentioned in Materials and Methods. No significant differences in viability were observed between isogenic mutant strains and the wild type (see Fig. S6 in the supplemental material). Moreover, the growth kinetics in MEM revealed that the mutant strains grew better than the wild type (see Fig. S7 in the supplemental material). Mutant strains are more resistant to ciprofloxacin. PolB and

FIG 7 Increased survival of mutants under ciprofloxacin treatment. The numbers of surviving ⌬polB/pMQ70 (A) and ⌬PA14_46880/pMQ70 (B) cells were

determined following exposure to ciprofloxacin (200 ng/ml) for 1, 2, and 3 h and compared to those of the ⌬polB/ppolB and ⌬PA14_46880/p46880 complemented mutant strains and the wild type. pMQ70 is the empty cloning vector. Error bars represent standard deviations from 3 replicate samples. The results are representative of three independent experiments carried out in triplicate. *, P ⬍ 0.05 compared to WT/pMQ70.

4752

iai.asm.org

Infection and Immunity

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

FIG 6 Equal growth among the wild-type and mutant strains. The growth

PA14_46880 are thought to be involved in stress responses (14, 42, 43). In order to investigate this hypothesis further, we treated our isogenic deletion mutants with the bacterial quinolone antibiotic ciprofloxacin (200 ng/ml), which has been shown to induce biofilm formation in bacteria (9, 10). We sought to measure bacterial cell survival following the application of ciprofloxacin. Generally, our results showed a significant decrease in the total survival of cells in all tested strains over 3 h (Fig. 7). Interestingly, we observed that the wild-type strain was more sensitive to ciprofloxacin. We found approximately 1- to 2-log increases in the survival of the ⌬polB/pMQ70 (Fig. 7A) and ⌬PA14_46880/pMQ70 (Fig. 7B) cells after 2 h of exposure to ciprofloxacin compared to the wild type. This significant increase in survival continued through 3 h for the ⌬PA14_46880/pMQ70 strain. Also, it appeared that complementation partially restored wild-type bacterial killing in both mutant strains. Taken together, the reduction in ciprofloxacin-mediated killing indicated to us that the ⌬polB/pMQ70 and ⌬PA14_46880/ pMQ70 strains are more resistant than the wild type. Supporting this observation, we calculated that the MIC of ciprofloxacin for the wild type was 0.108 ␮g/ml, but the MIC was 0.168 ␮g/ml for both the ⌬polB and ⌬PA14_46880 strains. Expression of algR is downregulated under ciprofloxacin pressure. To investigate the mechanism behind this stress phenotype, we looked at regulatory proteins involved in antibiotic stress response and biofilm formation. Specifically, we were interested in determining whether AlgR was involved in our observed response to ciprofloxacin. AlgR is a stress regulator that is known to respond to oxidative stress, influence biofilm formation and production of the biofilm polysaccharide alginate, and impact resistance to antibiotics (44, 45). Accordingly, we used qRT-PCR to monitor algR expression in relation to the normalization control gene fbp (20). We found the relative expression of algR to be significantly (P ⬍ 0.05) increased in the ⌬polB and ⌬PA14_46880 strains, by 2- and 1.6-fold, respectively, in nontreated cultures compared with the wild type (Fig. 8). Conversely, no significant differences were observed within ciprofloxacin-treated cultures between the wild type and mutants (Fig. 8). Ciprofloxacin treatment led to a significant decrease in algR transcript levels in the ⌬PA14_46880 strain (P ⬍ 0.05). A similar trend was observed in the ⌬polB strain, but this effect was not statistically significant. Effect of deletion mutation on production of pyocyanin in planktonic cultures. To further look at the mechanisms behind this stress phenotype, we sought to know whether pyocyanin was

