Carcinogenesis vol.13 no.2 pp.289-296, 1992
Isolation and characterization of cDNA and genomic sequences for mouse C^-methylguanine-DNA methyltransferase
Akiko Shiraishi, Kunihiko Sakumi, Yoshimichi Nakatsu, Hiroshi Hayakawa and Mutsuo Sekiguchi1 Department of Biochemistry, Faculty of Medicine and the Medical Institute of Bioregulation, Kyushu University, Fukuoka 812, Japan 'To whom correspondence should be addressed
Materials and methods Introduction Alkylation of DNA at the Opposition of guanine is regarded as one of the most critical events leading to induction of mutations and cancers in organisms (1,2). Once C^-methylguanine is formed, it can pair with thymine during DNA replication, the result being a conversion of the guanine—cytosine to the adenine—thymine pair in DNA (3). Such mutations are often found in DNA sequences of organisms exposed to relatively low doses of alkylating agents (4), and it has been demonstrated that mammary tumors of rats, induced by injection of methylnitrosourea (MNU), carry this type of mutation in the Haras-l gene (5). To counteract such effects, organisms possess a mechanism to repair O6-methylguanine in DNA (6). An enzyme, O6methylguanine-DNA methyltransferase, is present in various organisms, from bacteria to human cells, and appears to be responsible for preventing the occurrence of such mutations. The enzyme transfers methyl groups from C^-methylguanine and other methylated moieties of the DNA to its own molecule, thereby repairing DNA lesions in a single-step reaction (7). The roles of C^-methylguanine-DNA methyltransferase in preserving genetic information have been studied extensively, •Abbreviations: MNU, methylnitrosourea; MNNG, yV-methyl-Af'-nitro-/Vnitrosoguanidine
Chemicals [a-32P]dCTP (3000 Ci/mmol), [7-32P]ATP (5000 Ci/mmol) and [a-32P]CTP (800 Ci/mmol) were obtained from Amersham International. [3H]MNU (17.7 Ci/mmol) was purchased from Amersham Japan. Restriction endonucleases, the Klenow fragment of DNA polymerase I, T4 DNA ligase and bacterial alkaline phosphatase were obtained from Takara Shuzo Co. (Kyoto) and Toyobo Co. (Osaka). RNA size standards were obtained from Betnesda Research Laboratories. A random-primed DNA labeling kit was obtained from Wako Pure Chemicals (Osaka). Oligonucleotides were synthesized using an Applied Biosystems model 381A DNA synthesizer. 25 x blot wash is 0.3 M Na2HPO4/0.2 M NaH2PO4/0.034 M sodium pyrophosphate/1.25% SDS. 2 x SSCB is a 1:1 mixture of 4 x SSC and 2 x blot wash. 1 x SSC is 0.15 M NaCI/0.015 M sodium citrate. The 1 x Denhardt's solution we used was composed of 0.02% FicoU, 0.02% poryvinylpyrrolidone and 0.02% bovine serum albumin. 20 x SSPE is 3 M NaCl/0.2 M NaH2PO4/0.02 M NajEDTA. Bacterial strains and plasmids Cosmid pHC79 (T^ ApO and plasmid pUC18 were used as cloning vectors. pcDL81 was used as an expression vector in mammalian cells. This plasmid has multiple cloning sites downstream of the SRa promoter (18) and was obtained from K.Shimizu in our laboratory. E.coli 490A (rk~, m{~, met', thr~, leu", recA') and DH5a (supEM, AlacUim.90lacZAMl5), hsdRtf, recAl, endA\, gyrA96, thi-l, relAl) were used as host cells. The mouse liver cDNA library was purchased from Clontech (ML1017a). Cells and cell culture BALB/c 3T3 and NIH 3T3 are mouse fibroblast cell lines. HeLa MR cells are methyhransferase-deficient (19). The cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% horse serum. Mouse embryonic stem cell line D3 was obtained from M.Katsuki of Tokai University.
