INFECTION AND IMMUNITY, OCt. 1991, p. 3411-3417

Vol. 59, No. 10

0019-9567/91/103411-07$02.00/0 Copyright © 1991, American Society for Microbiology

Isolation, Characterization, and Molecular Cloning of a Specific Mycobacterium tuberculosis Antigen Gene: Identification of a Species-Specific Sequence CARLOS A. PARRA,* LIDA P. LONDONO, PATRICIA DEL PORTILLO, AND MANUEL E. PATARROYO Instituto de Inmunologia, Hospital San Juan de Dios, Universidad Nacional de Colombia, Carrera 10 Calle 1, Bogota, Colombia Received 7 December 1990/Accepted

5

July 1991

A rabbit polyclonal antiserum exhibiting a specific recognition pattern for Mycobacterium tuberculosis proteins was used to screen an M. tuberculosis genomic library constructed in the expression vector lambda gtll. One clone, denominated C1:10, expressed M. tuberculosis-specific determinants as part of a large fusion protein with ,I-galactosidase. The gene for this protein has been sequenced, and it encodes a protein of 134 amino acids (13.8 kDa) which did not display significant homology with any of the previously reported proteins in the data bases. Hybridization studies with restriction fragments of the cloned sequence revealed that it was not present in the genomes of related mycobacteria, namely, M. bovis, M. bovis BCG, M. flavescens, M. fortuitum, M. phlei, and M. vaccae. These findings suggest that we have detected a gene, or a fragment therefrom, unique for M. tuberculosis whose nucleotide and amino acid sequences could be useful tools in the design of an improved vaccine or a diagnostic method of greater accuracy for tuberculosis.

Tuberculosis is a major public health problem in developing countries, where most of the people afflicted by this disease are concentrated (40). Efforts to control the disease have been mounted from several angles, including vaccination, drug therapy, and early diagnosis. However, tuberculosis continues to be a major health problem in these countries, mainly because of the nonefficacy of the existing vaccine and the increased prevalence of the disease in AIDS patients. Although Mycobacterium bovis BCG has been widely used as a vaccine, its protective value in some vaccination trials has been disputed (37). The available forms of therapy are satisfactory in controlled situations, but in practice a rather high proportion of patients do not comply with the recommended regimens. Furthermore, a number of antibiotic-resistant strains are emerging, while alternative medications are not available (27). Finally, a fast, accurate, and inexpensive method to unambiguously diagnose tuberculosis infections has not yet been developed. Knowledge about the individual bacillary components is a prerequisite in the search for molecules of potential immunoprophylactic or immunodiagnostic value. In this context, it is important to find proteins or nucleotide sequences exclusive to the M. tuberculosis bacilli. Despite the numerous approaches to achieve this goal, the primary structure of most of the proteins already identified reveals that they correspond to heat shock proteins, which are found not only in other mycobacteria but also in other prokaryotic and eukaryotic cells (11, 18, 30, 43). In previous publications, we have reported the identification and isolation of several M. tuberculosis antigenic proteins which were well recognized by sera from tuberculosis patients (25). The complete amino acid sequences of some of these antigens have already been determined (13, 41). To identify proteins which could be involved in the particular pathogenic behavior of M. tuberculosis, we have

*

focused our studies on those proteins exclusively present in M. tuberculosis and not in M. bovis BCG. Here, we describe the results obtained when TB40 serum, a rabbit serum raised against one of these M. tuberculosis-specific proteins, was used to screen a lambda gtll genomic library. MATERIALS AND METHODS

Bacterial strains and vectors. The following mycobacterial strains were obtained from the Trudeau Mycobacterial Collection (TMC): M. tuberculosis (TMC 102, strain H37Rv), M. bovis (TMC 410), M. bovis BCG (TMC 1011, substrain Pasteur), M. phlei (ATCC 11758), M. vaccae (TMC 1526), M. flavescens (ATCC 14474), and M. fortuitum (TMC 1529). Bacteriophage lambda gtll and Escherichia coli Y1088, Y1089, and Y1090 were provided by Amersham (Amersham, United Kingdom). E. coli DH5a, E. coli XL1-Blue, and phagemid vector Bluescript were purchased from Stratagene (La Jolla, Calif.). M13mpl8 was from Pharmacia (Uppsala, Sweden). Sonic extracts. Mycobacteria were grown on Sauton's medium, harvested, and sonicated as described by Janicki et al. (16) with minor modifications. Briefly, the bacilli were sonicated by subjecting them to 15-min pulses in a Branson sonicator at 0°C, followed by a 5-min rest period between pulses, and the process was repeated four times. The sonicate was then centrifuged at 150,000 x g for 1 h at 4°C. The supernatant was removed, and the protein content was determined by the method of Lowry et al. (20). This material was stored in aliquots at -70°C until needed. Antiserum and immunological analysis. Polyclonal antisera raised against purified M. tuberculosis proteins have been produced by us and described elsewhere (25). Briefly, 150 ,ug of the MTP40 protein, which had been isolated from polyacrylamide gels under nonreducing conditions, was mixed volume for volume with incomplete Freund adjuvant and injected subcutaneously into rabbits on days 0, 20, and 45. The rabbits were bled on days 30, 45, and 60. The antiserum obtained after this immunization schedule was named TB40