Stress Genes in P. aeruginosa Biofilm

involved. Pyocyanin is a potent cytotoxin, and it has also been shown to assist redox cycling in the absence of other electron acceptors in P. aeruginosa. This adaptation allows these bacteria to balance their intracellular redox state (46). Thus, we tested the pyocyanin production in planktonic cultures of the wild-type and mutant strains. We found that the ⌬polB/pMQ70 and ⌬PA14_ 46880/pMQ70 strains showed increased pyocyanin production compared to the wild type. Complementation of both mutants led to pyocyanin levels indistinguishable from those of the wild type (Fig. 9A). Similar results were obtained with wild-type PAO1 and its respective isogenic deletion mutants (the ⌬polB and ⌬PA1345 strains) (see Fig. S8 in the supplemental material). These results indicate that the mutations affect pyocyanin production. To demonstrate the physiological relevance of this increase in secreted pyocyanin from our mutants, we added cell-free bacterial culture supernatants directly to CFBE cell monolayers. The integrity of the monolayer was observed by microscopy. As shown in Fig. 9B, supernatants induced death of airway epithelial cells, leading to severe disruption of the CFBE cell monolayer. As shown for CFBE cells treated with supernatants from wild-type bacteria, there were empty areas in the monolayer where cells had been killed and removed (Fig. 9B). However, in wells treated with supernatants from the ⌬polB and ⌬PA14_46880 strains, widespread destruction was evident, and only a few CFBE cells remained intact. These observations correlate well with the increased pyocyanin secreted by the mutant strains. Mutant strains are more cytotoxic. We wanted to know whether the increased pyocyanin production of isogenic mutants led to an increase in cytotoxic virulence. In order to address this issue, we inoculated confluent CFBE cell monolayers with the ⌬polB and ⌬PA14_46880 strains in 24-well tissue culture plates and measured LDH released from the cells as a determinant of cytotoxicity. Our results showed that the mutant strains were significantly more cytotoxic to the CFBE cells than the wild type. Moreover, the ⌬polB strain exhibited greater toxicity (84.4%)

November 2014 Volume 82 Number 11

FIG 9 Pyocyanin levels are increased in planktonic cultures of ⌬polB and

⌬PA14_46880 cells. (A) Pyocyanin levels in planktonic cultures of ⌬polB/ pMQ70 and ⌬PA14_46880/pMQ70 cells were significantly increased (*, P ⬍ 0.05) compared to those in the wild type. Complementation with recombinant plasmids ppolB and p46880 rescued pyocyanin to levels indistinguishable from those in the wild type. Absorbance was determined at 390 nm (A390). The results are the average of three independent experiments carried out with four to five replicates each experiment, and error bars represent standard deviations. (B) Supernatants of ⌬polB and ⌬PA14_46880 cells severely disrupt CFBE cell monolayers. Cell-free supernatants of the wild-type and mutant strains were added to CFBE cells, and the monolayers were observed by microscopy after 30 min. Untreated monolayers were also imaged for comparison. Images were obtained by an EVOSfl microscope. Scale bar, 100 ␮m.

than the ⌬PA14_46880 strain (70.8%) (Fig. 10). Complementation of deletion mutant strains suppressed the cytotoxic effects of mutations almost to the same levels as the wild type (Fig. 10). Importantly, this increased cytotoxicity of mutants is not due to increased bacterial number on the cells; in fact, we found the opposite (Fig. 4). On the other hand, we found slightly elevated ⌬polB planktonic CFU of mutant strains in CFBE supernatants after 6 h, although ⌬PA14_46880 CFU were identical to those of the wild-type (see Fig. S9 in the supplemental material). DISCUSSION

Due to the ability of P. aeruginosa to form chronic biofilm infections that are difficult to eradicate, the development of new strategies to control these recalcitrant infections is becoming increasingly important. However, most P. aeruginosa biofilm studies are carried out using nonliving surfaces as platforms, and the relevance of these biofilm factors to infectious biofilms is unclear. In this study, we screened a transposon insertion mutant library of P.

iai.asm.org 4753

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

FIG 8 Transcriptional levels of algR are elevated in polB and PA14_46880 mutant strains. Relative expression of algR under ciprofloxacin treatment was determined by qRT-PCR. The expression of algR in the ⌬polB/pMQ70 and ⌬PA14_46880/pMQ70 mutant strains was significantly increased in untreated cultures (Cip⫺), by 2-fold and 1.6-fold, respectively, compared to the wild type, whereas no significant differences in expression were observed in cultures treated with 200 ng/ml ciprofloxacin (Cip⫹). The relative expression was normalized to fbp expression as a control transcript. Error bars represent standard deviations from 3 replicate samples. *, P ⬍ 0.05 compared to the untreated wild type. The results are representative of three independent experiments carried out in triplicate. Additionally, treatment of ⌬PA14_46880 cells with ciprofloxacin led to significantly decreased algR transcript levels (‡, P ⬍ 0.05) compared to those in the untreated ⌬PA14_46880 cells.