289
Downloaded from http://carcin.oxfordjournals.org/ at UQ Library on July 13, 2015
An enzyme, O'-methylguanine-DNA methyltransferase, is present in various organisms and plays an important role in repair of DNA damaged by alkylating agents. The enzyme transfers methyl groups from (r-methylguanine and other methylated moieties of the DNA to its own molecule. As a first step to construct animal models with altered levels of the enzyme activity, we cloned cDNA and genomic DNA sequences for mouse methyltransferase and elucidated their structures. The nucleotide sequence of the cDNA revealed an open reading frame comprising 211 amino acid residues. The mol. wt of mouse O^-methylguanine-DNA methyltransferase, calculated from the predicted amino acid sequence, was 22 400, and the methyltransferase protein of this size was present when the cDNA was expressed in methyltransferasedeficient human cells. The predicted amino acid sequence of the mouse methyltransferase exhibits an intense homology with those of human and bacterial counterparts. Using the cDNA as a probe, part of the mouse gene for methyltransferase was isolated. The gene consisted of at least four exons and spanned > 145 kb. Sequences around the exon/intron junctions for the mouse gene are almost the same as those for the human species.
using Escherichia coli (8,9). This organism possesses two types of methyltransferase proteins, one being constitutive and the other inducible by brief treatment of cells with alkylating agents, and these are coded by the ogt and the ada genes respectively (10—13). Mutant cells defective in both of the genes show an increased sensitivity to alkylating agents and produce more mutations when exposed to low levels of TV-methyl-W-nitro-./v'nitrosoguanidine (MNNG) (14). To elucidate the roles of methyltransferases in preventing cancers, it is necessary to construct animal models with altered levels of the enzyme activity. The ada gene of E.coli, coding for bacterial methyltransferase, was introduced into mouse germ cells, and transgenic mice carrying the foreign methyltransferase gene with functional promoters were developed (15—17). Such mice had higher levels of methyltransferase activity and are potentially useful for investigating the role of methyltransferase in chemical-induced carcinogenesis. An even more definite answer regarding this problem may be obtained if mice defective in their own methyltransferase gene were available. It is of interest to determine whether frequencies of occurrence of tumors would increase in such mice, exposed or not exposed to the alkylating agents. To achieve this, it is necessary to isolate and characterize the mouse genomic sequence for the methyltransferase, and this we did in the present study. We cloned the cDNA for mouse methyltransferase and, using the cDNA as a probe, we isolated part of the genomic DNA sequences.
A.ShiraisbJ et al.
Analysis of the RNA product Antisense RNA of M-3 was synthesized by T3 RNA polymerase in the presence of [32P]CTP and NTPs. Total cellular RNA (15 /ig) was hybridized to antisense RNA probe (5 x 105 c.p.m.) and subjected to RNase protection analysis. As controls, tRNA (10 /ig) or sense RNA transcript (50 pg) from M-3 was annealed to this probe. After unhybridized RNAs were removed by digestion with RNase A and Tl, the nuclease-resistant probe was analyzed on 6% sequencing gels. /4/wI-digested pBR322 DNA was used as a marker. Poly(A)+ RNA was prepared from total RNA isolated from BALB/c 3T3 cells and D3 cells by the guanidinium thiocyanate/CsCI method (21), followed by adsorption to Oligo(dT) - Latex (Roche). Poly(A)+ RNA (2 fjg) was separated on 1.2% agarose gels containing 20 mM 3-{N-morpholino)propanesulfonic acid, 5 mM sodium acetate, 1 mM Na2 EDTA and 700 mM formaldehyde and transferred onto nitrocellulose membrane (BA85, Schleicher and Schuell) in 20 x SSC. This membrane was hybridized with the mouse methyltransferase cDNA (M-3) at 65°C in 5 x SSPE/5 x Denhardt's solution/1.0% SDS/150 ^g/ml heat-denatured salmon sperm DNA and finally washed in 0.2 x SSCB at 65°C. Expression of the mouse cDNA in human cells A 0.8 kb Noll—Kpril fragment carrying the mouse methyltransferase cDNA was excised from clone M-3 and inserted into the Notl-Kpnl site of pcDL81. The
