6ene. 93 (1990) 285-291 Elsevier

285

GENE 03677

Isolation of c D N A s encoding subunit V l b of human eytochrome c oxidase and steady-state levels of coxVlb m R N A in different tissues (Mitochondrial protein; respiratory chain; nuclear gene; skeletal muscle; liver; fibroblasts; MOLT-4 cells; ~gt I 1 and 2.ZAP libraries; ,~mtisera)

Jan-Willem Taanman', Cobi Schrage', Nieo J. Ponne b, Atze 2". Das c, Piet A. Bolhuis ~, Hans de Vries" and Etienne Agsteribbe" ° Laboratory of Physiological Chemistry, University of 6roningen, BIoemsingel !0, 9712 K Z 6roningen (The Netherlands): b Department of Neurology, A cademic Medical Centre, Meibergdreef l 5. 1! 05 A Z Amsterdam (The Netherlands) Tel. (3! -20) 5663842; and ¢ Department of Anatomy and Embryology, University of Amsterdam, Meibergdreef 15, ! 105 A Z Amsterdam (The Netherlands) Tel. (3!-20)5664934 Received by H. van Ormondt: 7 November 1989 Revised: 15 March 1990 Accepted: 20 March and 18 May 1990

SUMMARY

A full-length cDNA clone specifying the nuclear-encoded subunit Vlb of human cytochrome c oxidase (COX) was isolated from a human skeletal muscle cDNA expression library. This was done with antiserum directed against the group of subunits Via, b and c of bovine heart COX. A potential ribosome-binding site was located immediately upstream from the initiation codon. The predicted amino acid sequence revealed 85% similarity with the corresponding subunit of bovine heart COX. Subunit VIb lacks a cleavable presequence for mitochondrial addressing. We assume that there are no tissue-specific isoforms of subunit Vlb, since (i) in a Northern blot experiment a single hybridizing band of approx. 500 nucleotides was demonstrated in RNA from liver, skeletal muscle, MOLT-4 cells and fibroblasts and (ii) a full-length cDNA clone with an identical sequence was isolated from a human liver cDNA library. Steady-state levels of the coxVlb transcript were different in the tissues examined.

INTRODUCTION

Cytochrome c oxidase (COX; EC 1.9.3.1) is a mitochondrial enzyme complex integrated in the inner membrane. It transfers electrons from cytochrome c to molecular oxygen Correspondenceto: J.-W. Taanman, PhysiologicalChemistry Laboratory, University of Groningen, Bioemsingel 10, 9712 KZ Groningen (The Netherlands) Tel. (31-50)632737; Fax (31-50)632606. Abbreviations: aa, amino acid(s); bp, base pair(s); cDNA, DNA complementary to RNA; COX, cytochrome c oxidase; cox,gene coding for COX; kb, kilobase(s)or 1000 bp; nt, nucleotide(s); PA, polyacrylamide;PAGE, PA-gel electrophoresis; RBS, ribosome-binding site; RIA, 10mM Tris. HCi pH 7.5/150 mM NaCI/I ~o Triton X-100/0.1 ~o SDS/0.1% sodium deoxycholate/0.1% gelatine; rRNA, ribosomal RNA; SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCi/0.015 M Nas" citrate pH 7.6. 0378-1119/90/$03.50 © 1990Elsevier Science Publishers B.V.(BiomedicalDivision)

in the terminal reaction of the respiratory chain in eukaryotic cells. This electron transfer is coupled to a proton-pumping activity across the inner membrane. Like most complexes of the respiratory chain, COX consists of polypeptides of different genetic origin. The three largest subunits (I, II and lid are encoded by the mitochondrial genome (Anderson et al., 1981) and synthesized on mitochondrial ribosomes (Hare et al., 1980). These subunits are responsible for the catalytic functions. The other subunits are nuclear gene products, synthesized in the cytosol (Hare et al., 1980) and transported into the mitochondria. In mammals ten nuclear-encoded subunits are present (IV, Va, Vb, Via, Vlb, Vlc, VIIa, VIIb, VIIc and VIII, according to the nomenclature of Kadenbach et al., 1983). In lower eukaryotes the number of nuclear-encoded subunits is

286 smaller: four in Dictyostelium discoideum (Bisson et al., 1985) and six in Saccharomyces cerevisiae (Power et al.,

