Cell Biology International ISSN 1065-6995 doi: 10.1002/cbin.10240
RESEARCH ARTICLE
Isolation and characterization of lung resident mesenchymal stem cells capable of differentiating into alveolar epithelial type II cells Xuemin Gong1,2,3, Zhaorui Sun1,2,3, Di Cui1,2,3, Xiaomeng Xu1,2,3, Huiming Zhu1,2,3, Lihui Wang1,2,3, Weiping Qian4 and Xiaodong Han1,2,3* 1 2 3 4
Immunology and Reproductive Biology Laboratory, Medical College of Nanjing University, Nanjing 210093, China Jiangsu Key Laboratory of Molecular Medicine, Nanjing 210093, China State Key Laboratory of Analytical Chemistry for Life Science, Nanjing University, Nanjing 210093, China State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210093, China
Abstract Controversies and risks continue to be reported about exogenous mesenchymal stem cell-based therapies. In contrast with employing exogenous stem cells, making use of lung resident mesenchymal stem cells (LR-MSCs) could be advantageous. Our study sought to isolate the LR-MSCs and explore their potential to differentiate into alveolar epithelial type II cells (ATII cells). Total lung cells were first precultured, from which the Sca-1þCD45CD31 population was purified using fluorescence activated cell sorting (FACS). By these methods, it would seem that the Sca-1þCD45CD31 cells were LR-MSCs. Similar to bone marrow derived mesenchymal stem cells (BM-MSCs), these cells express Sca-1, CD29, CD90, CD44 and CD106, but not CD31 or CD45. They share the same gene expression file with the BM-MSCs and have a similar DNA content during longterm culturing. Furthermore, they could be serially passaged with all these properties being sustained. Above all, LR-MSCs could differentiate into ATII cells when co-cultured with ATII cells in a trans-well system. These findings demonstrated that the Sca-1þCD45CD31 cells appear to be LR-MSCs that can differentiate into ATII cells. This approach may hold promise for their use in the treatment of lung disease. Keywords: alveolar epithelial type II cells; differentiation; fluorescence activated cell sorting; lung resident mesenchymal stem cells; stem cell antigen-1
Introduction Being one of the most well-researched stem cells, bone marrow mesenchymal stem cells (BM-MSCs) have been described as an adherent, fibroblast-like population possessing the potential of extensive self-renewal and multi-lineage differentiation (Scolding and Rice, 2008). On the basis of this potential, BM-MSCs can home into lung tissue to repair injuries, from either an injection of cultured cells or bone marrow transplantation (Kotton et al., 2001; Thebaud and Van Haaffen, 2006). However, controversies and risks have been reported, which lead to an increasing number of assumptions that LR-MSCs may be logically more therapeutically efficient than BM-MSCs (Gill et al., 2004). To date LR-MSCs have yet to be isolated and identified. In adult mouse lung, putative stem and progenitor cells, including mucous-producing cells, ciliated cells, basal cells,
Clara cells and ATII cells, have been identified and characterized from the proximal to distal epithelium (Barth and Muller, 1999; Danto et al., 1995; Evans et al., 1986; Liao et al., 2005; Matthay and Folkesson, 2006). Using FACS, Hoechst dye-effluxing cells and the Sca-1þCD45CD31 cells are isolated and identified as lung stem cells. Although Hoechst dye-effluxing cells show the characteristics of mesenchymal stem cells (MSCs), their anatomical location and mechanisms involved in repairing lung injuries in vivo remain unclear (Summer et al., 2007). The stem cell antigen1þ (Sca-1þ) population (excluding hematopoietic and endothelial cells) appears to have a mesenchymal-like profile, predominantly exhibiting fibroblast-like morphology and the potential to differentiate into lipofibroblastic, osteogenic and chondrogenic cell lineages (Kim and Raiser, 2009). Therefore, Sca-1 is denoted as a prospective marker of lung mesenchymal cell (Kim and Raiser, 2009).
*Corresponding author: e-mail: [email protected] X.G. and Z.S. are joint first authors.
Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
405
X. Gong et al.
Isolation and characterization of LR-MSCs
Recently, Sca-1þCD45CD31 cells have been described as predominant mesenchymal cell lineages in the lung tissue (Hegab et al., 2010). Based on these results and some preliminary studies, the Sca-1þCD45CD31 cells from adult mouse lung are supposed to be the LR-MSCs. The present work explores the relationship between the Sca1þCD45CD31 cells and the BM-MSCs. Under in vitro co-culture conditions, rat airway epithelial cells can trigger the expression of several epithelial markers of BM-MSCs at an early stage (Han et al., 2009). Human lung MSCs (hLMSCs) have the ability to generate non-hematopoietic cells with characteristics of neuroectodermal and mesodermal lineages, including neural cells, osteoblasts, and sperm-like cells (Hua et al., 2009). These potential lung stem cells can differentiate into smooth muscle, bone, fat, and cartilage (Summer and Fitzsimmons, 2007). However, it remains unclear whether the LR-MSCs can be induced to differentiate into ATII cells. We have isolated the Sca-1þCD45CD31 cells using FACS. To ascertain whether the Sca-1þCD45CD31 cells were LR-MSCs, we investigated the surface marker expression, gene expression and DNA content between LR-MSCs and BM-MSCs. Using the trans-well system, LR-MSCs epithelial differentiation was also examined. We provide a method to isolate and amplify tissue-resident stem cells that can be helpful in further studies on adult lung mesenchymal stem cells activity and differentiation.
37 C in the dark. After two washes with PBS, cells were analyzed using a FACS Aria (Becton Dickinson). The following antibodies were employed: FITC conjugated Sca-1, PE conjugated CD45, APC conjugated CD31, PE conjugated CD29, PE conjugated CD90, PE conjugated CD44, and FITC conjugated CD106. Cells were sorted in a cold and sterile environment.
Materials and methods
cDNA was generated from RNA extracts derived from cultured Sca-1þCD45CD31cells, Sca-1CD45CD31cells and BM-MSCs using a reverse transcription kit (Transgen, China). RNA extract from whole lung tissue was used as a positive control. 18 S was used as an internal control. PCR was performed using the designed primers as shown in Table 1.
ATII cells line culture ATII cells from Yili Bio-technology Co. Ltd. (Shanghai, China) were cultured with low-glucose Dulbecco’s Modified Eagle’s medium (DMEM) containing 5% FBS, maintained in a humidified atmosphere of 95% air, 5% CO2 at 37 C.