I
construct was named pcDNK0.8. pcHMW, carrying the human methyltransferase cDNA in pcDLSl, was provided by Chueh Ling-Ling of our laboratory. Plasmid DNAs were purified by two cycles of CsCl gradient centrifugation. HeLa MR cells were plated in 15 cm dishes (1 x 106 cells/dish) and incubated for 24 h prior to transfection. For transfection, 50 ;tg of the DNA was applied to each dish according to the method of Chen and Okayama (22). After incubation for 3 days, the cells were harvested and suspended in 1 ml of 20 mM Tns-HCl (pH 8.5)/l mM Naj EDTA/1 mM mercaptoethanol/5% (v/v) glycerol. After sonication, the supernatant was taken as a crude extract. The extract containing 75 fig protein was incubated at 37°C for 15 min with [3H]MNU-treated calf thymus DNA (12). The reaction mixture was boiled for 3 min in the presence of 5% 2-mercaptoethanol, 2 3% SDS, 10% glycerol and 62.5 mM Tris-HCl (pH 6.8), and applied to 14% poh/acrylarrude gels containing SDS. Electrophoresis was carried out al 20 mA for 1 h and the gels were fixed, treated with ENLIGHTNING solution (NEN), dried and subjected to tluorography. Methyltransferase activity was assayed as described elsewhere (20). Southern blot analysis High mol. wt DNAs (10 /ig) were prepared from cells and completely digested with restriction endonucleases. The fragments were separated on 1 % agarose gels and blotted onto nylon membrane (Hybond-N+, Amersham) in 0.4 N NaOH. Hybridization conditions were the same as those used for Northern blot analysis. 1 GCTCAGGCACCTAAAACTTGTGTACCGTTCCCCGTTGCTGTCTGCAGTTT 51 GCAAGCTGGAACTTGGCAGA 71 ATG GCT GAG ACC TGC AAA ATG AAA TAC TCA GTG TTG GAC 1 Met Ala Glu Thr Cys Ly3 Met Ly3 Tyr Ser Val Leu Asp 110 AGC CCT TTG GGG AAG ATG GAG CTG TCT GGC TGT GAG CGA 14 Ser Pro Leu Gly Lys Met Glu Leu Ser Gly Cys Glu Arg 149 GGC CTG CAT GGG ATA CGG TTG CTC AGT GGG AAG ACC CCA 27 Gly Leu Hi3 Gly lie Arg Leu Leu Ser Gly Lys Thr Pro 188 AAC ACT GAC CCC ACA GAG GCC CCA GCT ACT CCT GAG GTG 40 Asn Thr Asp Pro Thr Glu Ala Pro Ala Thr Pro Glu Val 227 CTC GGT GGG CCA GAG GGA GTT CCA GAG CCT CTG GTG CAG 53 Leu Gly Gly Pro Glu Gly Val Pro Glu Pro Leu Val Gin 266 TGC ACA GCC TGG CTG GAA GCC TAT TTC CGT GAA CCC GCA 66 Cys Thr Ala Trp Leu Glu Ala Tyr Phe Arg Glu Pro Ala 305 GCC ACA GAG GGG CTT CCC TTG CCT GCT CTC CAT CAC CCT 79 Ala Thr Glu Gly Leu Pro Leu Pro Ala Leu His His Pro 344 GTG TTC CAG CAA GAT TCA TTC ACC AGA CAG GTG TTA TGG 92 Val Phe Gin Gin Asp Ser Phe Thr Arg Gin Val Leu Trp 383 AAG CTG CTG AAG GTT GTG AAA TTC GGA GAA ACG GTT TCT 105 Lys Leu Leu Lys Val Val Lys Phe Gly Glu Thr Val Ser 4 22 TAC CAG CAA TTA GCA GCC CTG GCA GGC AAC CCC AAA GCG 118 Tyr Gin Gin Leu Ala Ala Leu Ala Gly A3n Pro Lys Ala
\
4 61 GCT CGT GCA GTA GGA GGA GCA ATG AGA AGC AAT CCG GTC 131 Ala Arg Ala Val Gly Gly Ala Met Arg Ser Asn Pro Val M-1 M-2 M-3
500 CCC ATC CTC ATC CCC TGC CAC AGG GTG GTT CGC AGT GAC 144 Pro lie Leu H e Pro Cys Hi3 Arg Val Val Arg Ser Asp 539 GGT GCC ATC GGC CAT TAC TCC GGA GGA GGG CAG GCT GTG 157 Gly Ala H e Gly His Tyr Ser Gly Gly Gly Gin Ala Val 578 AAG GAG TGG CTT CTG GCC CAT GAG GGC ATC CCG ACC GGA 170 Lys Glu Trp Leu Leu Ala His Glu Gly H e Pro Thr Gly 617 CAG CCA GCC TCC AAG GGC TTG GGT CTG ACT GGG ACC TGG 183 Gin Pro Ala Ser Lys Gly Leu Gly Leu Thr Gly Thr Trp 656 CTC AAG TCA TCC TTC GAG TCG ACC AGC TCT GAG CCG TCT 196 Leu Lys Ser Ser Phe Glu Ser Thr Ser Ser Glu Pro Ser 695 GGC CGA AAT TGA 209 Gly Arg Asn END
Fig. 1. Organization of the cDNA and strategy for DNA sequencing. The upper panel shows organization of the cDNA with appropriate restriction sites. Closed and open boxes indicate the coding and the non-coding regions respectively. The regions carried by clone M-l, M-2 and M-3 are shown by solid bars. The lower half shows the strategy used for DNA sequencing. Horizontal arrows show the directions and the regions of the sequence analyzed.