Alshalchi and Anderson

aeruginosa for deficiencies in biofilm formation. In our work, we identified two genetic determinants that contribute to biofilm formation on biotic and abiotic surfaces. Mutation of these two genes, polB and PA14_46880 (see Fig. S1 in the supplemental material), revealed obvious reduction in bacterial attachment (Fig. 3 and 4A) and biofilm formation (Fig. 1, 2, and 4B and C; see Fig. S1) in the plastic and CFBE coculture biofilm models. These results confirm that that these genes have roles in biofilm biosynthesis or regulation on a variety of surfaces, and they might be vitally important for formation of infectious biofilm (e.g., in the CF lung). Importantly, biofilm effects were independent of growth rate and planktonic CFU levels (Fig. 6; see Fig. S3, S6, and S7 in the supplemental material). Also, while the transposon mutations show a milder phenotype than the isogenic deletion strains, it is imperative to remember that there are several caveats in working with transposon insertion mutants. First, the genes that are inactivated by the transposon are still present. Thus, depending upon where the transposon inserted, small or even large portions of the gene could still be transcribed and translated, leading to partial activity. Additionally, it is possible that the transposon could randomly excise from the gene in a subpopulation of the culture, resulting in partial activity of the factor in the culture as a whole. Finally, promoters on the transposon could inappropriately promote transcription of neighboring genes, which could confound assay results. Our results demonstrate that even modest transposon phenotypes (see Fig. S1) can lead to the discovery of genes that are vitally necessary for a particular function (Fig. 1). We also found that expression of these genes in wild-type P. aeruginosa stimulated biofilm formation (Fig. 2). Thus, polB and PA14_46880 might influence additional biofilm maturation steps, as well as impacting initial attachment. It is intriguing that twitching motility was inhibited in the ⌬polB and ⌬PA14_46880 strains (Fig. 5). Twitching motility allows dispersed, attached bacteria to migrate into microcolonies during biofilm maturation. In P. aeruginosa, twitching motility involves the action of type IV pili (35, 41), which are also an attachment factor for this microorganism. It is possible that mutation of polB or PA14_46880 disrupts

4754

iai.asm.org

Infection and Immunity

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

FIG 10 Increased cytotoxicity effect of mutant strains on CFBE epithelial cells. The cytotoxicity of the ⌬polB/pMQ70 and ⌬PA14_46880/pMQ70 mutant strains was analyzed after 6 h, as described in Materials and Methods. The mutant strains were significantly (*, P ⬍ 0.05) more cytotoxic to CFBE cells than the wild-type strain and mutant strains complemented with full-length genes (ppolB and p46880). Error bars represent standard deviations from three replicate samples. The numbers above the bars indicate the percentage of cytotoxicity values. The results are representative of three independent experiments carried out in triplicate. The wild-type value represents the average from three independent experiments carried out in triplicate.

type IV pilus function, which in turn could decrease bacterial binding and biofilm maturation. Indeed, mutation of polB and PA14_46880 resulted in complete inability of the bacteria to form into biofilm microcolonies on airway cells (Fig. 4C; see Fig. S4 in the supplemental material). Furthermore, invasion of the bacteria appeared to be inhibited, as only extracellular ⌬polB and ⌬PA14_46880 cells were observed. On the other hand, the wild type formed large clusters on the CFBE cell surface (Fig. 4C; see Fig. S4) as well as invaded the cells (see Fig. S5B in the supplemental material). It is important to note that the presence of gentamicin-protected bacteria (see Fig. S5A) could be the result of intracellular bacteria as well as the extra measure of antibiotic resistance afforded to bacteria within biofilms. To begin to uncover the mechanisms of polB and PA14_46880 in biofilm formation, we investigated the stress-related properties of these genes. Indeed, both appear to be involved in stress responses. Alignment analysis of PA14_46880 revealed approximately 39% identity with the rimK gene of Escherichia coli, which encodes L-glutamate ligase (data not shown). This enzyme catalyzes the posttranslational addition of a C-terminal glutamate residue to the 30S ribosomal subunit protein S6 (47). The RimK protein is known to respond to antibiotic stress (42, 43). The polB gene encodes a DNA polymerase in P. aeruginosa that is active upon DNA damage (14). We induced stressful conditions by incubation with low levels of the fluoroquinolone antibiotic ciprofloxacin. This type of drug targets the A subunit of DNA gyrase and inhibits DNA supercoiling and transcription—this inhibition ultimately leads to cell death (48). In our study, we found significant delays in cell death of isogenic mutant strains at 2 and 3 h of treatment (Fig. 7A and B). Thus, our data indicate that deletion of the polB and PA14_46880 genes protects against the drug treatment. We speculate that these factors keep the bacterium sensitized to drug stress, which is necessary for proper initiation of biofilm formation regulatory cascades. AlgR is an important regulator involved in biofilm formation processes, including polysaccharide production (alginate), virulence modulation, and stress response (49). For instance, it was found that an algR mutant of P. aeruginosa was more resistant to killing by an in vitro oxidase system as well as polymorphonuclear leukocyte (PMN) oxidative stress but more sensitive to killing by hypochlorite (4). Somewhat consistent with that study, we found that mutation of polB and PA14_46880 resulted in increased algR transcription (Fig. 8), which may partially account for the increased survival of these mutants under ciprofloxacin pressure. It is unclear why ciprofloxacin treatment leads to decreased algR expression, but it is possible that the presence of increased algR levels prior to treatment primes the cells to respond to antibiotic stress. There may be some regulatory overlap between genetic responses to stress of drug exposure and algR expression. Our results also suggest that pyocyanin might be playing a protective role under ciprofloxacin pressure. Pyocyanin causes host cell injury and death by producing reactive oxygen species (e.g., superoxide) through NADH reduction, which subsequently causes cell injury and death (50, 51). It has also been shown that pyocyanin reduction facilitates redox balancing through electron transfer, thus enabling survival under conditions of energy depletion, such as biofilm formation (46). Therefore, we propose that the increased pyocyanin production (Fig. 9; see Fig. S8 in the supplemental material) and hence increased redox activity, in our