1984). The function of the nuclear-encoded subunits is unknown, although a role in regulation of the enzyme activity has been proposed (Montecucco et al., 1986; Bisson et al., 1987). Nuclear-encoded subunits may modulate the catalytic functions in mammals according to the variable needs in different tissues (Kadenbach and Merle, 1981; Kadenbach, 1986). This hypothesis is supported by the fact that the kinetic properties of COX are different in liver and heart of the same animal (Merle and Kadenbach, 1982). Of the ten nuclear-encoded subunits at least three subunits (Via, VIIa and VllI) occur predominantly in tissue-specific forms. These so-called isoforms differ in electrophoretic mobility, immunological characteristics and N-terminal aa sequences (for review see: Kadenbach et ai., 1988). ~ifferent cDNAs coding for subunit Via were isolated from liver and heart of rat (Schlerfet al., 1988). Isoforms ofnuclear-encoded subunits have also been demonstrated in D. discoideum (Bisson and Schiavo, 1986) and S. cerevisiae (Cumsky et al., 1985). In D. discoideum variations in the oxygen concentration seem to trigger subunit switching (Schiavo and Bisson, 1989). The genes coding for the subunits of mitochondriai origin have been characterized and sequenced from many species including man (Anderson et al., 1981). To study the occurrence of isoforms of COX subunits in man and to study tissue-specific expression of genes encoding subunits of the respiratory complexes we have set out to isolate cDNA clones specifying nuclear-encoded subunits from man. The structural information obtained in this way may also shed some light on the function(s) of nuclear-encoded subunits in the complex. Until now, eDNA clones coding for the human nuclear-encoded subunits IV (Zeviani et al., 1987), Va (Rizzuto et al., 1988), Vb (Zeviani et al., 1988), Vla (Fabrizi et al., 1989a), Vlc (Otsuka et al., 1988), Vlla (Fabrizi et al., 1989b), Vllc (Koga et al., 1990) and VIII (Rizzuto et al., 1989) were cloned and sequenced. Recently we reported the coding sequence of COX Vlb isolated from a human skeletal muscle cDNA library (Taanman et al., 1989). The aim of the present study is the isolation and sequence determination of full-length cDNA clones from a human skeletal muscle library and a human liver library encoding COX VIb to investigate the existence of isoforms for this subunit.

RESULTS AND DISCUSSION

(n) Preparation and reactivity of antisera Bovine heart COX (a kind gift of Dr. A.O. Muijsers)was separated by preparative SDS-PAGE as described (Kad-

enbach et al., 1983). Samples were allowed to stand overnight at room temperature in sample buffer without/~-mercaptoethanol and applied to 10 cm wide slots. After separation, gels were stained mildly with 0.006% Coomassie brilliant blue to trace the protein bands. The COX subunits were collected from gel slices by a 24 h electroelution (Biotrap, Schleicher & Schuell). Purity of the eluted subunits was checked on silver-stained gels (Merril et al., 1984). The eluted protein was emulsified with complete Freund's adjuvant (1: 1). Rabbits were injected subcutaneously with 70-130 #g of protein per animal. Injections were repeated with the same amount of protein per animal with incomplete Freund's adjuvant (1: 1) after 28, 42, and 56 days. Blood was drawn before every injection and 10 days after the final injection the animals were bled. Serum was stored at -20 ° C until analysis. Subunits of bovine heart COX were not sufficiently separated by preparative SDS-PAGE to isolate single subunits. Therefore, groups of subunits were isolated from several gels and used to raise antibodies in rabbits. The two antisera used in this study were raised against subunits Vla, b and c, and against subunits r i b and c. The antisera were analysed by means of a Western blot with bovine heart COX (Fig. 1). Both antisera showed a specific reaction with the homologous subunits. The antisera also showed a specific cross-reaction with the corresponding polypeptides in human muscle COX and mitochondrial proteins of human liver on a Western blot (results not shown).