290
7 07 GTAACCGTTTGAATGACACATAGATGTAACGCGTGTCGGAAGCGGATGTG 7 57 TGGTGGCACCACTATATTAAAAGAGCTGCAAGTGTCCTGGGGGAAAAAAA 807 AAAAAAAAAAAAAAAAAAAAAAA Fig. 2. Nucleotide sequence of the cDNA for mouse fAmethylguanineDNA methyltransferase and the deduced amino acid sequence. The sequence underlined was used as a primer to construct the second cDNA library. The vector and adaptor sequences are not included.
Downloaded from http://carcin.oxfordjournals.org/ at UQ Library on July 13, 2015
Construction and screening of the cDNA libraries A mouse liver cDNA XgtlO library (4 x 103 plaques) was screened by using as a probe a 670 bp EcoTlWPmaCl fragment derived from pUC9MGMT (20). This probe contained the entire coding region for human methyltransferase and was labeled by the random-primed method. Prehybridization and hybridization were carried out at 42°C in a solution containing 6 x SSC, 5 x Denhardt's solution, 1 % SDS, 40% formamide and 50 fig/ml heat-denatured salmon sperm DNA. Nitrocellulose membranes (Millipore) were washed twice in 1 x SSCB at 65°C and autoradiographed on Fuji RX film at -80°C with an intensifying screen. To obtain the 5'-extended region of cDNA, a cDNA library was constructed using a specific primer. Messenger RNA was prepared from BALB/c 3T3 cells and used as a template for cDNA synthesis, which was primed with a synthetic oligonucleotide complementary to bases 368—387 of the mouse methyhransferase cDNA (underlined in Figure 2). These cDNA fragments were ligated to EcoRVNoA adaptors and inserted into the EcoRl site of pl)C18. This library was screened using as a probe an EcoRl fragment of the previously isolated mouse methyltransferase cDNA clone (M-l). Prehybridization and hybridization were performed at 42°C in 4 x SSC/5 x Denhardt's solution/1% SDS/50% formamide/50/jg/ml heatdenatured salmon sperm DNA. Membranes were washed at 65°C once in 2 x SSCB and once in 0.2 x SSCB. One clone that gave a positive signal was isolated and named M-2. From clone M-2 a 195 bp £co81I fragment carrying the 5' portion of cDNA was excised and ligated to the £co81I fragment of clone M-l. This composite mouse methyltransferase cDNA was inserted into the EcoRl site of pBSKS(-) (Stratagene) and named M-3.
Mouse methyttransferase gene Construction and screening of genomic library High mol. wt DNAs from BALB/c 3T3 cells were partially digested with BamHl and fractionated by sucrose-gradient centrifugation. Fragments of 35 - 4 5 kb were collected and inserted into the ftjmHI she of cosmid pHC79. They were packaged in vitro with packaging extracts (Gigapack Plus, Stratagene). Titer of the constructed genomic library was 1 x l(r c.f.u.//ig. Cosmid-infected Ecoli 490A cells were subjected to colony hybridization with a mouse cDNA fragment as a probe. Prehybridization and hybridization were performed at 42°C in 4 x SSC/5 x Denhardt's solution/1% SDS/50% formamide/50/jg/ml heatdenatured salmon sperm DNA. Final wash was made at 65"C in 0.2 x SSCB.
0»M)
908
- .
659 656 521
DNA sequencing cDNA and genomic DNA were digested with restriction enzymes and the resulting fragments were subcloned into pUC18. The inserts were sequenced using a Genesis 2000 (Dupont) automatic sequencer.