Pre-culture for efficient collection of lung stem cells Isolation of lung stem cells single-cell suspensions was prepared each time from lungs of at least five C57BL/6 (4–6 weeks old) as described by Hegab and Kubo (2010). Digested and filtered cells were cultured on dishes at 1.5 106 cells/ 100-mm dish in DMEM supplemented with antibiotics, 0.1 mM pyruvate and 10% FBS. After 7 days’ culture, the cells were released from culture dishes with 0.25% trypsin containing 0.02% EDTA for 30 s, centrifuged and washed with 1% BSA-containing PBS. The cells were used for FACS.
Flow cytometric analysis and sorting In order to sort the stem cells and analyze the expression of various surface markers, the cells were stained for 30 min at 406
Sorted cell culture Freshly isolated cells plated at 105/mL were cultured with DMEM medium containing 10% fetal bovine serum, 1% Lglutamine, 1% penicillin and streptomycin, maintained in a humidified atmosphere of 95% air, 5% CO2 at 37 C. The culture medium was changed every 3 days, and cells were passaged 1:2 or 1:3 using 0.25% trypsin when they reached 80–90% confluence.
DNA labeling DNA was labeled using propidium iodide as previously described (Summer and Fitzsimmons, 2007). Cultured Sca1þCD45CD31 cells, Sca-1CD45CD31 cells and the mouse BM-MSCs were tested.
RNA extraction and reverse transcriptase PCR (RT-PCR)
Indirect co-culture experiments Indirect co-culture was established using cell culture inserts (0.4 um pore, 4.5 cm2, Corning) as described by Han and Wang (2009). Both the LR-MSCs and ATII cells were plated at 105/mL at each time-point. For 0, 7 and 14 days, inserts were removed and LR-MSCs were collected for electron microscopy and immunocytochemistry analysis.
Immunofluorescent staining and Western-blot assay Immunofluorescence analysis was carried out as described by Sun et al. (2012). The following antibodies were employed: cytokeratin 18 (CK18), cytokeratin 19 (CK19), occludin, SP-C, Alex 594-labeled anti-rabbit IgG and Alex 594-labeled anti-mouse IgG. Nuclei were stained with 1 mg/mL DAPI (Sigma). Images of fluorescence were Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
X. Gong et al.
Isolation and characterization of LR-MSCs
Table 1 Primer sequence for RT-PCR Gene
Forward primer sequence (50 -30 )
Reverse primer sequence (50 -30 )
CK 18 CK 19 SP-C AQ5 CD31 Tie2 Flk-1 a-SMA Vimentin
AGATCGACAATGCCCGCCTT ACCCTGGCTGTGTCTGATGGG CCTTGAGATGAGCATCGGAGC CCTGGGACCTGTGAGTGGTGG GGCGATTGTAGCCACCTCCA CGCACACATTTGGCAGGACC GGGGCTTGATTTCACCTGGC CATGCGTCTGGACTTGGCTG TGCGGCTGCTTCAAGACTCG
TGCAGAAGGACCCCATTGAGC CCTCCACGCTCAGACGCAAG GGAAAGCCAGGTCTCTCCCG GAGAGGGGCTGAACCGATTCA TTGACCACTTTGCCGATGCC ACCCAGAGGCTTTGCAGATGG GGGAGGGTTGGCGTAGACTGT GTGCGAGGGCTGTGATCTCC CTCTCGCAGCCGCATGATGT
captured using a laser scanning confocal fluorescence microscope (Olympus, Tokyo, Japan). For Western-blotting analysis, whole cell lysates were separated using SDS/12% PAGE and electrophoretically transferred to PVDF membrane (Millipore) by standard procedures. After the membranes had been blocked, primary antibodies (CK18, CK19, occludin and SP-C) were added to the membranes and incubated at 4 C for 16 h. After three washes in PBS, the membranes were incubated with the secondary antibody at 37 C for 1 h. Immunoreactive protein bands were detected using an Odyssey Scanning System (LICOR Inc.).
Sca-1þCD45CD31 cells culture and phenotype identification After being plated for 24–48 h, long, thin and stellate sorted cells appeared that were exactly like BM-MSCs in terms of morphology, the cells being homogeneous in appearance.
Statistical analysis Results were shown as means SD. Continuous variables were compared by means of one-way ANOVA with Scheffe post hoc correction using SPSS for Windows version 11.0 (SPSS Inc., Chicago, IL, USA). Values of P < 0.05 were considered statistically significant. Results
Isolation and expansion of the Sca-1þCD45CD31 cells On the basis of previous work, it was hypothesized that the Sca-1þCD45CD31cells were LR-MSCs. The Sca1þCD45CD31 cells were sorted from the pre-cultured lung cells by using FACS with high efficiency (Fig. 1A–D). After being cultured in DMEM, the Sca-1þCD45CD31 cells were found to adhere to culture surfaces, and to display the morphologic features of BM-MSCs (long, thin, and stellate appearance; Fig. 1E). Cells with the physical characteristics of hematopoietic (small and round), endothelial (cobblestone), or epithelial (cuboidal) cells were noticeably absent from the culture. However, the Sca1CD45CD31 cells did not grow under the same culture conditions (Fig. 1F). Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
Figure 1 Isolation and culture of the Sca-1+CD45CD31 cells. (A–D) Isolate the Sca-1þCD45CD31 cells from the pre-cultured lung cells by FACS (C, D), isotype staining (A, B). (E, F) Morphology of the Sca-1þCD45CD31 cells and Sca-1CD45CD31 after cultured in low-glucose DMEM for 5 days. Sca-1þCD45CD31 cells display the morphologic features of mesenchymal stem cells which are considered as long, thin, and stellate appearance (E). However, the Sca-1CD45CD31 cells seldom grow in the same condition (F).
407
Isolation and characterization of LR-MSCs
X. Gong et al.
Figure 2 Culturing and analysis of the Sca-1+CD45CD31 cells. (A) Morphology of the Sca-1þCD45CD31 cells in the first, third and fifth passage. Phase-contrast images of the fibroblast-like morphology of sorted cells in the different passages. (B–H) Flow cytometric analysis of cultured cells in third passage. Flow cytometry analysis showed that the MLSCs stained homogeneously strong with markers for BM-MSCs, such as the CD29, CD90, CD44 and CD106 (B–F). The cells were negative for the markers of hematopoietic and endothelial cells (CD45, CD31) (G, H).