Corresponding author. 3411

3412

PARRA ET AL.

and tested by immunoelectrophoresis (IE) and crossed immunoelectrophoresis (CIE) as described by Weeke (38). To determine the proteins recognized by the antiserum, the denatured M. tuberculosis sonic extract was electrophoresed on a sodium dodecyl sulfate (SDS)-polyacrylamide gel and blotted onto a nitrocellulose membrane (Amersham) as described by Towbin et al. (36). The membrane strips were incubated with either the preimmune or the hyperimmune rabbit sera, followed by application of the appropriate second antibody and substrate. Isolation of mycobacterial DNA. DNA was isolated from both fast- and slow-growing mycobacteria which were cultured in Sauton's medium. After complete growth, the bacteria were harvested and washed three times with 1Ox TE (lx TE is 10 mM Tris HCI-1 mM EDTA [pH 8.0]). Washed bacilli were then incubated at 37°C with vigorous agitation for 1.5 h in the presence of lysozyme (2 mg/ml). Bacterial membranes were disrupted by increasing the temperature to 65°C and by adding SDS and proteinase K to a final concentration of 1% and 250 ,ug/ml, respectively. Ninety minutes later, the suspension was adjusted to 0.7 M NaCl; 1/10 volume of a mixture of Cetab (Sigma, St. Louis, Mo.) and NaCl (10% Cetab, 0.7 M NaCI) was then added. Finally, the suspension was incubated once more at 65°C for 20 min, and the DNA was extracted from the suspension with chloroform-isoamyl alcohol (24:1) and precipitated with isopropanol. The pellet was washed with 70% ethanol and finally resuspended in TE buffer. The concentration and purity of the DNA were assessed by standard spectrophotometric methods. Libraries and screening. To obtain the M. tuberculosis genomic library, 1 ,ug of DNA was digested with EcoRI (Amersham), and the sizes of the released fragments were estimated by agarose gel electrophoresis by using molecular size markers. Once the DNA reached an average insert size of between 1 and 5 kbp, the enzyme was inactivated. The digested DNA was then extracted twice with chloroformphenol (1:1) and once with chloroform-isoamyl alcohol (24: 1). Subsequently, the DNA was precipitated with 2.5 volumes of ethanol and the pellet was resuspended in water. Finally, 0.2 ,ug of the digested DNA was ligated to 0.8 ,ug of dephosphorylated EcoRI-digested lambda gtll arms (Promega, Madison, Wis.). The library was packaged in Gigapack Gold extracts (Stratagene) and amplified in E. coli Y1088. Antibody screening with the polyclonal antiserum was performed as described previously (15, 42), except that lambda gtll-infected E. coli Y1090 (5,000 PFU per 150-mmdiameter plate) was seeded on LB plates and incubated at 42°C for 7 h. To induce expression of the fusion protein, the plates were overlaid with isopropyl-i-D-thiogalactopyranoside (IPTG)-saturated filters (Hybond C extra; Amersham) and incubated for 12 h at 37°C. The polyclonal rabbit antiserum TB40 used for the screening was preabsorbed with an E. coli lysate (15) and used at a final dilution of 1:50. For color development, an immunodetection kit from Promega was used. To obtain the complete mtp4O gene, an enriched library of M. tuberculosis was constructed by electroeluting BamHIdigested fragments in the range of 3 kbp and subcloning them into the plasmid Bluescript. E. coli DH5a-competent cells were transformed with this plasmid. Colony screening was carried out with a random priming labeled probe as described by Bululela et al. (3). Preparation of recombinant lambda gtll lysogens. Colonies of E. coli Y1089 were lysogenized with the appropriate C1:10

INFECT. IMMUN.