403
257
226
B
1
7.5
Expression of the mouse cDNA in methyltransferase-deficient human cells For expression of the mouse cDNA in mammalian cells, M-3 cDNA was placed downstream of the strong promoter SRa (18) in pcDL81 and the construct was termed pcDNKO.8 (Figure 4A). pcDNK0.8 was transfected into HeLa MR cells devoid of methyltransferase activity (19). Three days after transfection, cells were harvested to determine the methyltransferase activity. As shown in Figure 4(B), cells carrying pcDNK0.8 exhibited a high
2
>
4.4 > '
Isolation and characterization of cDNA and genomic sequences for mouse C^-methylguanine-DNA methyltransferase
Akiko Shiraishi, Kunihiko Sakumi, Yoshimichi Nakatsu, Hiroshi Hayakawa and Mutsuo Sekiguchi1 Department of Biochemistry, Faculty of Medicine and the Medical Institute of Bioregulation, Kyushu University, Fukuoka 812, Japan 'To whom correspondence should be addressed
Materials and methods Introduction Alkylation of DNA at the Opposition of guanine is regarded as one of the most critical events leading to induction of mutations and cancers in organisms (1,2). Once C^-methylguanine is formed, it can pair with thymine during DNA replication, the result being a conversion of the guanine—cytosine to the adenine—thymine pair in DNA (3). Such mutations are often found in DNA sequences of organisms exposed to relatively low doses of alkylating agents (4), and it has been demonstrated that mammary tumors of rats, induced by injection of methylnitrosourea (MNU), carry this type of mutation in the Haras-l gene (5). To counteract such effects, organisms possess a mechanism to repair O6-methylguanine in DNA (6). An enzyme, O6methylguanine-DNA methyltransferase, is present in various organisms, from bacteria to human cells, and appears to be responsible for preventing the occurrence of such mutations. The enzyme transfers methyl groups from C^-methylguanine and other methylated moieties of the DNA to its own molecule, thereby repairing DNA lesions in a single-step reaction (7). The roles of C^-methylguanine-DNA methyltransferase in preserving genetic information have been studied extensively, •Abbreviations: MNU, methylnitrosourea; MNNG, yV-methyl-Af'-nitro-/Vnitrosoguanidine
Chemicals [a-32P]dCTP (3000 Ci/mmol), [7-32P]ATP (5000 Ci/mmol) and [a-32P]CTP (800 Ci/mmol) were obtained from Amersham International. [3H]MNU (17.7 Ci/mmol) was purchased from Amersham Japan. Restriction endonucleases, the Klenow fragment of DNA polymerase I, T4 DNA ligase and bacterial alkaline phosphatase were obtained from Takara Shuzo Co. (Kyoto) and Toyobo Co. (Osaka). RNA size standards were obtained from Betnesda Research Laboratories. A random-primed DNA labeling kit was obtained from Wako Pure Chemicals (Osaka). Oligonucleotides were synthesized using an Applied Biosystems model 381A DNA synthesizer. 25 x blot wash is 0.3 M Na2HPO4/0.2 M NaH2PO4/0.034 M sodium pyrophosphate/1.25% SDS. 2 x SSCB is a 1:1 mixture of 4 x SSC and 2 x blot wash. 1 x SSC is 0.15 M NaCI/0.015 M sodium citrate. The 1 x Denhardt's solution we used was composed of 0.02% FicoU, 0.02% poryvinylpyrrolidone and 0.02% bovine serum albumin. 20 x SSPE is 3 M NaCl/0.2 M NaH2PO4/0.02 M NajEDTA. Bacterial strains and plasmids Cosmid pHC79 (T^ ApO and plasmid pUC18 were used as cloning vectors. pcDL81 was used as an expression vector in mammalian cells. This plasmid has multiple cloning sites downstream of the SRa promoter (18) and was obtained from K.Shimizu in our laboratory. E.coli 490A (rk~, m{~, met', thr~, leu", recA') and DH5a (supEM, AlacUim.90lacZAMl5), hsdRtf, recAl, endA\, gyrA96, thi-l, relAl) were used as host cells. The mouse liver cDNA library was purchased from Clontech (ML1017a). Cells and cell culture BALB/c 3T3 and NIH 3T3 are mouse fibroblast cell lines. HeLa MR cells are methyhransferase-deficient (19). The cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% horse serum. Mouse embryonic stem cell line D3 was obtained from M.Katsuki of Tokai University.