(b) Construction and screening of the muscle eDNA library A library in the expressing bacteriophage ~gtl I (Young and Davis, 1983)was prepared from skeletal muscle RNA of disk-protrusion patients (three male, one female) who had undergone laminectomy. Muscle was frozen in liquid N2 immediately after surgery. Total RNA was isolated following the procedure of Auffray and Rougeon (1980). Oiigo(dT) chromatography (Maniatis et al., 1982)was used to select poly(A) ÷ RNA. With oligo(dT) as a primer, eDNA was synthesized with reverse transcriptase and T4 DNA polymerase (Amersham) under conditions r¢commanded by the supplier. Electrophoresis showed that the majority of the cDNAs had a length of 0.3-2 kb. The eDNA was methylated with M. EcoRl methyltransferase and iigated to EcoRl linkers. After restriction with EcoRl, the eDNA was isolated by gel filtration. Cloning in ~gtll was carried out according to the instructions ofthe manufacturer (Promega, Madison, Wl). The efficiency was 2 × 106 plaques/~g eDNA. The sample used for screening was amplified once. To screen the library, phages were plated on a lawn of Escherichia coliYl090 R - and incubated for 3.5 h at 42°C (Huynh et al., 1985). The plaques were overlaid with nitrocellulose (0.2 ~m pore size, Schleicher & SchueU), previously saturated with 10 mM isopropyl-~-thio-galactoside,

287

I n p u t V l a b c Vlb¢

kDa

18

IV IV"

• •

15

Vab

*

Vlabc

•

VIIabc , VIII

*

Fig. !, Western blot of bovine heart COX. Bovine heart COX was separated on a 0.1% SDS/16.$% PA-gelwith 6 M urea (Schllggerand Von Jagow, 1987). The sample was incubated in sample buffer with /~.mercaptoethanolfor 30 rain at 37"C, and appliedto a 10-cmwideslot. The lower part of the gel, with the nuclear encoded subunits, was transferred to an Immobilon PVDF membrane(Miilipore)by electroelution (Towbinet al., 1979) at 6 V/am,overnight.Strips of the membrane were treated with antiseraexactlylike the plaquelifts. A I: 4000 dilution was applied for the antiserum raised against bovine heart COX Via, b and c (Vlab¢) and a I: 400 dilutionwas appliedfor the antiserumraised against bovineheart COX Vlb and e (Vlbc).To visualizethe input one strip was stained with amido black. Prestained Low MolecularWeight Markers (BRL) ~vere used to determine the relative molecular mass. Band IV* represents a proteolytic break down product of subunit IV (Merle et ai., 1981).

for 3 h at 37°C. The filters were rinsed once with 150 mM NaCI and blocked in 10 mM Tris. HCI pH 7.5/350 mM NaCI 1~o gelatine for 2 h at 25 oC. Screening was performed in RIA with a 1 : 100 dilution ofthe antiserum raised against bovine heart COX Via, b and c overnight at room temperature. The antiserum was pretreated with an E. coil lysate immobilized on nitrocellulose filters to reduce background (Huynh et al., 1985). After washing three times for 20 min in RIA, goat anti-rabbit IgG conjugated with alkaline phosphatase (Sigma) in RIA was applied to the filters for 2 h at room temperature. Finally the filters were washed six times

for 10m in in RIA. Antigen-antibody complexes were visualized with 5-bromo-4-chloro-3-indolyl phosphate and nitro-blue tetrazolium (Leary et al., 1983). Plaques corresponding to purple, doughnut-shaped spots were picked up from the agar plates with a sterile toothpick and rescreened at lower density to purify the phage. (e) Construction and screening of the fiver eDNA library Total RNA isolated from human liver according to the method of Chirgwin et al. (1979) was used to construct a library in the expression vector ,IZAP (Short et al., 1988). Poly(A) + RNA was selected on oligo(dT) cellulose (Maniatis et al., 1982). Single-stranded eDNA was synthesized with the use of oligo(dT) and Moloney murine leukemia virus (MMLV) reverse transcriptase (BRL). Doublestranded eDNA was synthesized with RNase H and DNA polymerase I according to the method of Gubler and Hoffman (1983). Double-stranded eDNA was methylated with M. EcoRI methyitransferase and imperfect blunt ends were made double-stranded with T4 DNA polymerase. After ligation of the EcoRI linkers the eDNA was digested with EcoRI. Excess of linkers was separated from the eDNA by gel filtration. The eDNA was iigated with EcoRl digested, dephosphorylated ~IZAP arms (Stratagene), using equal molar ratios of eDNA and vector. The DNA was packaged in vitro and plated on E. cog XL-I-B cells for amplification. The eDNA library contained approximately 1 × 106 recombinant clones. The muscle-derived eDNA insert coding for COX Vlb was used to screen the liver library following the Stratagene protocol, with E. cog BB4 serving as host cells. The eDNA was random.primer-labelled (Feinberg and Vogelstein, 1983) in the presence of [0t-32P]dCTP (3000 Ci/mmoi) to a specific activity of 109 cpm//~g DNA with a Multiprime DNA Labelling kit (Amersham). Hybridizing plaques were replated at lower density to obtain plaque-pure clones. (d) Isolation of human eox¥1b cDNAs