recombinant lambda gtll clone as described by Huynh et al. (15). The fusion protein was analyzed by Western blot (immunoblot). Probes and hybridization studies. Several restriction endonuclease fragments were used as probes in the different hybridization assays. The fragments were labeled by the random priming method (10) by use of the Oligolabelling Kit from Pharmacia. Southern blots of M. tuberculosis DNA were performed with genomic mycobacterial DNAs digested with different restriction enzymes. A 10-tLg amount of each digested DNA was electrophoresed on 1% agarose gels. The resulting gels were blotted onto Hybond N membranes (Amersham) as recommended by the manufacturer. The filters were hybridized with 10 nmol of the random priming labeled probe per ml (specific activity, 108 cpm/,g of DNA used). Hybridizations were carried out at 65°C for 16 h in a mixture composed of 3x SSC, 0.2% bovine serum albumin, 0.2% Ficoll, 0.2% polyvinylpyrrolidone, and 0.02 jig of tRNA per ml (lx SSC is 150 mM NaCl plus 15 mM sodium citrate [pH 7.0]). The filters were washed at 65°C in a solution containing O.1x SSC. SDS at 0.5% was present in both hybridization mixtures and washing solutions. DNA sequence and computer analysis. DNA was purified from recombinant phages as previously described (22). C1:10 clone inserts contained in the EcoRI sites of the lambda gtll vector were sequenced directly (21) by using the purified C1:10 DNA as a template and the lambda gtll primers (Boehringer Mannheim). These inserts were also released and subcloned into the polylinker of the M13mpl8 vector which was amplified in E. coli XL1-Blue. DNA sequencing was carried out by the dideoxynucleotide chain termination method (26) by using modified T7 DNA polymerase (34) as described in the U.S. Biochemicals sequencing manual on a Sequenase DNA sequencing kit. To obtain the sequence of the gene, restriction fragments of a 3-kbp BamHI fragment released from the digested M. tuberculosis genome were subcloned into the polylinker of the plasmid Bluescript. In this case, the double-stranded sequencing method was used and the plasmid DNA was initially denatured by alkali (4). Sequencing reactions were carried out with a-35S-dATP, and the reaction products were subjected to electrophoresis in 8% polyacrylamide gels. The DNA sequence data were analyzed by using the computer programs of Staden (31-33). Computer-aided analysis of the nucleic acid and deduced amino acid sequences was performed with the programs of the Genetics Computer Group (University of Wisconsin Biotechnology Center, Madison) (8) and GENEPRO. Nucleotide sequence accession number. The mtp4O gene nucleotide sequence has been submitted to GenBank, Los Alamos National Laboratory, under the accession number M57952. RESULTS Specificity of the TB40 antiserum. The specificity of the TB40 antiserum was initially evaluated by IE and CIE against protein extracts from M. tuberculosis and M. bovis BCG. The antiserum precipitated antigens only from M. tuberculosis sonic extracts and did not cross-react with any BCG antigen (Fig. 1A). A single precipitation band was evidenced when the serum was used in CIE with M. tuberculosis sonic extracts, as shown in Fig. 1B. Four proteins of M. tuberculosis sonic extracts with molecular masses of 14, 28, 40, and 76 kDa were detected by Western blots with the antiserum (Fig. 1C).

~t

CLONING OF A SPECIFIC M. TUBERCULOSIS ANTIGEN

VOL. 59, 1991

X

A.

A

9

3413

a

:S *.

_f

431t0

SAWJO

I

iW is

0oAv .,

I

c:,

I .. ..... FIG. 1. (A) IE of TB40 antiserum with M. tuberculosis (upper well) and M. bovis BCG (lower well) sonic extracts. Sonic extract (100 Fg) from each mycobacterium was loaded per well. Undiluted serum (100 ,ul) was used on the central lane. (B) CIE of TB40 antiserum against M. tuberculosis. A total of 100 ,ug of mycobacterial sonic extract was initially electrophoresed in a 1.0% agarose gel and subsequently in a similar gel containing TB40 serum at a 1:50 dilution. (C) Reactivity of TB40 serum with M. tuberculosis in a Western blot assay. Sonic extracts from M. tuberculosis (100 ,ug per lane) were mixed with Laemmli buffer containing 2.5% P-mercaptoethanol, kept at 100°C for 3 min, and loaded on an SDS-10% polyacrylamide gel. The gel was blotted onto a nitrocellulose membrane, and strips were incubated with a 1:50 dilution of either rabbit preimmune serum (lane 1) or hyperimmune serum (lane 2). Goat anti-rabbit alkaline phosphatase conjugate was used as a second antibody. Molecular weight markers are indicated.

Genomic library and screening. Approximately 200 ,ug of DNA was recovered from the different mycobacteria used (5). The M. tuberculosis genomic library contained 105 PFU/Ig of DNA used. The library was amplified in E. coli Y1088 to a final titer of 1011 PFU/ml. The amplified library consisted of 90% recombinants whose DNA insert sizes averaged between 0.5 and 5 kbp. Four filters, representing a total of 20,000 plaques, were probed with the polyclonal rabbit TB40 serum. In the first round of screening, two possible candidates were detected, but, after three consecutive purification rounds, only the strongest one remained positive. This clone was denominated C1: 10. EcoRI endonuclease restriction analysis of this clone demonstrated the presence of two inserts, 266 and 350 bp long. The total insert size was 610 bp according to a double digestion with KpnI and SstI (data not shown). Nucleotide sequencing showed a 5' through 3' arrangement of the 266 and 350 inserts in the vector. An EcoRI restriction site was found at nucleotide 261. E. coli Y1089 was lysogenized with the lambda gtll C1:10 clone and lysed after induction of the lacZ operon with 10 mM IPTG. The resultant protein extract was analyzed by Western blot. Figure 2 shows that a 130-kDa fusion protein, which contains a foreign polypeptide of approximately 13 kDa, was generated. This hybrid protein was visualized by the binding of either the polyclonal rabbit serum antibodies

FIG. 2. Immunobloting analyses from 10% polyacrylamide gels of lysates from E. coli Y1089 lysogenized with C1:10 clone (lanes 2 and 3) or with lambda gtll with no insert (lanes 1 and 4). (A) Incubation with a murine anti-,-galactosidase monoclonal antibody (Promega); (B) incubation with TB40 serum. Molecular weight markers are indicated.