Stress Genes in P. aeruginosa Biofilm

November 2014 Volume 82 Number 11

suggest that PolB and PA14_46880 negatively impact toxicity. Thus, the polB and PA14_46880 genes might form a link between drug stress and the chronic biofilm phenotype, by holding virulence properties and oxidative stress reduction factors (e.g., pyocyanin) in check during early colonization and biofilm formation. This action leads to proper activation of biofilm signaling. Furthermore, both mutations seemed to respond similarly to the conditions tested, suggesting that these genes likely impact a common biofilm stimulatory pathway. Further investigation of these and other biofilm formation pathways will be key to the development of alternative strategies to eliminate complicated chronic biofilm infections of P. aeruginosa. ACKNOWLEDGMENTS We thank Michael Taylor for his contribution in creating the transposon mutant library of P. aeruginosa and Seth Winfree at the Indiana Center for Biological Microscopy for assistance with confocal microscopy. S.A.A. also thanks all members of IIE and SRF for their support in her fellowship. This work was funded by a Research Support Funds Grant (RSFG) from IUPUI and PRF from Purdue University to G.G.A.

REFERENCES 1. Fux CA, Costerton JW, Stewart PS, Stoodley P. 2005. Survival strategies of infectious biofilms. Trends Microbiol. 13:34 – 40. http://dx.doi.org/10 .1016/j.tim.2004.11.010. 2. Hoiby N, Ciofu O, Bjarnsholt T. 2010. Pseudomonas aeruginosa biofilms in cystic fibrosis. Future Microbiol. 5:1663–1674. http://dx.doi.org/10 .2217/fmb.10.125. 3. Costerton JW, Stewart PS, Greenberg EP. 1999. Bacterial biofilms: a common cause of persistent infections. Science 284:1318 –1322. http://dx .doi.org/10.1126/science.284.5418.1318. 4. Lizewski SE, Lundberg DS, Schurr MJ. 2002. The transcriptional regulator AlgR is essential for Pseudomonas aeruginosa pathogenesis. Infect. Immun. 70:6083– 6093. http://dx.doi.org/10.1128/IAI.70.11.6083 -6093.2002. 5. Suntres ZE, Omri A, Shek PN. 2002. Pseudomonas aeruginosa-induced lung injury: role of oxidative stress. Microb. Pathog. 32:27–34. http://dx .doi.org/10.1006/mpat.2001.0475. 6. Coggan KA, Wolfgang MC. 2012. Global regulatory pathways and crosstalk control Pseudomonas aeruginosa environmental lifestyle and virulence phenotype. Curr. Issues Mol. Biol. 14:47–70. 7. Macia MD, Blanquer D, Togores B, Sauleda J, Perez JL, Oliver A. 2005. Hypermutation is a key factor in development of multiple-antimicrobial resistance in Pseudomonas aeruginosa strains causing chronic lung infections. Antimicrob. Agents Chemother. 49:3382–3386. http://dx.doi.org /10.1128/AAC.49.8.3382-3386.2005. 8. Mandsberg LF, Ciofu O, Kirkby N, Christiansen LE, Poulsen HE, Hoiby N. 2009. Antibiotic resistance in Pseudomonas aeruginosa strains with increased mutation frequency due to inactivation of the DNA oxidative repair system. Antimicrob. Agents Chemother. 53:2483–2491. http: //dx.doi.org/10.1128/AAC.00428-08. 9. Gotoh H, Zhang Y, Dallo SF, Hong S, Kasaraneni N, Weitao T. 2008. Pseudomonas aeruginosa, under DNA replication inhibition, tends to form biofilms via Arr. Res. Microbiol. 159:294 –302. http://dx.doi.org/10.1016 /j.resmic.2008.02.002. 10. Takahashi A, Yomoda S, Ushijima Y, Kobayashi I, Inoue M. 1995. Ofloxacin, norfloxacin and ceftazidime increase the production of alginate and promote the formation of biofilm of Pseudomonas aeruginosa in vitro. J. Antimicrob. Chemother. 36:743–745. http://dx.doi.org/10.1093 /jac/36.4.743. 11. Simpson JA, Smith SE, Dean RT. 1993. Alginate may accumulate in cystic fibrosis lung because the enzymatic and free radical capacities of phagocytic cells are inadequate for its degradation. Biochem. Mol. Biol. Int. 30:1021–1034. 12. Gangell C, Gard S, Douglas T, Park J, de Klerk N, Keil T, Brennan S, Ranganathan S, Robins-Browne R, Sly PD, Arest CF. 2011. Inflammatory responses to individual microorganisms in the lungs of children with cystic fibrosis. Clin. Infect. Dis. 53:425– 432. http://dx.doi.org/10.1093/cid /cir399.