The sorted cells had a homogeneous fibroblast-like and spindle-shaped morphology after several passages (Fig. 2A). To determine whether Sca-1þCD45CD31cells were LR-MSCs, their expression of markers that characterize BMMSCs was investigated. BM-MSCs uniformly express CD44, CD106 and CD90. Analysis of the cell surface marker showed that the Sca-1þCD45CD31 cells expressed Sca-1, CD44, CD106, CD90 and CD29, but not CD31 or CD45 (Fig. 2B–H), indicating that these cells were of mesenchymal origin with high purity.
Lung stem cells shared the same characteristics with LRMSCs To show that Sca-1þCD45CD31 cells were LR-MSCs. RTPCR of RNA from cultured Sca-1þCD45CD31 cells indicated that these cells had a gene expression similar to that of BM-MSCs. Both of them weakly expressed epithelial cell markers (SP-C, AQ5, CK19 and CK18) and endothelial cell marker (FLK-1), while highly expressing 408
mesenchymal cell markers (vimentin, a-SMA; Fig. 3A and B). The results indicated that the Sca-1þCD45CD31 cells were perhaps LR-MSCs. Sca-1CD45CD31 cells expressed all of the lineage markers, indicating that Sca-1 played an important role in the sorting. The whole-lung RNA was used as a positive control. Next, DNA contents (propidium iodide staining) of the Sca-1þCD45CD31cells were examined at 1 and 5 passages (Fig. 3C and D) and revealed no difference between the cell types. This indicated that the ability was maintained in culture as an intrinsic property of the Sca-1þCD45CD31cells. Importantly, cultured Sca-1þCD45CD31cells had the same DNA content as BM-MSCs (Fig. 3C–E). Therefore, Sca-1þCD45CD31 cells were indeed LR-MSCs. As a control, the Sca-1CD45CD31 cells had a different DNA content (Fig. 3F).
Morphological changes of differentiated LR-MSCs The microphotographs of LR-MSCs co-cultured with ATII cells are shown in Fig. 4A. ATII cells were cuboidal in shape Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
X. Gong et al.
Isolation and characterization of LR-MSCs
Figure 3 Gene expression and DNA content of the Sca-1+CD45CD31 cells. (A) RT-PCR was performed on the whole lung, BM-MSCs, the Sca-1þCD45CD31 cells and Sca-1CD45CD31 cells. The Sca-1þCD45CD31 cells have a similar expression with the BM-MSCs. Both of them have a weak baseline expression of epithelial, endothelial cell markers and high expression of mesenchymal cell markers. The Sca-1CD45CD31 cells express all of the lineage markers. And the whole lung RNA was used as a positive control. (B) Quantification of gene expression levels from rt-pcr by densitometry. All expression values were normalized to the value of 18S gene. Each column and bar represented the mean SE of three individual samples. (n ¼ 3, *P < 0.05). (C–F) The cell cycle analysis of the cultured cells. Sca-1þCD45CD31cells had a similar DNA content with BM-MSCs (C–E). And the DNA content of the Sca-1þCD45CD31 cells remained unchanged during several passages (C, D). The Sca-1CD45CD31 cells have a lower fraction of cells in S, and G2 phases (F).
and expressed epithelial markers including CK18, CK19, occludin and SP-C (see Supporting Information). A short duration (3 days) of co-culture did not induce evident morphological changes of LR-MSCs; however, after 7 days’ co-culturing with ATII cells, an average 30 6% of the LRMSCs showed remarkable morphological changes, changing from typical fibroblast-like spindle appearance to round or polygonal cells. When cultured with ATII cells for 14 days, >60% of the LR-MSCs presented an epithelial-like cuboidal cell shape resembling more a monolayer culture of epithelial cells.
Epithelial marker expression in differentiated LR-MSCs Expression of epithelial markers in differentiated LR-MSCs was investigated by immunofluorescence after being induced by co-culture system for 7 and 14 days (Fig. 4B). Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
A 7-day co-culture of LR-MSCs with ATII cells induced the appearance of CK18, CK19, the tight-junction protein, occludin, and SP-C in some LR-MSCs. The expression of these epithelial markers significantly increased after 14 days of co-culture. Western blotting analysis was used for quantitative analysis of epithelial markers expression in induced LRMSCs for 0, 7, 14 days. A similar time-dependent increase was seen in expression of various epithelial markers of LRMSCs. Seven day co-cultures of LR-MSCs with ATII cells led to low level expression of CK18, CK19, occludin and SP-C (Fig. 4C). Very few LR-MSCs can differentiate into epithelial cells during short-term induction. Compared to the 7 day group, the 14 day group showed higher expression of epithelial markers. Western blotting results supported the previous immunofluorescence data, indicating that longterm co-cultures of LR-MSCs with ATII cells can induce the expression of multiple epithelial markers. 409
Isolation and characterization of LR-MSCs
Figure 4 Co-culture of LR-MSCs with ATII cells induced morphology changes and expression of some markers of epithelial differentiation in LR-MSCs. (A) Phase-contrast images of LR-MSCs differentiating into epithelial for 0, 7, 14 days. (B) Immunofluorescent analysis of cytokeratin 18, cytokeratin 19, occludin, SP-C expression in LR-MSCs co-cultured with ATII cells for 0, 7, 14 days. All of these primary antibodies were stained with secondary Alex594-labeled antibodies, nuclear staining with DAPI. (C) Western blotting detection of cytokeratin 18, cytokeratin 19, occludin, SP-C expression in co-cultured LR-MSCs with ATII cells for 0, 7, 14 days. b-actin is used as an inner control.
Discussion Our work has shown that the Sca-1þCD45CD31 cells sorted from the adult mouse lung by FACS appear to be LRMSCs. Furthermore, LR-MSCs could differentiate into ATII cells. FACS used for isolating the LR-MSCs proved very efficient in sorting Sca-1þCD45-CD31 cells, which were of fibroblast-like morphology. Consistent with our hypothesis, the phenotypic analysis and specific gene expression pattern of the Sca-1þCD45CD31 cells clearly suggested that they were LR-MSCs. Both of them weakly expressed epithelial cell markers (SP-C and CK-18) and endothelial cell 410