Screening of 115000 recombinant plaques of a human skeletal muscle eDNA library, cloned in ~.gtl 1, with the antiserum against COX Via, b and c resulted in the isolation of 22 clones that were positive on rescreening. DNA was purified from the clones and the size of the eDNA inserts was estimated by EcoRl digestion and subsequent electrophoresis on a 0.8% agarose gel. Two of the selected recombinants, designated ~.SEI and ~.SF1, with inserts of approximately 450 bp were analysed in detail. Both clones were also recognized by the antiserum directed against COX VIb and c. The eDNA fragments of ~SEI and 2SFI were inserted into the EcoRI cloning site of pUCI9 and clones containing the respective fragments were obtained and named pSE1.7 and pSFI.7. Seven ofthe initially isolated clones, including ~SFI, hybridized with the fragment

288

cloned in pSEI.7. DNA sequence analysis revealed that both subclones contained an identical eDNA fragment. The sequence is shown in Fig. 2. The eDNA is 450 bp long and contains a 44-bp Y-untranslated region, a 261-bp open readin~ frame, starting with an ATG codon and terminating with a TGA stop codon, and a 145-bp 3'-untranslated region including an AATAAA polyadenylation signal (Proudfoot and Brownlee, 1976) and a poly(A)+tail of 11 bp. The eDNA appears to code for COX VIb since the deduced polypeptide, 86 aa in length, shows 85 % similarity with subunit Vlb of bovine heart COX (Steffens et al., 1979). We conclude that the first 5'-proximal ATG represents the translation start position, because the sequence CACCATGG at position 41-48 is consistent with the favored eukaryotic initiation site (Kozak, 1981). The eukaryotic