monoclonal anti-p-galactosidase. The fusion protein was produced only after induction of the lacZ operon with IPTG (data not shown). To confirm the actual organization of the 266- and 350-bp EcoRI fragments in the M. tuberculosis genome, the hybridization pattern of each of these two fragments within the total DNA was analyzed. EcoRI and three other different restriction enzymes (KpnI, SstI, and BamHI), none of which had recognition sites within these two inserts, were used to digest the M. tuberculosis DNA. Southern blots of the digested DNAs were carried out separately and probed with each of the two EcoRI fragments in phage clone C1:10. The probes hybridized with bands of the same size in the EcoRI digestion, but very different restriction bands were recognized by each probe in the lanes where DNA digested with the other enzymes had been loaded (data not shown). These results, and the way in which the library was constructed, indicated that these two different segments of the genome had come together during the cloning process. Isolation of the gene. Taking into account the fact that an open reading frame (ORF) was found following the EcoRI site in the 266-bp insert downstream from the P-galactosidase and that no ORF was seen running through the 350-bp insert, we chose the 266-bp fragment as the probe with which to screen another enriched M. tuberculosis library in order to isolate the complete gene. A 3-kbp BamHI fragment of M. tuberculosis DNA was found to contain the 266-bp insert (Fig. 3 and 4A). An enriched library of this fragment was constructed in phagemid Bluescript. A total of 1,000 recomor a

3414

INFECT. IMMUN.

PARRA ET AL.

a

SSmE S

Sa EI

i -- /OO bp

**a-a

HSm

NH

St

a

II

I

I

Sp

P

-IPROBE 206 bp S

S

I-1

a PROBE

Kbp

1.!

*E

'E

E

E

PROBE 266 bp

a PfOBE 1.5 Kbp

FIG. 3. Restriction map of the 3-kbp region of the M. tuberculosis genome containing the mtp4O gene. Noted segment represents the gene. The upper diagram indicates direction and length of the gene sequence determined. Restriction enzymes: B, BamHI; E, EcoRI; H, HincII; N, NcoI; Nt, NotI; P, PstI; S, SacIl; Sm, SmaI; Sp, SphI; St, StuI. This 3-kbp fragment held no sites for BglII, ClaI, HindIII, KpnI, or TthlllI enzymes.

binant colonies were screened with the 266-bp probe; the plasmid DNA of several positive colonies was isolated, and the 3-kbp BamHI insert was cut with different restriction enzymes. Figure 3 shows the final alignment of the endonuclease restriction fragments on this 3-kbp BamHI sequence. Sequence analysis. The sequence of the 266-bp fragment of clone C1:10, as well as the sequences of its flanking regions in the chromosome, are shown in Fig. 4. The ORF begins with an ATG codon at position +1, goes through the ORF previously identified in clone C1:10, and finishes 402 nucleotides downstream, with a TGA codon. The overall G+C base composition of the sequence is 62.4%, and there is a significant preference for the use of C or G in the third position of the codons. Upstream of the coding sequence, ATTGGTGCGGGCGATTTGCTCGCGCACATGCAAGCAAATCGAACGCCGGGAGATTACCGG

60

GAAATTTCAGCTGCACAGCCCGCT6GAGTCCCGcGGACsGGTGTGGTTTCCTGAGTTG6C

1-0

-35

SD

S

P

A

G

V

P

V

N

160

ATCACTGCGGATAGGGCACCCGATAGGGAATGCTCGGcAAC3CGCCGTCGGTGGTTCCCA 150 -10

T T L G M H C 6 S F G S A P S N G W L K ACACCACGTTAGGGATGCACTGCGGCAGCTTCGGCAGCGCTCCCAGCAACGGGTGGCTCA -40

L

6

L

E

V

F G

G

V

A

K

L

N

A

E

V MS

P

T

AGTTGGGTCTGGTCGAATTCGGTGGAGTCGCAAAGTTGAAcGCTGAGGTCATGTCGCCAA

300

EcoRI T

P

S

R Q

A

V

IM L

G

T

G

T

P

N

R

A

R

I

N

CCACGCCGTCGCGCCAGGCGGTCATGTTGGGAACCGGCACGCCGAACCGGGCGCSAATCA F

N

C

E

V

W

S N

V

S E

T

I

S G

P

R

L

Y

360

G

ACTTCAATTGCGAGGTGTGGTCGAACGTGTCGGAGAC,ATCAGCGGGCCGCGGOTGTACG E

M T

P

6

M 0

6

T

R

K

P

R

S M

L

G

Tl V

T

P

S

G

P R M P

P

D

N

S

P

G

V

P

4:0

GCGAAATGACAATGCAGGGAACGCGAAAACCCAGACCGAGCGGACCACGAATGCrACCGG 4Ev T

A

V

P

A

ACCCGGGTACTGCGTCGATGTTGGGCACCGTGACGAATTCGCCGGGTGTCCCGpCGETGC

540

EcoRI

W

G A

CGTGGGGGGCGTGACGTGGTCGAAGAAGCCSCCGTTCTCGTCATAGCTGACGATAAGTGC 600 554

GGTCTTTTCCCACACCGCGGGATTGGACAGCAAGATCCGCAGCSCGTTCACCATGGACAC_G 66:

FIG. 4. Nucleotide sequence and deduced amino acid sequence of the M. tuberculosis genomic region containing the mtp4O gene. The presumed initiation codon is located at position 150. The probable -35 and -10 promoter sequences are underlined, and the putative Shine-Dalgarno (SD) motif is overlined. Stop codon is marked (*). EcoRI cloning sites are indicated. The repeated amino acid motif is boxed.

there exist consensus sequences that resemble known bacterial promoters. At position -35, there is a typical E. coli promoter sequence, TTGGCA. At position -11, there exists a CCGATAG sequence that is similar in six nucleotides to a well-known B. subtilis promoter. The most probable ShineDalgarno sequence is located immediately adjacent to the initiation codon (-7). The encoded amino acid sequence contains 134 residues. The predicted molecular mass of the protein is 13 kDa. There are two cysteine residues at positions 18 and 74. There is an amino acid motif (MLGX, where X is either T or N), beginning at amino acid residue 1, which is repeated three times in the sequence at 54-amino-acid residue intervals (Fig. 4). Hybridization studies. To establish whether the epitope specificity of the MTP40 protein observed with the TB40 antiserum could also be found at the DNA level, the 266-bp EcoRI fragment was used as a probe in hybridization studies. As is shown in Fig. 5A, the probe hybridized to the M. tuberculosis genome but did not react with another six mycobacterial genomes, namely, M. bovis, M. bovis BCG, M. phlei, M. vaccae, M. flavescens, and M. fortuitum. Probes constructed with another two restriction fragments from the cloned 3-kbp genomic fragment (1.1-kbp BamHIEcoRI fragment and 1.5-kbp EcoRI-BamHI fragment), as shown in Fig. 3, presented the same hybridization behavior (Fig. 5B and C). Southern blots used for autoradiographs (Fig. 5) were hybridized under low stringency conditions, indicating the exclusive presence of this 266-bp sequence in the M. tuberculosis genome, which involves its flanking regions as well. The copy number of this 3-kbp DNA fragment within the M. tuberculosis genome was also studied in similar experiments. The M. tuberculosis DNA was digested to completion by restriction enzymes EcoRI, BamHI, PstI, BstEII, and SaclI in independent reactions. Autoradiographs of the hybridizations between the DNA and four different probes from the 3-kbp BamHI fragment are shown in Fig. 6. The hybridization patterns are conserved for all four DNA probes, even when the sample was treated with restriction enzymes which have a high cutting frequency in the M. tuberculosis genome (e.g., BstEII and SacIl), suggesting that there is a single copy of this 3-kbp BamHI fragment within the entire genome.

CLONING OF A SPECIFIC M. TUBERCULOSIS ANTIGEN

VOL. 59, 1991 .1

4

5

SS 9 1E U

6

2 13

4

-R1 2

3 4 5 67

9K #

12 S3 14 -

4

2

S1r

7

9 t

3415

it 12 0 14-

A; '-E!r C ,~,',.iE ,&X i: 0

_.

: ..

A ..

... ,:

A. FIG. 5. Analysis of different mycobacterial genomes for the presence of the mtp4O gene and its flanking regions. DNA from M. tuberculosis (lanes 1 and 2), M. fortuitum (lanes 3 and 4), M. flavescens (lanes 5 and 6), M. vaccae (lanes 7 and 8), M. phlei (lanes 9 and 10), M. bovis (lanes 11 and 12), and M. bovis BCG (lanes 13 and 14) were digested with EcoRI (lanes 1, 3, 5, 7, 9, 11, and 13) or BamHI (lanes 2, 4, 6, 8, 10, and 14) restriction enzymes. The digested DNAs were separated by electrophoresis on 1% agarose gels and blotted onto nylon membranes. Each panel was hybridized under low stringency conditions with the following different random priming labeled probes derived from the 3-kbp cloned fragment: the 266-bp EcoRI fragment (A), the 1.1-kbp EcoRl fragment (B), and the 1.5-kbp EcoRI-BamHI fragment

(C). DISCUSSION In this article, we describe a rabbit antiserum which showed selective recognition of certain M. tuberculosis proteins. When the serum was tested by us in a number of different immunological assays, including immunodifusion, IE, and Western blot, it failed to recognize, in protein extracts from atypical mycobacteria, those antigenic determinants that it recognized in M. tuberculosis sonic extracts (data not shown). The precipitation band evidenced by CIE with M. tuberculosis sonic extracts was not detected in M. bovis BCG sonic extracts when the serum was tested with a well-known BCG reference system (7, 24). Considering this capacity of TB40 antibodies to recognize epitopes specific for M. tuberculosis antigens, we chose this serum to probe a genomic library of M. tuberculosis. The screening of 20,000 PFU with the TB40 serum led us to identify an M. tuberculosis gene, or a fragment therefrom, which is 402 bp long. Its total G+C content and the tendency to use G or C in the third position of the codons are two features that agree with the results observed in genes of other mycobacterial antigens (23, 29, 35). Sequence analysis allowed us to identify a putative transcription promoter region 35 nucleotides upstream from the ATG starting codon. This sequence resembles an E. coli promoter (14), since it comprises the hexanucleotide TTGGCA with a homology of 5 of 6 nucleotides to TTGACA. We were unable to identify, at position -10, a sequence similar to a TATA box, but a 7-nucleotide-long sequence that resembles a reported Pribnow box of Bacillus subtilis genes (19) was found. These two -10 consensus sequences differ only in the last nucleotide of the string. There is a T in the B. subtilis genes while there is a C in the mycobacterial gene. Although the Shine-Dalgarno sequence (28) matches in only three positions with the traditional Shine-Dalgarno sequence found in most of the known mycobacterial genes, it is almost identical to that reported for the 32-kDa protein gene of M. tuberculosis (AGGGAAG, homology of 6 nucleotides to AGGGAAT) (2). The putative methionine initiation codon is located 35 nucleotides downstream from the consensus promoter se-