X. Gong et al.
marker (FLK-1), while highly expressing mesenchymal cell markers (vimentin, a-smooth). Phenotypic analysis showed that LR-MSCs expressed Sca-1, CD29, CD90, CD106 and CD44, similar to BM-MSCs. Propidium iodide staining demonstrated that LR-MSCs had a similar DNA content to BM-MSCs. Both the LR-MSCs and BM-MSCs had a higher fraction of cells in G1 phase, suggesting a high proliferation rate. In addition, they could be cultured and expanded in vitro for a long time without losing these properties. Thus a defined MSCs population resides within the adult mouse lung. In the lung, the alveolar surface consists normally of two types of epithelial cells: alveolar type I (ATI) and alveolar epithelial type II (ATII); the latter have long been considered to serve as progenitor cells in the alveoli and play an important role in repairing lung injuries (Fujino et al., 2011). We chose the co-culture method of LR-MSCs with ATII cells to differentiate LR-MSCs into ATII cells. The two kinds of cells were separated using a cell impermeable membrane to permit only their released humoral factors to exchange freely. It is usually considered that local appropriate environmental factors would be required for the differentiation of LR-MSCs. ATII cells might spontaneously release humoral factors to provide essential stimuli for LR-MSCs differentiation. LR-MSCs as the control group did not express markers of epithelia. Under co-culture conditions, the fibroblastic morphology of LR-MSCs gradually appeared the cuboidal or polygonal shape of epithelial cells. After 7 days of stimulation, specific markers of epithelium begun to be expressed by the LR-MSCs. Together the data show that LR-MSCs could be induced into ATII cells under coculture conditions. Wnt/b-catenin signaling is crucial in regulating embryonic development, cell proliferation and motility, cell-fate determination, and the generation of cell polarity (Clevers and Pinto, 2005; Cool et al., 2009). In addition, blocking Wnt/b-catenin signaling may promote differentiation of MSCs toward airway epithelial cells (Han et al., 2009). Above all, these authors hypothesized that determining the differentiation of the LR-MSCs through controlling the Wnt/b-catenin signaling would be a more efficient method of treating lung injury. This can reduce the risks associated with exogenous stem cell therapy. Therefore, our work proposes and provides a useful method for novel therapeutic approaches that can cure lung diseases. In conclusion, we suggest that the Sca-1þCD45CD31 cells are LR-MSCs. These cells undergo extensive selfrenewal in culture and have similar properties to the BM-MSCs. When co-cultured with the ATII cells, these cells could differentiate into ATII cells. This may help resolve the relative role of these cells in the pathogenesis of specific lung diseases through controlling their mesenchymal differentiation state in lung. Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
X. Gong et al.
Acknowledgments The study was supported by National Natural Science Foundation of China (81170054); the Technological Project of Health Department, Jiangsu Province, PR China (H200755); Natural Science Foundation of Jiangsu Province of China (BK2011570); 2011 Innovation Projects of University Graduate in Training of graduate students, Jiangsu Province, PR China (CXZZ11_0040); and the Open Research Fund of State Key Laboratory of Bioelectronics, Southeast University. References Barth PJ, Muller B (1999) Effects of nitrogen dioxide exposure on Clara cell proliferation and morphology. Pathol Res Pract 195:487–93. Clevers H, Pinto D (2005) Wnt control of stem cells and differentiation in the intestinal epithelium. Exp Cell Res 306:357–63. Cool SM, Ling L, Nurcombe V (2009) Wnt signaling controls the fate of mesenchymal stem cells. Gene 433:1–7. Danto SI, Shannon JM, Borok Z, Zabski SM, Crandall ED (1995) Reversible Transdifferentiation of Alveolar Epithelial-Cells. Am J Resp Cell Mol 12:497–502. Evans MJ, Shami SG, Cabralanderson LJ, Dekker NP (1986) Role of Nonciliated Cells in Renewal of the Bronchial Epithelium of Rats Exposed to NO2. Am J Pathol 123:126–33. Fujino N, Kubo H, Suzuki T, Ota C, Hegab AE, He M et al. (2011) Isolation of alveolar epithelial type II progenitor cells from adult human lungs. Lab Invest 91:363–78. Gill DR, Davies LA, Pringle IA, Hyde SC (2004) The development of gene therapy for diseases of the lung. Cell Mol Life Sci 61:355–68. Han XD, Wang YJ, Sun ZR, Qiu XF, Li Y, Qjn JZ (2009) Roles of Wnt/beta-catenin signaling in epithelial differentiation of mesenchymal stem cells. Biochem Bioph Res Co 390: 1309–14. Hegab AE, Kubo H, Fujino N, Suzuki T, He M, Kato H et al. (2010) Isolation and Characterization of Murine Multipotent Lung Stem Cells. Stem Cells Dev 19:523–35.
Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
Isolation and characterization of LR-MSCs
Hua JL, Yu HS, Dong WZ, Yang CR, Gao ZM, Lei AM et al. (2009) Characterization of mesenchymal stem cells (MSCs) from human fetal lung: Potential differentiation of germ cells. Tissue Cell 41:448–55. Kim CF, Raiser DM (2009) Commentary: Sca-1 and Cells of the Lung: A Matter of Different Sorts. Stem Cells 27:606–11. Kotton DN, Ma BY, Cardoso WV, Sanderson EA, Summer RS, Williams MC et al. (2001) Bone marrow-derived cells as progenitors of lung alveolar epithelium. Development 128:5181–8. Liao R, Pfister O, Mouquet F, Jain M, Summer R, Helmes M et al. (2005) CD31() but not CD31(þ) cardiac side population cells exhibit functional cardiomyogenic differentiation. Circ Res 97:52–61. Matthay MA, Folkesson HG (2006) Alveolar epithelial ion and fluid transport – Recent progress. Am J Respir Cell Mol Biol 35:10–9. Scolding NJ, Rice CA (2008) Autologous bone marrow stem cells – properties and advantages. J Neurol Sci 265:59–62. Summer R, Fitzsimmons K, Dwyer D, Murphy J, Fine A (2007) Isolation of an Adult Mouse Lung Mesenchymal Progenitor Cell Population. Am J Respir Cell Mol Biol 37:152–9. Sun Z, Wang Y, Gong X, Su H, Han X (2012) Secretion of rat tracheal epithelial cells induces mesenchymal stem cells to differentiate into epithelial cells. Cell Biol Int 36:169– 75. Thebaud B, Van Haaffen T (2006) Adult bone marrow-derived stem cells for the lung: Implications for pediatric lung diseases. Pediatr Res 59:94r–9. Final version published online 10 February 2014.
Supporting Information Additional supporting information may be found in the online version of this article at the publisher’s web-site. Figure S1. Identification of the ATII cells. (A) Morphology of the ATII cells; (B) Immunofluorescent analysis of cytokeratin 18, cytokeratin 19, occludin, SP-C expression in ATII cells.