1

TTGkGCTGCAGGTTGI~J~TCCGGGGTGCCTTTAGG&TTCAGCACCRTGGCGGPJ~G&C&TG human: 14 A E D M bovine: N-Ac X

60

GAGAC~TCAAGAACTACAAG&CCGCCCCTTTTGAC&GC'~GCTTCCCCJtkCC&GAAC E 0

T a

K

I

K

N

Y

K Q

T

A

P

F

D

S

R

F

P

N

O

N

120

CAGRCT&GJt~ACTGCTGGC&GAACTACCTGGACTTCCACCGCTGTC&GAAGGCA&TGACC Q T R N C W Q N Y L D F H R C Q K k M T

180

GCTAAAGG&GGCG&TATCTC TGTGTGCGAATGGT&CCAGCGTGTGTACCAGTCCCTCTGC A K G G D I S V C E W Y Q R V Y Q S L C V R K

240

CCC&CATCCTGGGTCAC&GACTGGG.%TGAGCAACGGGCTGAAGGCACGTTTCCCGGG.q, AG P T S W V T D W D E O R A E G T F P G K l S T D R

300

ATCTGJ~,ACTGGCTGCATCTCCCTTTCCTCTGTCCTCCATCCTTCTCCCAGGATGGTGAAG I t

360

GG~&CCTGGT&cce>G&TCCC(:&CCCC,~,GG&TCCTN~TC&TGAC~TACCTGCT~'T

420

][][~CTC&TTGOA,~qkGTG~

E

Fig. 2, The nt sequenceof the human coxVlb full.lengtheDNA and the deduced aa sequence.The polyadenylationsignal is overlined.The stop codon is indicatedby an asterisk.The aa residues are represented by the standard single.lettercode. The bovineheart COX Vlb aa, whichdiffer from human, are shownbelowthe aa sequence.The N-terminalresidue of mature bovineheart COX Vlb is acetylated(N-Ao).To determinethe nt sequenceDNAofselected~.8t! 1recombinantsfromthe musclelibrary was isolated from a 5-ml liquid culture (Davis et al., 1986). Inserted eDNA was liberated by digestion with £coRl and subcloned into the EcoRl siteofpUCl9(Yaniseh-Perronet al., 1985).Recombinantplasmid DNA was isolated by the rapid boilingmethod (Holmes and Quigley, 198I). The plasmidDNAwas digestedwithEcoRl and the eDNAinserts were reclonedin both orientationsinto M13mp18(Yanisch-Perronet al., 1985).The determinationof the sequencewas carriedout by the dideoxy chain-termination method (Sanger etal., 1977). The phagemid pBluescript SK ( - ) (Short et al., 1988)containingthe eDNA fragment was excised and rescued from the selected recombinant ~.ZAPplaques of the liverlibraryvia the manufacturer'sprocedure(Stratagene).£. coli XL-I-Bcellswereusedas host cellsand R408as helperphage.Phagemid DNA preparations were carried out using the alkaline lysis method for plasmid isolation as described by Birnboim and Doly (19"/9)with an additional phenol/chloroform extraction. Double-stranded DNA was sequencedwithSequenaseaccordingto the protocolof the manufacturer (U.S. BiochemicalCorporation).The sequencedata are availableat the EMBL,GenBankand DDBJ NucleotideSequenceDatabases underthe accession number X13923.

RBS score for position 45 is -7.3, as calculated by the computer program developed by Staden (1984). This implies that subunit VIb of human COX, which is imported into mitochondria, has no cleavable presequence for mitochondrial addressing. Import into mitochondria of cytoplasmatically synthesized polypeptides is often mediated by a cleavable presequence (reviewed by Hartl et al., 1989). Mitochondrial targeting signals are quite variable, but generally lack acidic aa residues, are enriched for basic, hydrophobic and hydroxylated ca, and can potentially fold into an amphiphilic ~-helix (Von Heijne, 1986). Although the majority of mitochondrially imported proteins have cleavable presequences, the absence of a presequence is not exceptional among COX subunits. Subunit VIIa of S. cerevisiae (Wright et al., 1986), subunit VIc of rat liver (Suske et al., 1987) and of human fibroblasts (Otsuka et al., 1988), and subunit Via of rat heart (Schlerf et al., 1988) and of human liver (Fabrizi et al., 198%) do not have cleavable presequences. The sequence data of a eDNA clone specifying COX VIb of bovine heart, which was recently isolated (Lightowlers and Capaldi, 1989), also suggests the lack of a presequence. We presume that like the ADP/ATP carrier (Adrian et al., 1986; Smagula et al., 1988) subunit VIb has an internal sequence that targets the polypeptide to the mitochondria. It is difficult to indicate which part of the aa sequence is responsible for mitochondrial delivery, but the relatively small size of the polypeptide makes it an attractive candidate for studies on import of the group of mitochondrially imported proteins without a presequenze. The mature bovine heart COX VIb subunit lacks the N-terminal methionine residue (Steffens et al., 1979) predicted by the eDNA sequence of human. Probably the N-terminal methionine residue is cleaved off posttranslationally. Po.~,• translational removal of N-terminal methionine residues is quite common for mitochondrially imported polypeptides without a presequenco (e.g., Smith et al., 1979; Wright et al., 1986; Suske et al., 1987; Schlerf et al., 1988). In mature bovine heart COX VIb the N-terminal alanino residue is acetylated (Steffens et al., 1979). We expect that the N-terminal alanine residue of mature human COX VIb is also acetylated in conformity with the bovine counterpart and similar to the ADP/ATP carrier and cytochrome c. Precursors of the ADP/ATP carrier and cytochrome c are synthesized without cleavable presequences (Zimmermann et al., 1979ab), their N-terminal methionine residue is removed after translation (Smith et al., 1979) and both polypeptides are N-terminally acetylated in vertebrates (Aquila et al., 1982; Hartl et al., 1989). This would mean that the relative Mr of mature human COX Vlb is 10088. The hydropathy prof'de of human COX Vlb is presented in Fig. 3. Subunit Vlb is hydrophilic throughout its length, suggesting a peripheral location in the membrane-integrated complex. This assumption is in agreement with the immu-

289 ll,qliOllilollill

L

N

No

2 1

_N

0

o

I lo

I 2o

I 30 Residue

I 40

I 50

1 60

F

L

N

"1617 n t -

^A

- 708 n t _ l l

cox vxb

l~Iropl~l..