289
Downloaded from http://carcin.oxfordjournals.org/ at UQ Library on July 13, 2015
An enzyme, O'-methylguanine-DNA methyltransferase, is present in various organisms and plays an important role in repair of DNA damaged by alkylating agents. The enzyme transfers methyl groups from (r-methylguanine and other methylated moieties of the DNA to its own molecule. As a first step to construct animal models with altered levels of the enzyme activity, we cloned cDNA and genomic DNA sequences for mouse methyltransferase and elucidated their structures. The nucleotide sequence of the cDNA revealed an open reading frame comprising 211 amino acid residues. The mol. wt of mouse O^-methylguanine-DNA methyltransferase, calculated from the predicted amino acid sequence, was 22 400, and the methyltransferase protein of this size was present when the cDNA was expressed in methyltransferasedeficient human cells. The predicted amino acid sequence of the mouse methyltransferase exhibits an intense homology with those of human and bacterial counterparts. Using the cDNA as a probe, part of the mouse gene for methyltransferase was isolated. The gene consisted of at least four exons and spanned > 145 kb. Sequences around the exon/intron junctions for the mouse gene are almost the same as those for the human species.
using Escherichia coli (8,9). This organism possesses two types of methyltransferase proteins, one being constitutive and the other inducible by brief treatment of cells with alkylating agents, and these are coded by the ogt and the ada genes respectively (10—13). Mutant cells defective in both of the genes show an increased sensitivity to alkylating agents and produce more mutations when exposed to low levels of TV-methyl-W-nitro-./v'nitrosoguanidine (MNNG) (14). To elucidate the roles of methyltransferases in preventing cancers, it is necessary to construct animal models with altered levels of the enzyme activity. The ada gene of E.coli, coding for bacterial methyltransferase, was introduced into mouse germ cells, and transgenic mice carrying the foreign methyltransferase gene with functional promoters were developed (15—17). Such mice had higher levels of methyltransferase activity and are potentially useful for investigating the role of methyltransferase in chemical-induced carcinogenesis. An even more definite answer regarding this problem may be obtained if mice defective in their own methyltransferase gene were available. It is of interest to determine whether frequencies of occurrence of tumors would increase in such mice, exposed or not exposed to the alkylating agents. To achieve this, it is necessary to isolate and characterize the mouse genomic sequence for the methyltransferase, and this we did in the present study. We cloned the cDNA for mouse methyltransferase and, using the cDNA as a probe, we isolated part of the genomic DNA sequences.
A.ShiraisbJ et al.
Analysis of the RNA product Antisense RNA of M-3 was synthesized by T3 RNA polymerase in the presence of [32P]CTP and NTPs. Total cellular RNA (15 /ig) was hybridized to antisense RNA probe (5 x 105 c.p.m.) and subjected to RNase protection analysis. As controls, tRNA (10 /ig) or sense RNA transcript (50 pg) from M-3 was annealed to this probe. After unhybridized RNAs were removed by digestion with RNase A and Tl, the nuclease-resistant probe was analyzed on 6% sequencing gels. /4/wI-digested pBR322 DNA was used as a marker. Poly(A)+ RNA was prepared from total RNA isolated from BALB/c 3T3 cells and D3 cells by the guanidinium thiocyanate/CsCI method (21), followed by adsorption to Oligo(dT) - Latex (Roche). Poly(A)+ RNA (2 fjg) was separated on 1.2% agarose gels containing 20 mM 3-{N-morpholino)propanesulfonic acid, 5 mM sodium acetate, 1 mM Na2 EDTA and 700 mM formaldehyde and transferred onto nitrocellulose membrane (BA85, Schleicher and Schuell) in 20 x SSC. This membrane was hybridized with the mouse methyltransferase cDNA (M-3) at 65°C in 5 x SSPE/5 x Denhardt's solution/1.0% SDS/150 ^g/ml heat-denatured salmon sperm DNA and finally washed in 0.2 x SSCB at 65°C. Expression of the mouse cDNA in human cells A 0.8 kb Noll—Kpril fragment carrying the mouse methyltransferase cDNA was excised from clone M-3 and inserted into the Notl-Kpnl site of pcDL81. The