8

A 2

3 4

4

3

~~~~~4 0KbP 234 12345wwt;.s

_

-1

160 l :2*'F,8

b

° 3

C0D

C

1 2 3 4

0~~~0.

1a

35 4

a

FIG. 6. Copy number of the mtp4O gene and flanking regions in the M. tuberculosis genome. The hybridization patterns of different restriction fragments from the cloned 3-kbp BamHI fragment are shown. M. tuberculosis DNA (10 ,ug) was digested with EcoRI (lane 1), BamHI (lane 2), PstI (lane 3), SacII (lane 4), and BstEII (lane 5) restriction enzymes and electrophoresed on 1% agarose gels. Gels were blotted onto nylon membranes and hybridized with four different probes: 206-bp SacII fragment (A), 266-bp EcoRI fragment (B), 1.1-kbp BamHI-EcoRI fragment (C), and 1.5-kbp EcoRIBamHI fragment (D).

3416

INFECT. IMMUN.

PARRA ET AL.

quence, and the protein consists of 134 amino acid residues. A motif of four amino acids (MLGX, where X is a T or a P) was found repeated three times within the sequence. A search in the EMBL3 data bank did not show any significant homology between the gene and other sequences previously reported, either at the nucleotide or amino acid level. The 266-bp EcoRI fragment was expressed as a fusion protein in the pGEMEX-1 vector, and the TB40 antiserum recognized this product. This result confirms that this 266-bp fragment, but not the 350-bp fragment in clone C1:10, is encoding the epitopes recognized by. the TB40 serum in the original screening. Monoclonal antibodies IT-1, IT-7, IT-10, IT-13, IT-15, IT-23, and IT-27 (8a, 8b), raised against other M. tuberculosis proteins, did not react with this fusion protein (data not shown), thus confirming the results of the search in the data banks. Considering the TGA codon at position 554 as the stop codon, the estimated molecular mass of the encoded protein is 13 kDa. This result does not agree with our expectations since the serum was initially raised against an M. tuberculosis protein whose molecular mass was in the range of 40 kDa, but it reacted not only against a 14-kDa protein but also against two other antigens of 28 and 76 kDa. The discrepancy observed above could be explained in several ways. It is possible that we have only sequenced a part of the gene. However, all the available sequence evidence indicates that a complete gene is present in this 600-bp fragment: further downstream of the mentioned TGA stop codon there exist a TGA codon at position 589 and a TAA codon at position 595 which could function as alternative stop codons. Moreover, there are two stop codons located upstream from the initiation site, ruling out the possibility of promoters different from the ones we have found. It is also possible that the apparent molecular weight of the native protein, inoculated under nondenaturing conditions, differed from that defined by the antiserum in immunoblots of reduced, denatured sonicate (Fig. 1C). Alternatively, the detected protein may share immunogenic determinants with the initially inoculated product. Studies are presently being conducted in our laboratory to explain this result. Hybridization studies suggest that the mtp4O gene is unique to the M. tuberculosis genome. The fact that under low-stringency conditions the probes derived from its flanking segments did not hybridize with other mycobacterial genomes rules out the presence of homologous regions to the cloned 3-kbp gerlomic region in the tested samples. Recently, the synthesis of two oligonucleotide probes representing the 5' and 3' ends of the gene has allowed us to confirm the exclusive presence of this gene in the M. tuberculosis genome. The gene could be amplified by polymerase chain reaction only from M. tuberculosis strains (H37Rv and H37Ra) and not from M. leprae, M. smegmatis, or M. bovis BCG Pasteur (7a). The use of nucleic acid probes for the diagnosis of infectious diseases has increased during the last several years. Such probes must be very specific for a particular pathogenic species, thereby allowing its use to differentiate rapidly between pathogenic and nonpathogenic species or between virulent and avirulent strains, as exemplified by studies in Leishmania species (39). The search for such specific sequences in mycobacteria has recently been successful in the case of M. leprae (1, 6, 12). One of these sequences has been found to be repeated at least 18 times in the bacillus genome. Recently, Shinnick et al. (30) discussed the potential use of specific rDNA sequences in the diagnosis of tuberculosis. However, to our knowledge, the sequence