~g

I ?0

80

number

Fig. 3. Hydropathy plot of human COX Vlb. The hydropathy plot was calculated according to the algorithm of Kyte and Doolittle (1982) with a rolling window of seven aa residues.

nological studies of Merle et el. (1981) which suggested a location of COX Vlb at the surface of the complex. To investigate the possibility of tissue-specific expression, 92 000 recombinant plaques of a human liver eDNA library cloned in ,tZAP were screened at low stringency with the random-primer-labelled insert of pSEI.7. The screening resulted in five hybridizing clones that were positive on successive replating. Phagemids containing the eDNA fragments were excised and rescued from four selected recombinants. Sequence analysis identified all four eDNA inserts as cDNAs coding for COX VIb, however, three eDNA inserts represented truncated cDNAs. Their sequence confirmed the sequence presented in Fi& 2. However, one clone had an alternative poly(A) + site at position 432 instead of position 439.

(e) Transcript analysis To determine the approximate size of the coxglb transcript, Northern blot analysis was performed with total RNA isolated from liver, skeletal muscle, MOLT-4 cells and fibroblasts. A single hybridizing band of approximately 500 nt was present in all tissues (Fig. 4). The length of the hybridizing transcript indicates that the insert of ,ISEI (which has a length of about 440 bp not including the poly(A) + tail) is essentially full-length. There is strong evidence that the COX subunits, Via, Vlla and VIII, occur as tissue-specific isoforms. Marginal immunological differences were observed for COX Vlb isolated from rat liver and skeletal muscle (Kuhn-Nentwig and Kadenbach, 1985). The possible occurrence of tissuespecific isoforms of COX VIb was not confirmed in other experiments (reviewed by Kadenbach et el., 1988). Our results from Northern analysis of liver, muscle, MOLT-4 cell and fibroblast RNA support the opinion that tissuespecific isoforms of COX Vlb do no exist, since the single hybridizing transcript in all tissues examined had apparently the same size. The absence ofisoforms is also supported by

!

D-COX I I

~ , - 50o he-

Fig. 4. Northern blots oftotal RNA (7.5 Fg) from human skeletal muscle (M), liver (L), MOLT=4 cells (Me) and fibroblasts (F) hybridized with DNA probes for coxVlb (left) and cox//(right). Adult skeletal muscle and liver were frozen in liquid N, immediately after surgery and stored at -80°C. Samples of frozen tissue (0.5-1 g} were ground to powder in liquid N=. From this powder total RNA was isolated by the cold guanidinium-thiocyanate/CsCI method (Hun and Rutter, 1989). Total RNA from confluent fibroblast cultures was isolated via the method described by Maniatis et el. (1982) for cultured mammalian cells. Total RNA from the T-lymphocyte leukemic cell fine MOLT-4 was isolated by the procedure of Birnboim (1988). The RNA preparations were denatured with glyoxal, ffactionated on a 1.25~ agarose gel and transferred to C.~ne Screen Plus filter (New England Nuclear) in 20 × $SC at 0.04 bar, using a Miiliblot-V vacuum-blotting device (Millipore), and hybridized with full-length eDNA encoding COX Vlb, random-primer-labelled with [lsaP]dCTP to a specific activity of 5 × l0 s cpm/pg. The filter was hybridized for 40h at 47°C in 50~0 formamide/l% $DS/I M NaCi/100pg sonicated denatured salmon sperm DNA per ml/5 x Denhardt's solution (Denhardt, 1966)/30 mM Na. phosphate pH 6.5. The filter was prehybridized in the same solution for 6 h at 47°C. Alter hybridization the filter was washed twice for 30 rain in 2 × SSC/! % SDS at room temperature, in 2 x SSC at 60°C and in 0.2 g SSC at room temperature. Autoradiography was performed overnight with a Kodak XAR-$ film using an intensifying screen. Part ofthe filter with total RNA isolated from muscle and liver was later hybridized under the same conditions with a cloned Xbal-fragment ofhuman mitochondrial DNA containingcoxlI and 74 bp ofcoxl. The latter filter was autoradiographed overnight without a screen. The coxll hybridizing band and the coxl hybridizing band (visible on an overexposed autorediogram) were used to calculate the size ofthe cox Fib t~anscript. The sizes of the hybridizing bands are denoted.