411
RESEARCH ARTICLE
Isolation and characterization of lung resident mesenchymal stem cells capable of differentiating into alveolar epithelial type II cells Xuemin Gong1,2,3, Zhaorui Sun1,2,3, Di Cui1,2,3, Xiaomeng Xu1,2,3, Huiming Zhu1,2,3, Lihui Wang1,2,3, Weiping Qian4 and Xiaodong Han1,2,3* 1 2 3 4
Immunology and Reproductive Biology Laboratory, Medical College of Nanjing University, Nanjing 210093, China Jiangsu Key Laboratory of Molecular Medicine, Nanjing 210093, China State Key Laboratory of Analytical Chemistry for Life Science, Nanjing University, Nanjing 210093, China State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210093, China
Abstract Controversies and risks continue to be reported about exogenous mesenchymal stem cell-based therapies. In contrast with employing exogenous stem cells, making use of lung resident mesenchymal stem cells (LR-MSCs) could be advantageous. Our study sought to isolate the LR-MSCs and explore their potential to differentiate into alveolar epithelial type II cells (ATII cells). Total lung cells were first precultured, from which the Sca-1þCD45CD31 population was purified using fluorescence activated cell sorting (FACS). By these methods, it would seem that the Sca-1þCD45CD31 cells were LR-MSCs. Similar to bone marrow derived mesenchymal stem cells (BM-MSCs), these cells express Sca-1, CD29, CD90, CD44 and CD106, but not CD31 or CD45. They share the same gene expression file with the BM-MSCs and have a similar DNA content during longterm culturing. Furthermore, they could be serially passaged with all these properties being sustained. Above all, LR-MSCs could differentiate into ATII cells when co-cultured with ATII cells in a trans-well system. These findings demonstrated that the Sca-1þCD45CD31 cells appear to be LR-MSCs that can differentiate into ATII cells. This approach may hold promise for their use in the treatment of lung disease. Keywords: alveolar epithelial type II cells; differentiation; fluorescence activated cell sorting; lung resident mesenchymal stem cells; stem cell antigen-1
Introduction Being one of the most well-researched stem cells, bone marrow mesenchymal stem cells (BM-MSCs) have been described as an adherent, fibroblast-like population possessing the potential of extensive self-renewal and multi-lineage differentiation (Scolding and Rice, 2008). On the basis of this potential, BM-MSCs can home into lung tissue to repair injuries, from either an injection of cultured cells or bone marrow transplantation (Kotton et al., 2001; Thebaud and Van Haaffen, 2006). However, controversies and risks have been reported, which lead to an increasing number of assumptions that LR-MSCs may be logically more therapeutically efficient than BM-MSCs (Gill et al., 2004). To date LR-MSCs have yet to be isolated and identified. In adult mouse lung, putative stem and progenitor cells, including mucous-producing cells, ciliated cells, basal cells,
Clara cells and ATII cells, have been identified and characterized from the proximal to distal epithelium (Barth and Muller, 1999; Danto et al., 1995; Evans et al., 1986; Liao et al., 2005; Matthay and Folkesson, 2006). Using FACS, Hoechst dye-effluxing cells and the Sca-1þCD45CD31 cells are isolated and identified as lung stem cells. Although Hoechst dye-effluxing cells show the characteristics of mesenchymal stem cells (MSCs), their anatomical location and mechanisms involved in repairing lung injuries in vivo remain unclear (Summer et al., 2007). The stem cell antigen1þ (Sca-1þ) population (excluding hematopoietic and endothelial cells) appears to have a mesenchymal-like profile, predominantly exhibiting fibroblast-like morphology and the potential to differentiate into lipofibroblastic, osteogenic and chondrogenic cell lineages (Kim and Raiser, 2009). Therefore, Sca-1 is denoted as a prospective marker of lung mesenchymal cell (Kim and Raiser, 2009).
*Corresponding author: e-mail: [email protected] X.G. and Z.S. are joint first authors.
Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
405
X. Gong et al.
Isolation and characterization of LR-MSCs
Recently, Sca-1þCD45CD31 cells have been described as predominant mesenchymal cell lineages in the lung tissue (Hegab et al., 2010). Based on these results and some preliminary studies, the Sca-1þCD45CD31 cells from adult mouse lung are supposed to be the LR-MSCs. The present work explores the relationship between the Sca1þCD45CD31 cells and the BM-MSCs. Under in vitro co-culture conditions, rat airway epithelial cells can trigger the expression of several epithelial markers of BM-MSCs at an early stage (Han et al., 2009). Human lung MSCs (hLMSCs) have the ability to generate non-hematopoietic cells with characteristics of neuroectodermal and mesodermal lineages, including neural cells, osteoblasts, and sperm-like cells (Hua et al., 2009). These potential lung stem cells can differentiate into smooth muscle, bone, fat, and cartilage (Summer and Fitzsimmons, 2007). However, it remains unclear whether the LR-MSCs can be induced to differentiate into ATII cells. We have isolated the Sca-1þCD45CD31 cells using FACS. To ascertain whether the Sca-1þCD45CD31 cells were LR-MSCs, we investigated the surface marker expression, gene expression and DNA content between LR-MSCs and BM-MSCs. Using the trans-well system, LR-MSCs epithelial differentiation was also examined. We provide a method to isolate and amplify tissue-resident stem cells that can be helpful in further studies on adult lung mesenchymal stem cells activity and differentiation.
37 C in the dark. After two washes with PBS, cells were analyzed using a FACS Aria (Becton Dickinson). The following antibodies were employed: FITC conjugated Sca-1, PE conjugated CD45, APC conjugated CD31, PE conjugated CD29, PE conjugated CD90, PE conjugated CD44, and FITC conjugated CD106. Cells were sorted in a cold and sterile environment.
Materials and methods
cDNA was generated from RNA extracts derived from cultured Sca-1þCD45CD31cells, Sca-1CD45CD31cells and BM-MSCs using a reverse transcription kit (Transgen, China). RNA extract from whole lung tissue was used as a positive control. 18 S was used as an internal control. PCR was performed using the designed primers as shown in Table 1.
ATII cells line culture ATII cells from Yili Bio-technology Co. Ltd. (Shanghai, China) were cultured with low-glucose Dulbecco’s Modified Eagle’s medium (DMEM) containing 5% FBS, maintained in a humidified atmosphere of 95% air, 5% CO2 at 37 C.