iai.asm.org 4755

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

mutant strains can alleviate the deleterious effect of hydroxyl radicals and enhance survival under ciprofloxacin treatment (52), although this remains to be tested experimentally. As suggested above, reduced stress might inhibit proper biofilm formation regulation. It has also been shown that pyocyanin promotes virulence by interfering with several cellular functions in host cells related to the production of reactive oxygen species (ROS) and other effects (53). These events lead to reduced nucleotide concentration and enhanced cytosolic redox potential (54). Subsequently, exposure of the cells to an exaggerated oxidative stress exhausts their antioxidant capacity. In our study, this view is further supported by the increased cell death of CFBE cells treated with supernatants from the ⌬polB and ⌬PA14_46880 mutants (Fig. 9B), which suggests that increased pyocyanin secretion in these strains contributes to increased cell injury. Importantly, it has been found that slight increases in the pyocyanin concentration within the range we observed from our strains lead to increased oxidative stress within CFBE cells (54). Furthermore, pyocyanin impacts extracellular DNA (eDNA) release in planktonic cultures of P. aeruginosa through ROS generation, which likely happens as a consequence of bacterial lysis by ROS. This activity has proven to be essential at all stages of biofilm formation (51). In addition, altered pyocyanin production in the ⌬polB and ⌬PA14_46880 strains resulted in dramatically increased cytotoxic effects on airway cells (Fig. 10). Inhibition of toxin production is a key characteristic of P. aeruginosa biofilms (6, 22), especially those in the CF lung, and our data showing increased toxicity further support our conclusions that mutation of polB and PA14_46880 inhibits the transition to a chronic biofilm lifestyle. Notably, the deficiency in binding and biofilm formation on CFBE cells correlates with a slight increase in the number of ⌬polB planktonic cells in the supernatant of mutant biofilms, compared with the WT (see Fig. S9 in the supplemental material). This increase in planktonic surviving cells is associated with increases in the kinetic growth of mutant strains in the MEM, compared with the WT (see Fig. S7 in the supplemental material). Increased planktonic numbers may contribute to the highly toxic effect of the mutant strains toward CFBE cells. Other virulence determinants in addition to pyocyanin may also play a role, and this will be investigated in future studies. Prolonged growth of P. aeruginosa in infections, such as in the CF lung, exposes the bacteria to numerous stresses, and chronic infection bacterial strains accumulate mutations. Many of these mutations occur in DNA repair systems (14–16), which leads to further genotypic variation (8, 13). As a result, these strains become adapted to survive in the stressful niche of CF patient lungs (45). It is likely that replication-inhibiting antibiotics enhance chronic biofilm infections through the SOS response; however, it is possible that SOS response suppression acquired by resistance to DNA-inhibiting antibiotics may also play a role (7, 55). Overall, intact SOS and active DNA repair systems seem to be essential for biofilm formation under drug treatment in P. aeruginosa. Here we have demonstrated that disruption of the polB and PA14_46880 genes led to significant reduction in biofilm formation on plastic and epithelial cells and rendered the cells less susceptible to ciprofloxacin pressure. Chronic P. aeruginosa infection in the CF lung and elsewhere is characterized by a general downregulation of toxins and other factors associated with acute infections, as well as upregulation of biofilm properties (56). Our data

Alshalchi and Anderson

4756

iai.asm.org

32. 33.

34.

35. 36.