the fact that identical full-length clones were isolated from a liver eDNA library and a skeletal muscle eDNA library. However, the Northern blot experiment does not exclude the possibility of cross-hybridizing cox glb transcripts of about the same length, or the presence of non-cross-hybridizing cox Vlb transcripts. Although equal amounts of total RNA were loaded, the intensity of the hybridizing band was significantly higher in skeletal muscle than in liver (Fig. 4). Northern blots presented by Zeviani et el. (1987, 1988) and Rizzuto eta]. (1988, 1989) reveal the same phenomenon for the transcripts of c o x l V and coxVa, but not for the transcripts of cox Vb and cox VllL In order to quantify the steady-state levels of the cox Vlb transcript, the autoradiogram shown in Fig. 4 was scanned. The results are presented in Table i.

290 TABLE ! Relative steady-state levels ofhuman cox transcripts in various tissues or cells Percentage of the value obtained ~th total RNA from livers

caxVlb cox//

Liver

Muscle

MOLT-4cells

Fibroblasts

100 100

220 140

230 NQ

40 NQ

s Quantification of the steady-state levels presented in Fig. 4. The autoradiograms were scanned utilizing an LKB Ultroscan XL gel scanner. The results are expressed in % ofthe value obtained with total RNA from liver. NQ, not quantified.

The differences observed in steady-state levels might reflect tissue-specific energy requirements. To compare the steady-state levels of the (nuclear) coxVlb transcript in muscle and liver with the steady-state levels of the (mitochondrial) c o x l l transcript in these tissues, part ofthe same Northern blot with total RNA from liver and muscle was hybridized with a c o x l l probe (Fig. 4). The data presented in Table I suggest a different steadystate level ratio of cox transcripts in different tissues. The coordination between nuclear and mitochondrial genes involved in the biosynthesis of a functional COX complex and the tissue-specific steady-state levels of cox transcripts will be objects for future studies.

Auffray, C. and Rougeon, F.: Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochcm. 107 (1980) 303-314. Birnboim, H.C.: Rapid extraction of high molecular weight RNA from cultured cells and 8ranulocytes for Northern analysis. Nucleic Acids Res. 16 (1983) 1487-1497. Birnboim, H.C. and Doly, J.: A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7 (1979) 1513-1523. Bisson, R. and Schiavo, (3.: Two different forms ofcytochrome c oxidase can be purified from the slime mold Diclyostellum discoideum. J. Biol. Chem. 261 (1986)4373--4376. Bisson, R., Schiavo, G. and Montecucco, C.: ATP induces conformation. al changes in mitochondrial cytochrome c oxidase. J. Biol. Chem. 262 (1987) 5992-5998. Bisson, R., Schiavo, G. and Papini, E.: Cytochrome c oxidase from the slime mold Dlctyostelium discoideum: purification and characterization. Biochemistry 24 (1985) 7845-7852. Chirgwin, J.M., Przybyla, A.E., MacDonald, RJ. and Rutter, WJ.: Isolation ofbiologicallyactive ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18 (1979) 5294-5299. Cumsky, M.G., Ko, C., Trueblood, C.E. and Poyton, R.O.: Two nonidentical forms of subunit V are functional in yeast cytochrome c oxidase. Prec. Natl. Acad. S¢i. USA 82 (1985) 2235-2239. Davis, G., Dibner, M.D. and Battey, J.F.: Basic Methods In Molecular Biology. Elsevier, New York, 1986. Denhardt, D.T.: A membrane-filter technique for the detection of complementary DNA. Biochem. Biophys. Res. Comm. 23 (1966) 641-646. Fabrizi, G.M., Rizzuto, R., Nakase, 14., Mira, S., Kadenbach, B. and Schon, E.A.: Sequence of a eDNA specifyingsubunit Via of human cytochrome c oxidase. Nucleic Acids Res. 17 (1989a) 6409. Fabrizi, G.M,, Rizzuto, R., Nakase, 14.,Mira, S., Lomax, M.I., Grossman, L.I. and Schon, E.A.: Sequence of a eDNA specifying subunit Vlla of human cytoehrome e oxidase. Nucleic Acids Res. 17 (1989b) 7107. Feinber$, A.P. and Vogelstein, B,: A technique for radiolabeling DNA

restriction endonuelease fragments to high specific activity. Anal. ACKNOWLEDGEMENTS