Pre-culture for efficient collection of lung stem cells Isolation of lung stem cells single-cell suspensions was prepared each time from lungs of at least five C57BL/6 (4–6 weeks old) as described by Hegab and Kubo (2010). Digested and filtered cells were cultured on dishes at 1.5 106 cells/ 100-mm dish in DMEM supplemented with antibiotics, 0.1 mM pyruvate and 10% FBS. After 7 days’ culture, the cells were released from culture dishes with 0.25% trypsin containing 0.02% EDTA for 30 s, centrifuged and washed with 1% BSA-containing PBS. The cells were used for FACS.
Flow cytometric analysis and sorting In order to sort the stem cells and analyze the expression of various surface markers, the cells were stained for 30 min at 406
Sorted cell culture Freshly isolated cells plated at 105/mL were cultured with DMEM medium containing 10% fetal bovine serum, 1% Lglutamine, 1% penicillin and streptomycin, maintained in a humidified atmosphere of 95% air, 5% CO2 at 37 C. The culture medium was changed every 3 days, and cells were passaged 1:2 or 1:3 using 0.25% trypsin when they reached 80–90% confluence.
DNA labeling DNA was labeled using propidium iodide as previously described (Summer and Fitzsimmons, 2007). Cultured Sca1þCD45CD31 cells, Sca-1CD45CD31 cells and the mouse BM-MSCs were tested.
RNA extraction and reverse transcriptase PCR (RT-PCR)
Indirect co-culture experiments Indirect co-culture was established using cell culture inserts (0.4 um pore, 4.5 cm2, Corning) as described by Han and Wang (2009). Both the LR-MSCs and ATII cells were plated at 105/mL at each time-point. For 0, 7 and 14 days, inserts were removed and LR-MSCs were collected for electron microscopy and immunocytochemistry analysis.
Immunofluorescent staining and Western-blot assay Immunofluorescence analysis was carried out as described by Sun et al. (2012). The following antibodies were employed: cytokeratin 18 (CK18), cytokeratin 19 (CK19), occludin, SP-C, Alex 594-labeled anti-rabbit IgG and Alex 594-labeled anti-mouse IgG. Nuclei were stained with 1 mg/mL DAPI (Sigma). Images of fluorescence were Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
X. Gong et al.
Isolation and characterization of LR-MSCs
Table 1 Primer sequence for RT-PCR Gene
Forward primer sequence (50 -30 )
Reverse primer sequence (50 -30 )
CK 18 CK 19 SP-C AQ5 CD31 Tie2 Flk-1 a-SMA Vimentin
AGATCGACAATGCCCGCCTT ACCCTGGCTGTGTCTGATGGG CCTTGAGATGAGCATCGGAGC CCTGGGACCTGTGAGTGGTGG GGCGATTGTAGCCACCTCCA CGCACACATTTGGCAGGACC GGGGCTTGATTTCACCTGGC CATGCGTCTGGACTTGGCTG TGCGGCTGCTTCAAGACTCG
TGCAGAAGGACCCCATTGAGC CCTCCACGCTCAGACGCAAG GGAAAGCCAGGTCTCTCCCG GAGAGGGGCTGAACCGATTCA TTGACCACTTTGCCGATGCC ACCCAGAGGCTTTGCAGATGG GGGAGGGTTGGCGTAGACTGT GTGCGAGGGCTGTGATCTCC CTCTCGCAGCCGCATGATGT
captured using a laser scanning confocal fluorescence microscope (Olympus, Tokyo, Japan). For Western-blotting analysis, whole cell lysates were separated using SDS/12% PAGE and electrophoretically transferred to PVDF membrane (Millipore) by standard procedures. After the membranes had been blocked, primary antibodies (CK18, CK19, occludin and SP-C) were added to the membranes and incubated at 4 C for 16 h. After three washes in PBS, the membranes were incubated with the secondary antibody at 37 C for 1 h. Immunoreactive protein bands were detected using an Odyssey Scanning System (LICOR Inc.).
Sca-1þCD45CD31 cells culture and phenotype identification After being plated for 24–48 h, long, thin and stellate sorted cells appeared that were exactly like BM-MSCs in terms of morphology, the cells being homogeneous in appearance.
Statistical analysis Results were shown as means SD. Continuous variables were compared by means of one-way ANOVA with Scheffe post hoc correction using SPSS for Windows version 11.0 (SPSS Inc., Chicago, IL, USA). Values of P < 0.05 were considered statistically significant. Results
Isolation and expansion of the Sca-1þCD45CD31 cells On the basis of previous work, it was hypothesized that the Sca-1þCD45CD31cells were LR-MSCs. The Sca1þCD45CD31 cells were sorted from the pre-cultured lung cells by using FACS with high efficiency (Fig. 1A–D). After being cultured in DMEM, the Sca-1þCD45CD31 cells were found to adhere to culture surfaces, and to display the morphologic features of BM-MSCs (long, thin, and stellate appearance; Fig. 1E). Cells with the physical characteristics of hematopoietic (small and round), endothelial (cobblestone), or epithelial (cuboidal) cells were noticeably absent from the culture. However, the Sca1CD45CD31 cells did not grow under the same culture conditions (Fig. 1F). Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
Figure 1 Isolation and culture of the Sca-1+CD45CD31 cells. (A–D) Isolate the Sca-1þCD45CD31 cells from the pre-cultured lung cells by FACS (C, D), isotype staining (A, B). (E, F) Morphology of the Sca-1þCD45CD31 cells and Sca-1CD45CD31 after cultured in low-glucose DMEM for 5 days. Sca-1þCD45CD31 cells display the morphologic features of mesenchymal stem cells which are considered as long, thin, and stellate appearance (E). However, the Sca-1CD45CD31 cells seldom grow in the same condition (F).
407
Isolation and characterization of LR-MSCs
X. Gong et al.
Figure 2 Culturing and analysis of the Sca-1+CD45CD31 cells. (A) Morphology of the Sca-1þCD45CD31 cells in the first, third and fifth passage. Phase-contrast images of the fibroblast-like morphology of sorted cells in the different passages. (B–H) Flow cytometric analysis of cultured cells in third passage. Flow cytometry analysis showed that the MLSCs stained homogeneously strong with markers for BM-MSCs, such as the CD29, CD90, CD44 and CD106 (B–F). The cells were negative for the markers of hematopoietic and endothelial cells (CD45, CD31) (G, H).