37. 38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48. 49.

common mechanism of cellular death induced by bactericidal antibiotics. Cell 130:797– 810. http://dx.doi.org/10.1016/j.cell.2007.06.049. Alm RA, Mattick JS. 1997. Genes involved in the biogenesis and function of type-4 fimbriae in Pseudomonas aeruginosa. Gene 192:89 –98. http://dx .doi.org/10.1016/S0378-1119(96)00805-0. Redelman CV, Chakravarty S, Anderson GG. 2014. Antibiotic treatment of Pseudomonas aeruginosa biofilms stimulates expression of the magnesium transporter gene mgtE. Microbiology 160:165–178. http://dx.doi .org/10.1099/mic.0.070144-0. Essar DW, Eberly L, Hadero A, Crawford IP. 1990. Identification and characterization of genes for a second anthranilate synthase in Pseudomonas aeruginosa: interchangeability of the two anthranilate synthases and evolutionary implications. J. Bacteriol. 172:884 –900. O’Toole GA, Kolter R. 1998. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295–304. http://dx.doi.org/10.1046/j.1365-2958.1998.01062.x. Moreau-Marquis S, Bomberger JM, Anderson GG, Swiatecka-Urban A, Ye S, O’Toole GA, Stanton BA. 2008. The ⌬F508-CFTR mutation results in increased biofilm formation by Pseudomonas aeruginosa by increasing iron availability. Am. J. Physiol. Lung Cell. Mol. Physiol. 295:L25–L37. http://dx.doi.org/10.1152/ajplung.00391.2007. Moreau-Marquis S, Redelman CV, Stanton BA, Anderson GG. 2010. Co-culture models of Pseudomonas aeruginosa biofilms grown on live human airway cells. J. Vis. Exp. 44:e2186. http://dx.doi.org/10.3791/2186. Fleiszig SM, Wiener-Kronish JP, Miyazaki H, Vallas V, Mostov KE, Kanada D, Sawa T, Yen TS, Frank DW. 1997. Pseudomonas aeruginosamediated cytotoxicity and invasion correlate with distinct genotypes at the loci encoding exoenzyme S. Infect. Immun. 65:579 –586. Evans DJ, Frank DW, Finck-Barbancon V, Wu C, Fleiszig SM. 1998. Pseudomonas aeruginosa invasion and cytotoxicity are independent events, both of which involve protein tyrosine kinase activity. Infect. Immun. 66:1453–1459. Garcia-Medina R, Dunne WM, Singh PK, Brody SL. 2005. Pseudomonas aeruginosa acquires biofilm-like properties within airway epithelial cells. Infect. Immun. 73:8298 – 8305. http://dx.doi.org/10.1128/IAI.73.12.8298 -8305.2005. Shan Z, Xu H, Shi X, Yu Y, Yao H, Zhang X, Bai Y, Gao C, Saris PE, Qiao M. 2004. Identification of two new genes involved in twitching motility in Pseudomonas aeruginosa. Microbiology 150:2653–2661. http: //dx.doi.org/10.1099/mic.0.27131-0. Pomposiello PJ, Bennik MH, Demple B. 2001. Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate. J. Bacteriol. 183:3890 –3902. http://dx.doi.org/10.1128 /JB.183.13.3890-3902.2001. Tran L, van Baarsel JA, Washburn RS, Gottesman ME, Miller JH. 2011. Single-gene deletion mutants of Escherichia coli with altered sensitivity to bicyclomycin, an inhibitor of transcription termination factor Rho. J. Bacteriol. 193:2229 –2235. http://dx.doi.org/10.1128/JB.01463-10. Mathee K, Ciofu O, Sternberg C, Lindum PW, Campbell JI, Jensen P, Johnsen AH, Givskov M, Ohman DE, Molin S, Hoiby N, Kharazmi A. 1999. Mucoid conversion of Pseudomonas aeruginosa by hydrogen peroxide: a mechanism for virulence activation in the cystic fibrosis lung. Microbiology 145:1349 –1357. http://dx.doi.org/10.1099/13500872-145-6 -1349. Ciofu O, Riis B, Pressler T, Poulsen HE, Hoiby N. 2005. Occurrence of hypermutable Pseudomonas aeruginosa in cystic fibrosis patients is associated with the oxidative stress caused by chronic lung inflammation. Antimicrob. Agents Chemother. 49:2276 –2282. http://dx.doi.org/10.1128 /AAC.49.6.2276-2282.2005. Price-Whelan A, Dietrich LE, Newman DK. 2007. Pyocyanin alters redox homeostasis and carbon flux through central metabolic pathways in Pseudomonas aeruginosa PA14. J. Bacteriol. 189:6372– 6381. http://dx.doi.org /10.1128/JB.00505-07. Kang WK, Icho T, Isono S, Kitakawa M, Isono K. 1989. Characterization of the gene rimK responsible for the addition of glutamic acid residues to the C-terminus of ribosomal protein S6 in Escherichia coli K12. Mol. Gen. Genet. 217:281–288. http://dx.doi.org/10.1007/BF02464894. Drlica K, Zhao X. 1997. DNA gyrase, topoisomerase IV, and the 4-quinolones. Microbiol. Mol. Biol. Rev. 61:377–392. Lizewski SE, Schurr JR, Jackson DW, Frisk A, Carterson AJ, Schurr MJ. 2004. Identification of AlgR-regulated genes in Pseudomonas aeruginosa by use of microarray analysis. J. Bacteriol. 186:5672–5684. http://dx.doi .org/10.1128/JB.186.17.5672-5684.2004.