I
construct was named pcDNK0.8. pcHMW, carrying the human methyltransferase cDNA in pcDLSl, was provided by Chueh Ling-Ling of our laboratory. Plasmid DNAs were purified by two cycles of CsCl gradient centrifugation. HeLa MR cells were plated in 15 cm dishes (1 x 106 cells/dish) and incubated for 24 h prior to transfection. For transfection, 50 ;tg of the DNA was applied to each dish according to the method of Chen and Okayama (22). After incubation for 3 days, the cells were harvested and suspended in 1 ml of 20 mM Tns-HCl (pH 8.5)/l mM Naj EDTA/1 mM mercaptoethanol/5% (v/v) glycerol. After sonication, the supernatant was taken as a crude extract. The extract containing 75 fig protein was incubated at 37°C for 15 min with [3H]MNU-treated calf thymus DNA (12). The reaction mixture was boiled for 3 min in the presence of 5% 2-mercaptoethanol, 2 3% SDS, 10% glycerol and 62.5 mM Tris-HCl (pH 6.8), and applied to 14% poh/acrylarrude gels containing SDS. Electrophoresis was carried out al 20 mA for 1 h and the gels were fixed, treated with ENLIGHTNING solution (NEN), dried and subjected to tluorography. Methyltransferase activity was assayed as described elsewhere (20). Southern blot analysis High mol. wt DNAs (10 /ig) were prepared from cells and completely digested with restriction endonucleases. The fragments were separated on 1 % agarose gels and blotted onto nylon membrane (Hybond-N+, Amersham) in 0.4 N NaOH. Hybridization conditions were the same as those used for Northern blot analysis. 1 GCTCAGGCACCTAAAACTTGTGTACCGTTCCCCGTTGCTGTCTGCAGTTT 51 GCAAGCTGGAACTTGGCAGA 71 ATG GCT GAG ACC TGC AAA ATG AAA TAC TCA GTG TTG GAC 1 Met Ala Glu Thr Cys Ly3 Met Ly3 Tyr Ser Val Leu Asp 110 AGC CCT TTG GGG AAG ATG GAG CTG TCT GGC TGT GAG CGA 14 Ser Pro Leu Gly Lys Met Glu Leu Ser Gly Cys Glu Arg 149 GGC CTG CAT GGG ATA CGG TTG CTC AGT GGG AAG ACC CCA 27 Gly Leu Hi3 Gly lie Arg Leu Leu Ser Gly Lys Thr Pro 188 AAC ACT GAC CCC ACA GAG GCC CCA GCT ACT CCT GAG GTG 40 Asn Thr Asp Pro Thr Glu Ala Pro Ala Thr Pro Glu Val 227 CTC GGT GGG CCA GAG GGA GTT CCA GAG CCT CTG GTG CAG 53 Leu Gly Gly Pro Glu Gly Val Pro Glu Pro Leu Val Gin 266 TGC ACA GCC TGG CTG GAA GCC TAT TTC CGT GAA CCC GCA 66 Cys Thr Ala Trp Leu Glu Ala Tyr Phe Arg Glu Pro Ala 305 GCC ACA GAG GGG CTT CCC TTG CCT GCT CTC CAT CAC CCT 79 Ala Thr Glu Gly Leu Pro Leu Pro Ala Leu His His Pro 344 GTG TTC CAG CAA GAT TCA TTC ACC AGA CAG GTG TTA TGG 92 Val Phe Gin Gin Asp Ser Phe Thr Arg Gin Val Leu Trp 383 AAG CTG CTG AAG GTT GTG AAA TTC GGA GAA ACG GTT TCT 105 Lys Leu Leu Lys Val Val Lys Phe Gly Glu Thr Val Ser 4 22 TAC CAG CAA TTA GCA GCC CTG GCA GGC AAC CCC AAA GCG 118 Tyr Gin Gin Leu Ala Ala Leu Ala Gly A3n Pro Lys Ala
\
4 61 GCT CGT GCA GTA GGA GGA GCA ATG AGA AGC AAT CCG GTC 131 Ala Arg Ala Val Gly Gly Ala Met Arg Ser Asn Pro Val M-1 M-2 M-3
500 CCC ATC CTC ATC CCC TGC CAC AGG GTG GTT CGC AGT GAC 144 Pro lie Leu H e Pro Cys Hi3 Arg Val Val Arg Ser Asp 539 GGT GCC ATC GGC CAT TAC TCC GGA GGA GGG CAG GCT GTG 157 Gly Ala H e Gly His Tyr Ser Gly Gly Gly Gin Ala Val 578 AAG GAG TGG CTT CTG GCC CAT GAG GGC ATC CCG ACC GGA 170 Lys Glu Trp Leu Leu Ala His Glu Gly H e Pro Thr Gly 617 CAG CCA GCC TCC AAG GGC TTG GGT CTG ACT GGG ACC TGG 183 Gin Pro Ala Ser Lys Gly Leu Gly Leu Thr Gly Thr Trp 656 CTC AAG TCA TCC TTC GAG TCG ACC AGC TCT GAG CCG TCT 196 Leu Lys Ser Ser Phe Glu Ser Thr Ser Ser Glu Pro Ser 695 GGC CGA AAT TGA 209 Gly Arg Asn END
Fig. 1. Organization of the cDNA and strategy for DNA sequencing. The upper panel shows organization of the cDNA with appropriate restriction sites. Closed and open boxes indicate the coding and the non-coding regions respectively. The regions carried by clone M-l, M-2 and M-3 are shown by solid bars. The lower half shows the strategy used for DNA sequencing. Horizontal arrows show the directions and the regions of the sequence analyzed.