described here is unique and is the first exclusive coding sequence reported for M. tuberculosis. The strong humoral and cellular responses to synthetic peptides derived from this protein in both tuberculosis patients and household contacts (9) suggest the presence of important T- and B-cell epitopes within this antigen. From the data presented here, we conclude that we have cloned a gene, or a fragment of a larger gene, denominated mtp4O, which could be a promising tool for use in the design of an improved tuberculosis vaccine. ACKNOWLEDGMENTS We thank George Widera, Al Remtulla, Nina Agadian, and John Zabriskie for helpful discussion of the manuscript, Juan Rodriguez, Marcela Rodriguez, and Clemencia Pinilla for providing assistance, and William R. Jacobs, Jr., for kindly providing the M. tuberculosis, M. bovis BCG, M. smegmatis, and M. leprae DNAs. This research was supported by the Presidency of the Republic of Colombia, the Colombian Ministry of Public Health, and the German Leprosy Relief Association. REFERENCES 1. Booth, R. J., D. P. Harris, J. M. Love, and J. D. Watson. 1988. Antigenic proteins of Mycobacterium leprae: complete sequence of the gene for the 18-kDa protein. J. Immunol. 140:597601. 2. Borremans, M., L. De Wit, G. Volckaert, J. Ooms, J. De Bruyn, K. Huygen, J.-P. Van Vooren, M. Stelandre, R. Verhofstadt, and J. Content. 1989. Cloning, sequence determination, and expression of a 32-kilodalton-protein gene of Mycobacterium tuberculosis. Infect. Immun. 57:3123-3130. 3. Bululela, L., A. Foster, T. Bochm, and T. H. Rabbitts. 1989. A

rapid procedure for colony screening using nylon filters. Nucleic Acids Res. 17:452. 4. Chen, E. Y., and P. H. Seeburg. 1985. Supercoil sequencing: a fast, simple method for sequencing plasmid DNA. DNA 4:165170. 5. Clark-Curtiss, J. E., and M. A. Docherty. 1989. A speciesspecific repetitive sequence in M. leprae DNA. J. Infect. Dis. 159:7-15. 6. Clark-Curtiss, J. E., W. R. Jacobs, M. A. Docherty, L. R. Ritchie, and R. Curtiss. 1985. Molecular analysis of DNA and construction of genomic libraries of Mycobacterium leprae. J. Bacteriol. 161:1093-1102. 7. Closs, O., M. Harboe, N. H. Axelsen-Chistensen, and M. Magnussen. 1980. The antigens of Mycobacterium bovis, strain BCG, studied by crossed-immunoelectrophoresis: a reference system. Scand. J. Immunol. 12:249-264. 7a.Del Portillo, P., L. A. Murillo, and M. E. Patarroyo. 1991. Amplification of a species-specific DNA fragment of Mycobacterium tuberculosis and its possible use in diagnosis. J. Clin. Microbiol. 29:2163-2168. 8. Devereux, J. R., P. Haeberli, and 0. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. 8a.Engers, H. D., et al. 1985. Letter. Infect. Immun. 48:603-605. 8b.Engers, H. D., et al. 1986. Letter. Infect. Immun. 51:718-720. 9. Falla, J. C., C. A. Parra, M. Mendoza, L. C. Franco, F. Guzman, J. Forero, 0. Orozco, and M. E. Patarroyo. 1991. Identification of B- and T-cell epitopes within the MTP40 protein of Mycobacterium tuberculosis and their correlation with the disease course. Infect. Immun. 59:2265-2273. 10. Feinberg, A. P., and R. Vogelstein. 1983. A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13. 11. Garsia, R. J., L. Hellqvist, R. J. Booth, A. J. Radford, W. J. Britton, L. Astbury, R. J. Trent, and A. Basten. 1989. Homology of the 70-kilodalton antigens from Mycobacterium leprae and Mycobacterium bovis with the Mycobacterium tuberculosis 71-kilodalton antigen and with the conserved heat shock protein 70 of eukaryotes. Infect. Immun. 57:204-212.

VOL. 59, 1991

CLONING OF A SPECIFIC M. TUBERCULOSIS ANTIGEN

12. Grosskinsky, C. M., W. R. Jacobs, J. E. Clark-Curtiss, and B. R. Bloom. 1989. Genetic relationships among Mycobacterium leprae, Mycobacterium tuberculosis, and candidate leprosy vaccine strains determined by DNA hybridization: identification of an M. leprae-specific repetitive sequence. Infect. Immun. 57: 1535-1541. 13. Harboe, M., S. Nagai, M. E. Patarroyo, M. L. Torres, C. Ramirez, and N. Cruz. 1986. Properties of proteins MPB64, MPB70, and MPB80 of Mycobacterium bovis BCG. Infect. Immun. 52:293-302. 14. Hawley, D. K., and W. R. McClure. 1983. Compilation and analysis of E. coli promoter DNA sequences. Nucleic Acids Res. 11:2237-2255. 15. Huynh, T. V., R. A. Young, and R. W. Davis. 1985. Constructing and screening libraries in lambda gtlO and lambda gtll, p. 49. In D. M. Glover (ed.), DNA cloning: a practical approach, vol. 1. IRL Press, Oxford. 16. Janicki, B. W., G. L. Wright, R. C. Good, and S. D. Chaparas. 1976. Comparison of antigens in sonic and pressure cell extracts of Mycobacterium tuberculosis. Infect. Immun. 13:425-437. 