The sorted cells had a homogeneous fibroblast-like and spindle-shaped morphology after several passages (Fig. 2A). To determine whether Sca-1þCD45CD31cells were LR-MSCs, their expression of markers that characterize BMMSCs was investigated. BM-MSCs uniformly express CD44, CD106 and CD90. Analysis of the cell surface marker showed that the Sca-1þCD45CD31 cells expressed Sca-1, CD44, CD106, CD90 and CD29, but not CD31 or CD45 (Fig. 2B–H), indicating that these cells were of mesenchymal origin with high purity.
Lung stem cells shared the same characteristics with LRMSCs To show that Sca-1þCD45CD31 cells were LR-MSCs. RTPCR of RNA from cultured Sca-1þCD45CD31 cells indicated that these cells had a gene expression similar to that of BM-MSCs. Both of them weakly expressed epithelial cell markers (SP-C, AQ5, CK19 and CK18) and endothelial cell marker (FLK-1), while highly expressing 408
mesenchymal cell markers (vimentin, a-SMA; Fig. 3A and B). The results indicated that the Sca-1þCD45CD31 cells were perhaps LR-MSCs. Sca-1CD45CD31 cells expressed all of the lineage markers, indicating that Sca-1 played an important role in the sorting. The whole-lung RNA was used as a positive control. Next, DNA contents (propidium iodide staining) of the Sca-1þCD45CD31cells were examined at 1 and 5 passages (Fig. 3C and D) and revealed no difference between the cell types. This indicated that the ability was maintained in culture as an intrinsic property of the Sca-1þCD45CD31cells. Importantly, cultured Sca-1þCD45CD31cells had the same DNA content as BM-MSCs (Fig. 3C–E). Therefore, Sca-1þCD45CD31 cells were indeed LR-MSCs. As a control, the Sca-1CD45CD31 cells had a different DNA content (Fig. 3F).
Morphological changes of differentiated LR-MSCs The microphotographs of LR-MSCs co-cultured with ATII cells are shown in Fig. 4A. ATII cells were cuboidal in shape Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
X. Gong et al.
Isolation and characterization of LR-MSCs
Figure 3 Gene expression and DNA content of the Sca-1+CD45CD31 cells. (A) RT-PCR was performed on the whole lung, BM-MSCs, the Sca-1þCD45CD31 cells and Sca-1CD45CD31 cells. The Sca-1þCD45CD31 cells have a similar expression with the BM-MSCs. Both of them have a weak baseline expression of epithelial, endothelial cell markers and high expression of mesenchymal cell markers. The Sca-1CD45CD31 cells express all of the lineage markers. And the whole lung RNA was used as a positive control. (B) Quantification of gene expression levels from rt-pcr by densitometry. All expression values were normalized to the value of 18S gene. Each column and bar represented the mean SE of three individual samples. (n ¼ 3, *P < 0.05). (C–F) The cell cycle analysis of the cultured cells. Sca-1þCD45CD31cells had a similar DNA content with BM-MSCs (C–E). And the DNA content of the Sca-1þCD45CD31 cells remained unchanged during several passages (C, D). The Sca-1CD45CD31 cells have a lower fraction of cells in S, and G2 phases (F).
and expressed epithelial markers including CK18, CK19, occludin and SP-C (see Supporting Information). A short duration (3 days) of co-culture did not induce evident morphological changes of LR-MSCs; however, after 7 days’ co-culturing with ATII cells, an average 30 6% of the LRMSCs showed remarkable morphological changes, changing from typical fibroblast-like spindle appearance to round or polygonal cells. When cultured with ATII cells for 14 days, >60% of the LR-MSCs presented an epithelial-like cuboidal cell shape resembling more a monolayer culture of epithelial cells.
Epithelial marker expression in differentiated LR-MSCs Expression of epithelial markers in differentiated LR-MSCs was investigated by immunofluorescence after being induced by co-culture system for 7 and 14 days (Fig. 4B). Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
A 7-day co-culture of LR-MSCs with ATII cells induced the appearance of CK18, CK19, the tight-junction protein, occludin, and SP-C in some LR-MSCs. The expression of these epithelial markers significantly increased after 14 days of co-culture. Western blotting analysis was used for quantitative analysis of epithelial markers expression in induced LRMSCs for 0, 7, 14 days. A similar time-dependent increase was seen in expression of various epithelial markers of LRMSCs. Seven day co-cultures of LR-MSCs with ATII cells led to low level expression of CK18, CK19, occludin and SP-C (Fig. 4C). Very few LR-MSCs can differentiate into epithelial cells during short-term induction. Compared to the 7 day group, the 14 day group showed higher expression of epithelial markers. Western blotting results supported the previous immunofluorescence data, indicating that longterm co-cultures of LR-MSCs with ATII cells can induce the expression of multiple epithelial markers. 409
Isolation and characterization of LR-MSCs
Figure 4 Co-culture of LR-MSCs with ATII cells induced morphology changes and expression of some markers of epithelial differentiation in LR-MSCs. (A) Phase-contrast images of LR-MSCs differentiating into epithelial for 0, 7, 14 days. (B) Immunofluorescent analysis of cytokeratin 18, cytokeratin 19, occludin, SP-C expression in LR-MSCs co-cultured with ATII cells for 0, 7, 14 days. All of these primary antibodies were stained with secondary Alex594-labeled antibodies, nuclear staining with DAPI. (C) Western blotting detection of cytokeratin 18, cytokeratin 19, occludin, SP-C expression in co-cultured LR-MSCs with ATII cells for 0, 7, 14 days. b-actin is used as an inner control.
Discussion Our work has shown that the Sca-1þCD45CD31 cells sorted from the adult mouse lung by FACS appear to be LRMSCs. Furthermore, LR-MSCs could differentiate into ATII cells. FACS used for isolating the LR-MSCs proved very efficient in sorting Sca-1þCD45-CD31 cells, which were of fibroblast-like morphology. Consistent with our hypothesis, the phenotypic analysis and specific gene expression pattern of the Sca-1þCD45CD31 cells clearly suggested that they were LR-MSCs. Both of them weakly expressed epithelial cell markers (SP-C and CK-18) and endothelial cell 410