Infection and Immunity

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

13. Conibear TC, Collins SL, Webb JS. 2009. Role of mutation in Pseudomonas aeruginosa biofilm development. PLoS One 4:e6289. http://dx.doi.org /10.1371/journal.pone.0006289. 14. Kivisaar M. 2010. Mechanisms of stationary-phase mutagenesis in bacteria: mutational processes in pseudomonads. FEMS Microbiol. Lett. 312: 1–14. http://dx.doi.org/10.1111/j.1574-6968.2010.02027.x. 15. Oliver A, Baquero F, Blazquez J. 2002. The mismatch repair system (mutS, mutL and uvrD genes) in Pseudomonas aeruginosa: molecular characterization of naturally occurring mutants. Mol. Microbiol. 43: 1641–1650. http://dx.doi.org/10.1046/j.1365-2958.2002.02855.x. 16. Oliver A, Sanchez JM, Blazquez J. 2002. Characterization of the GO system of Pseudomonas aeruginosa. FEMS Microbiol. Lett. 217:31–35. http://dx.doi.org/10.1111/j.1574-6968.2002.tb11452.x. 17. Winsor GL, Lam DK, Fleming L, Lo R, Whiteside MD, Yu NY, Hancock RE, Brinkman FS. 2011. Pseudomonas Genome Database: improved comparative analysis and population genomics capability for Pseudomonas genomes. Nucleic Acids Res. 39(Suppl 1):D596 –D600. http://dx.doi .org/10.1093/nar/gkq869. 18. Simon R, Quandt J, Klipp W. 1989. New derivatives of transposon Tn5 suitable for mobilization of replicons, generation of operon fusions and induction of genes in Gram-negative bacteria. Gene 80:161–169. http://dx .doi.org/10.1016/0378-1119(89)90262-X. 19. O’Toole GA, Pratt LA, Watnick PI, Newman DK, Weaver VB, Kolter R. 1999. Genetic approaches to study of biofilms. Methods Enzymol. 310:91– 109. http://dx.doi.org/10.1016/S0076-6879(99)10008-9. 20. Anderson GG, Moreau-Marquis S, Stanton BA, O’Toole GA. 2008. In vitro analysis of tobramycin-treated Pseudomonas aeruginosa biofilms on cystic fibrosis-derived airway epithelial cells. Infect. Immun. 76:1423– 1433. http://dx.doi.org/10.1128/IAI.01373-07. 21. Shanks RM, Caiazza NC, Hinsa SM, Toutain CM, O’Toole GA. 2006. Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from Gram-negative bacteria. Appl. Environ. Microbiol. 72:5027– 5036. http://dx.doi.org/10.1128/AEM.00682-06. 22. Kuchma SL, Connolly JP, O’Toole GA. 2005. A three-component regulatory system regulates biofilm maturation and type III secretion in Pseudomonas aeruginosa. J. Bacteriol. 187:1441–1454. http://dx.doi.org/10 .1128/JB.187.4.1441-1454.2005. 23. Su S, Panmanee W, Wilson JJ, Mahtani HK, Li Q, Vanderwielen BD, Makris TM, Rogers M, McDaniel C, Lipscomb JD, Irvin RT, Schurr MJ, Lancaster JR, Jr, Kovall RA, Hassett DJ. 2014. Catalase (KatA) plays a role in protection against anaerobic nitric oxide in Pseudomonas aeruginosa. PLoS One 9:e91813. http://dx.doi.org/10.1371/journal.pone .0091813. 24. Ma L, Jackson KD, Landry RM, Parsek MR, Wozniak DJ. 2006. Analysis of Pseudomonas aeruginosa conditional psl variants reveals roles for the psl polysaccharide in adhesion and maintaining biofilm structure postattachment. J. Bacteriol. 188:8213– 8221. http://dx.doi.org/10.1128 /JB.01202-06. 25. O’Toole GA, Kolter R. 1998. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol. Microbiol. 28:449 – 461. http://dx.doi .org/10.1046/j.1365-2958.1998.00797.x. 26. Bruscia E, Sangiuolo F, Sinibaldi P, Goncz KK, Novelli G, Gruenert DC. 2002. Isolation of CF cell lines corrected at DeltaF508-CFTR locus by SFHR-mediated targeting. Gene Ther. 9:683– 685. http://dx.doi.org/10 .1038/sj.gt.3301741. 27. Fleiszig SM, Zaidi TS, Preston MJ, Grout M, Evans DJ, Pier GB. 1996. Relationship between cytotoxicity and corneal epithelial cell invasion by clinical isolates of Pseudomonas aeruginosa. Infect. Immun. 64:2288 – 2294. 28. Pukatzki S, Kessin RH, Mekalanos JJ. 2002. The human pathogen Pseudomonas aeruginosa utilizes conserved virulence pathways to infect the social amoeba Dictyostelium discoideum. Proc. Natl. Acad. Sci. U. S. A. 99:3159 –3164. http://dx.doi.org/10.1073/pnas.052704399. 29. Bloemberg GV, O’Toole GA, Lugtenberg BJ, Kolter R. 1997. Green fluorescent protein as a marker for Pseudomonas spp. Appl. Environ. Microbiol. 63:4543– 4551. 30. Choi H, Lee DG. 2012. Antimicrobial peptide pleurocidin synergizes with antibiotics through hydroxyl radical formation and membrane damage and exerts antibiofilm activity. Biochim. Biophys. Acta 1820:1831–1838. http://dx.doi.org/10.1016/j.bbagen.2012.08.012. 31. Kohanski MA, Dwyer DJ, Hayete B, Lawrence CA, Collins JJ. 2007. A