17. Kohne, D., J. Hogan, V. Jones, E. Dean, and T. H. Adams. 1986. Novel approach for rapid and sensitive detection of microorganisms: DNA probes to rRNA, p. 110-112. In L. Lieve (ed.), Microbiology-1986. American Society for Microbiology, Washington, D.C. 18. Lathigra, R. B., D. B. Young, D. Sweetser, and R. A. Young. 1988. A gene from Mycobacterium tuberculosis which is homologous to the DnaJ heat shock protein of E. coli. Nucleic Acids Res. 16:1636. 19. Losick, R., and J. Pero. 1981. Cascades of sigma factors. Cell 25:582-584. 20. Lowry, 0. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-275. 21. Manfioletti, G., and C. Schneider. 1988. A new and fast method for preparing high quality lambda DNA suitable for sequencing. Nucleic Acids Res. 16:2873-2885. 22. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 23. Matsuo, K., R. Yamaguchi, A. Yamazaki, H. Tasaka, and T. Yamada. 1988. Cloning and expression of the Mycobacterium bovis BCG gene for extracellular alpha-antigen. J. Bacteriol. 170:3847-3854. 24. Patarroyo, M. E., C. Parra, C. Pinilla, P. del Portillo, D. Lozada, M. Oramas, M. Torres, P. Clavoo, C. Ramirez, N. Fajardo, N. Cruz, and C. Jimenez. 1986. Immunogenic synthetic peptides against Mycobacterium tuberculosis, p. 219. In F. Brown et al. (ed.), Vaccines 86: new approaches to immunization. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 25. Patarroyo, M. E., C. A. Parra, C. Pinilla, P. del Portillo, M. L. Torres, P. Clavijo, L. M. Salazar, and C. Jimenez. 1986. Immunogenic synthetic peptides against mycobacteria of potential immunodiagnostic and immunoprophylactic value. Lepr. Rev. 57(Suppl. 2):163-168. 26. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.

3417

USA 74:5463-5467. 27. Sensi, P. 1989. Approaches to the development of new antituberculosis drugs. Rev. Infect. Dis. 11(Suppl. 2):S467. 28. Shine, J., and L. Dalgarno. 1974. The 3'-terminal sequence of Escherichia coli 16S ribosomal RNA: complementary to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA 71:1342-1346. 29. Shinnick, T. M. 1987. The 65-kilodalton antigen of Mycobacterium tuberculosis. J. Bacteriol. 169:1080-1088. 30. Shinnick, T. M., M. H. Vodkin, and J. C. Williams. 1988. The Mycobacterium tuberculosis 65-kilodalton antigen is a heat shock protein which corresponds to common antigen and to the Escherichia coli GroEL protein. Infect. Immun. 56:446-451. 31. Staden, R. 1982. Automation of the computer handling of the gel reading data produced by the shotgun method of DNA sequencing. Nucleic Acids Res. 10:4731-4751. 32. Staden, R. 1984. Graphic methods to determine the function of nucleic acid sequences. Nucleic Acids Res. 12:521-538. 33. Staden, R. 1982. An interactive graphics program for comparing and aligning nucleic acid and amino acid sequences. Nucleic Acids Res. 10:2951-2961. 34. Tabor, S., and C. C. Richardson. 1987. DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84:4767-4771. 35. Thole, J. E. R., W. J. Keulen, A. H. J. Kolk, D. G. Groothuis, L. G. Berwald, R. H. Tiesjema, and J. D. A. van Embden. 1987. Characterization, sequence determination, and immunogenicity of a 64-kilodalton protein of Mycobacterium bovis BCG expressed in Escherichia coli K-12. Infect. Immun. 55:1466-1475. 36. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Nati. Acad. Sci. USA 76:4350-4354. 37. Tuberculosis Prevention Trial, Madras. 1979. Trial of BCG vaccines in South India for tuberculosis prevention. Indian J. Med. Res. 72:349-363. 38. Weeke, B. 1973. Rocket immunoelectrophoresis, p. 37. In N. H. Axelsen, J. Kroll, and B. Weeke (ed.), A manual of quantitative immunoelectrophoresis, methods and applications. Universitetsforlaget, Oslo. 39. Wirth, D. F., and D. M. Pratt. 1982. Rapid identification of Leishmania species by hybridization of kinetoplast DNA in cutaneous lesions. Proc. Natl. Acad. Sci. USA 79:6999-7003. 40. World Health Organization. 1982. Tuberculosis control. Technical Report Series vol. 671, p. 1. 41. Yamaguchi, R., K. Matsuo, A. Yamazaki, C. Abe, S. Nagai, K. Terasaka, and T. Yamada. 1989. Cloning and characterization of the gene for the immunogenic protein MPB64 of Mycobacterium bovis BCG. Infect. Immun. 57:283-288. 42. Young, D., R. Lathigra, R. Hendrix, D. Sweetser, and R. A. Young. 1988. Stress proteins are immune targets in leprosy and tuberculosis. Proc. Natl. Acad. Sci. USA 85:4267-4270. 43. Young, R. A., B. R. Bloom, C. M. Grosskinsky, J. Ivanji, D. Thomas, and R. W. Davis. 1985. Dissection of Mycobacterium tuberculosis antigens using recombinant DNA. Proc. Natl. Acad. Sci. USA 82:2583-2587.