X. Gong et al.
marker (FLK-1), while highly expressing mesenchymal cell markers (vimentin, a-smooth). Phenotypic analysis showed that LR-MSCs expressed Sca-1, CD29, CD90, CD106 and CD44, similar to BM-MSCs. Propidium iodide staining demonstrated that LR-MSCs had a similar DNA content to BM-MSCs. Both the LR-MSCs and BM-MSCs had a higher fraction of cells in G1 phase, suggesting a high proliferation rate. In addition, they could be cultured and expanded in vitro for a long time without losing these properties. Thus a defined MSCs population resides within the adult mouse lung. In the lung, the alveolar surface consists normally of two types of epithelial cells: alveolar type I (ATI) and alveolar epithelial type II (ATII); the latter have long been considered to serve as progenitor cells in the alveoli and play an important role in repairing lung injuries (Fujino et al., 2011). We chose the co-culture method of LR-MSCs with ATII cells to differentiate LR-MSCs into ATII cells. The two kinds of cells were separated using a cell impermeable membrane to permit only their released humoral factors to exchange freely. It is usually considered that local appropriate environmental factors would be required for the differentiation of LR-MSCs. ATII cells might spontaneously release humoral factors to provide essential stimuli for LR-MSCs differentiation. LR-MSCs as the control group did not express markers of epithelia. Under co-culture conditions, the fibroblastic morphology of LR-MSCs gradually appeared the cuboidal or polygonal shape of epithelial cells. After 7 days of stimulation, specific markers of epithelium begun to be expressed by the LR-MSCs. Together the data show that LR-MSCs could be induced into ATII cells under coculture conditions. Wnt/b-catenin signaling is crucial in regulating embryonic development, cell proliferation and motility, cell-fate determination, and the generation of cell polarity (Clevers and Pinto, 2005; Cool et al., 2009). In addition, blocking Wnt/b-catenin signaling may promote differentiation of MSCs toward airway epithelial cells (Han et al., 2009). Above all, these authors hypothesized that determining the differentiation of the LR-MSCs through controlling the Wnt/b-catenin signaling would be a more efficient method of treating lung injury. This can reduce the risks associated with exogenous stem cell therapy. Therefore, our work proposes and provides a useful method for novel therapeutic approaches that can cure lung diseases. In conclusion, we suggest that the Sca-1þCD45CD31 cells are LR-MSCs. These cells undergo extensive selfrenewal in culture and have similar properties to the BM-MSCs. When co-cultured with the ATII cells, these cells could differentiate into ATII cells. This may help resolve the relative role of these cells in the pathogenesis of specific lung diseases through controlling their mesenchymal differentiation state in lung. Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
X. Gong et al.
Acknowledgments The study was supported by National Natural Science Foundation of China (81170054); the Technological Project of Health Department, Jiangsu Province, PR China (H200755); Natural Science Foundation of Jiangsu Province of China (BK2011570); 2011 Innovation Projects of University Graduate in Training of graduate students, Jiangsu Province, PR China (CXZZ11_0040); and the Open Research Fund of State Key Laboratory of Bioelectronics, Southeast University. References Barth PJ, Muller B (1999) Effects of nitrogen dioxide exposure on Clara cell proliferation and morphology. Pathol Res Pract 195:487–93. Clevers H, Pinto D (2005) Wnt control of stem cells and differentiation in the intestinal epithelium. Exp Cell Res 306:357–63. Cool SM, Ling L, Nurcombe V (2009) Wnt signaling controls the fate of mesenchymal stem cells. Gene 433:1–7. Danto SI, Shannon JM, Borok Z, Zabski SM, Crandall ED (1995) Reversible Transdifferentiation of Alveolar Epithelial-Cells. Am J Resp Cell Mol 12:497–502. Evans MJ, Shami SG, Cabralanderson LJ, Dekker NP (1986) Role of Nonciliated Cells in Renewal of the Bronchial Epithelium of Rats Exposed to NO2. Am J Pathol 123:126–33. Fujino N, Kubo H, Suzuki T, Ota C, Hegab AE, He M et al. (2011) Isolation of alveolar epithelial type II progenitor cells from adult human lungs. Lab Invest 91:363–78. Gill DR, Davies LA, Pringle IA, Hyde SC (2004) The development of gene therapy for diseases of the lung. Cell Mol Life Sci 61:355–68. Han XD, Wang YJ, Sun ZR, Qiu XF, Li Y, Qjn JZ (2009) Roles of Wnt/beta-catenin signaling in epithelial differentiation of mesenchymal stem cells. Biochem Bioph Res Co 390: 1309–14. Hegab AE, Kubo H, Fujino N, Suzuki T, He M, Kato H et al. (2010) Isolation and Characterization of Murine Multipotent Lung Stem Cells. Stem Cells Dev 19:523–35.
Cell Biol Int 38 (2014) 405–411 © 2014 International Federation for Cell Biology
Isolation and characterization of LR-MSCs
Hua JL, Yu HS, Dong WZ, Yang CR, Gao ZM, Lei AM et al. (2009) Characterization of mesenchymal stem cells (MSCs) from human fetal lung: Potential differentiation of germ cells. Tissue Cell 41:448–55. Kim CF, Raiser DM (2009) Commentary: Sca-1 and Cells of the Lung: A Matter of Different Sorts. Stem Cells 27:606–11. Kotton DN, Ma BY, Cardoso WV, Sanderson EA, Summer RS, Williams MC et al. (2001) Bone marrow-derived cells as progenitors of lung alveolar epithelium. Development 128:5181–8. Liao R, Pfister O, Mouquet F, Jain M, Summer R, Helmes M et al. (2005) CD31() but not CD31(þ) cardiac side population cells exhibit functional cardiomyogenic differentiation. Circ Res 97:52–61. Matthay MA, Folkesson HG (2006) Alveolar epithelial ion and fluid transport – Recent progress. Am J Respir Cell Mol Biol 35:10–9. Scolding NJ, Rice CA (2008) Autologous bone marrow stem cells – properties and advantages. J Neurol Sci 265:59–62. Summer R, Fitzsimmons K, Dwyer D, Murphy J, Fine A (2007) Isolation of an Adult Mouse Lung Mesenchymal Progenitor Cell Population. Am J Respir Cell Mol Biol 37:152–9. Sun Z, Wang Y, Gong X, Su H, Han X (2012) Secretion of rat tracheal epithelial cells induces mesenchymal stem cells to differentiate into epithelial cells. Cell Biol Int 36:169– 75. Thebaud B, Van Haaffen T (2006) Adult bone marrow-derived stem cells for the lung: Implications for pediatric lung diseases. Pediatr Res 59:94r–9. Final version published online 10 February 2014.
Supporting Information Additional supporting information may be found in the online version of this article at the publisher’s web-site. Figure S1. Identification of the ATII cells. (A) Morphology of the ATII cells; (B) Immunofluorescent analysis of cytokeratin 18, cytokeratin 19, occludin, SP-C expression in ATII cells.
411