Stress Genes in P. aeruginosa Biofilm

November 2014 Volume 82 Number 11

lial cells. Free Radic. Biol. Med. 45:1653–1662. http://dx.doi.org/10.1016 /j.freeradbiomed.2008.09.011. 55. Gotoh H, Kasaraneni N, Devineni N, Dallo SF, Weitao T. 2010. SOS involvement in stress-inducible biofilm formation. Biofouling 26:603– 611. http://dx.doi.org/10.1080/08927014.2010.501895. 56. Rowen DW, Deretic V. 2000. Membrane-to-cytosol redistribution of ECF sigma factor AlgU and conversion to mucoidy in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Mol. Microbiol. 36:314 – 327. http://dx.doi.org/10.1046/j.1365-2958.2000.01830.x. 57. Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, Brinkman FS, Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL, Goltry L, Tolentino E, Westbrock-Wadman S, Yuan Y, Brody LL, Coulter SN, Folger KR, Kas A, Larbig K, Lim R, Smith K, Spencer D, Wong GK, Wu Z, Paulsen IT, Reizer J, Saier MH, Hancock RE, Lory S, Olson MV. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406:959 –964. http://dx.doi.org /10.1038/35023079.

iai.asm.org 4757

Downloaded from http://iai.asm.org/ on April 2, 2015 by UNIV OF MONTANA

50. Dietrich LE, Price-Whelan A, Petersen A, Whiteley M, Newman DK. 2006. The phenazine pyocyanin is a terminal signalling factor in the quorum sensing network of Pseudomonas aeruginosa. Mol. Microbiol. 61: 1308 –1321. http://dx.doi.org/10.1111/j.1365-2958.2006.05306.x. 51. Das T, Manefield M. 2012. Pyocyanin promotes extracellular DNA release in Pseudomonas aeruginosa. PLoS One 7:e46718. http://dx.doi.org/10 .1371/journal.pone.0046718. 52. Hassett DJ, Schweizer HP, Ohman DE. 1995. Pseudomonas aeruginosa sodA and sodB mutants defective in manganese- and iron-cofactored superoxide dismutase activity demonstrate the importance of the ironcofactored form in aerobic metabolism. J. Bacteriol. 177:6330 – 6337. 53. Rada B, Leto TL. 2013. Pyocyanin effects on respiratory epithelium: relevance in Pseudomonas aeruginosa airway infections. Trends Microbiol. 21:73– 81. http://dx.doi.org/10.1016/j.tim.2012.10.004. 54. Schwarzer C, Fischer H, Kim EJ, Barber KJ, Mills AD, Kurth MJ, Gruenert DC, Suh JH, Machen TE, Illek B. 2008. Oxidative stress caused by pyocyanin impairs CFTR Cl(⫺) transport in human bronchial epithe-