290
7 07 GTAACCGTTTGAATGACACATAGATGTAACGCGTGTCGGAAGCGGATGTG 7 57 TGGTGGCACCACTATATTAAAAGAGCTGCAAGTGTCCTGGGGGAAAAAAA 807 AAAAAAAAAAAAAAAAAAAAAAA Fig. 2. Nucleotide sequence of the cDNA for mouse fAmethylguanineDNA methyltransferase and the deduced amino acid sequence. The sequence underlined was used as a primer to construct the second cDNA library. The vector and adaptor sequences are not included.
Downloaded from http://carcin.oxfordjournals.org/ at UQ Library on July 13, 2015
Construction and screening of the cDNA libraries A mouse liver cDNA XgtlO library (4 x 103 plaques) was screened by using as a probe a 670 bp EcoTlWPmaCl fragment derived from pUC9MGMT (20). This probe contained the entire coding region for human methyltransferase and was labeled by the random-primed method. Prehybridization and hybridization were carried out at 42°C in a solution containing 6 x SSC, 5 x Denhardt's solution, 1 % SDS, 40% formamide and 50 fig/ml heat-denatured salmon sperm DNA. Nitrocellulose membranes (Millipore) were washed twice in 1 x SSCB at 65°C and autoradiographed on Fuji RX film at -80°C with an intensifying screen. To obtain the 5'-extended region of cDNA, a cDNA library was constructed using a specific primer. Messenger RNA was prepared from BALB/c 3T3 cells and used as a template for cDNA synthesis, which was primed with a synthetic oligonucleotide complementary to bases 368—387 of the mouse methyhransferase cDNA (underlined in Figure 2). These cDNA fragments were ligated to EcoRVNoA adaptors and inserted into the EcoRl site of pl)C18. This library was screened using as a probe an EcoRl fragment of the previously isolated mouse methyltransferase cDNA clone (M-l). Prehybridization and hybridization were performed at 42°C in 4 x SSC/5 x Denhardt's solution/1% SDS/50% formamide/50/jg/ml heatdenatured salmon sperm DNA. Membranes were washed at 65°C once in 2 x SSCB and once in 0.2 x SSCB. One clone that gave a positive signal was isolated and named M-2. From clone M-2 a 195 bp £co81I fragment carrying the 5' portion of cDNA was excised and ligated to the £co81I fragment of clone M-l. This composite mouse methyltransferase cDNA was inserted into the EcoRl site of pBSKS(-) (Stratagene) and named M-3.
Mouse methyttransferase gene Construction and screening of genomic library High mol. wt DNAs from BALB/c 3T3 cells were partially digested with BamHl and fractionated by sucrose-gradient centrifugation. Fragments of 35 - 4 5 kb were collected and inserted into the ftjmHI she of cosmid pHC79. They were packaged in vitro with packaging extracts (Gigapack Plus, Stratagene). Titer of the constructed genomic library was 1 x l(r c.f.u.//ig. Cosmid-infected Ecoli 490A cells were subjected to colony hybridization with a mouse cDNA fragment as a probe. Prehybridization and hybridization were performed at 42°C in 4 x SSC/5 x Denhardt's solution/1% SDS/50% formamide/50/jg/ml heatdenatured salmon sperm DNA. Final wash was made at 65"C in 0.2 x SSCB.
0»M)
908
- .
659 656 521
DNA sequencing cDNA and genomic DNA were digested with restriction enzymes and the resulting fragments were subcloned into pUC18. The inserts were sequenced using a Genesis 2000 (Dupont) automatic sequencer.
403
257
226
B
1
7.5
Expression of the mouse cDNA in methyltransferase-deficient human cells For expression of the mouse cDNA in mammalian cells, M-3 cDNA was placed downstream of the strong promoter SRa (18) in pcDL81 and the construct was termed pcDNKO.8 (Figure 4A). pcDNK0.8 was transfected into HeLa MR cells devoid of methyltransferase activity (19). Three days after transfection, cells were harvested to determine the methyltransferase activity. As shown in Figure 4(B), cells carrying pcDNK0.8 exhibited a high
2
>
4.4 > '