We thank Dr. Anton Muijsers for providing the bovine heart COX, Dr. K.W. Zimmerman for providing part ofthe human tissues used in this study, Dr. Peter Terpstra for computer analysis, Judith Hettinga for assistance with the Western blot experiment, Bert Tebbes for photography, and Marijke Holtrop for scanning the autoradiogram. This research was supported in part by a grant from the Prinses Beatrix Fends to E.A., H.d.V. and R. Berger.

REFERENCES Adrian, G.S., MeCammon, M.T., Montgomery,D.L. and Douglas, M.G.: Sequences reouired for the deliveryand localization ofthe ADP/ATP translocato: to the mitochondrial inner membrane. Mol. Cell. Biol. 6 (1986) 626-634. Anderson, S., Bankier, A.T., Barrell, B.G., De Bruijn, M.H,L,, Coulson, A.R., Drouin, J., Eperon, I.C., Nierlieh, D.P., Roe, B.A., Sanger, F,, Sehreier, P.H., Smith, A.J.H., Staden, R. and Young, I.G.: Sequence and organization of the human mitocbondrial Scheme. Nature 290 ( 1981) 457-465. Aquila, 14., Misra, D., Eulitz, M. and Klingenber8, M.: Complete amino acid sequence ofthe ADP/ATP carrier from beef heart mitochondria. Hoppe-Seyler Z. Physiol. Chem. 363 (1982) 345-349.

Bioehem. 132 (1983) 6-13. Gubler, U. and Hofl~nan, BJ.: A simple and very efficient method for generating eDNA libraries. GeM 25 (1983)263-269. Han, J,14, and Rutter, WJ.: Isolation of intact mRNA and construction of full.length eDNA libraries: use of a new vector ,~8t22, and primeradapters for directional eDNA cloning, In Setlow, J.K, (Ed.), Genetic Engineering, Principles and Methods, Vol. 10. Plenum Press, New York, 1989, pp. 195-219. Hare, J.F., Ching, E. and Attardi, G.: Isolation, subunit composition, and site of synthesis of human eytoehrome o oxidase. Biochemistry 19 (1980) 2023-2030. Hartl, F.-U,, Pfanner, N., Nioholson, D.W. and Nenpert, W.: Mitoehondrial protein import. Biochim. Biophys. Acts 988 (1989) 1-45. Holmes, D.S. and Quigley,M.: A rapid boilingmethod for the preparation of bacterial plasmids. Anal. Biochem. 114 (1981) 193-197. 14uynh, T.V., Young, R.A, and Davis, R.W.: Constructing and screening eDNA libraries in ~gtl0 and ~gtl !, In Glover, D.M. (Ed.), DNA Cloning: A Practical Approach, Vol. I. IRL Press, Oxford, 1985, pp. 49-78. Kadenbach, B,: Regulation of respiration and ATP synthesis in higher organisms: hypothesis. J. Bioenerg. Biomembr. 18 (1986) 39-54. Kadenbaeh, B. and Merle, P.: On the function of multiple subunits of cytochrome ¢ oxidme from higher eukaryntes. FEBS Lett. 135 (1981) 1-11. Kadenbach, B., Jaransch, J., 14artmann, R. and Merle, P.: Separation of mammalian cytochrome c oxidase into 13 polypeptides by a sodium dodeeyl sulfate-gel electrophoretie procedure. Anal. Biochem. 129 (1983) 517-521.

291 Kadenbach, B., Kuhn-Nentwig, L. and BOSe,U.: Evolution of a regulatory enzyme: Cytochrome-c oxidase (complex IV). in Lee, C.P. (Ed.), Current Topics in Bioenersetics, Vol. 15. Academic Press, New York, 1987, pp. 113-161. Knga, Y., Fabrizi, G.M., Mira, S., Amaudo, F..,Lomax, M.I., Aqua, M.S., Grossman, L.I. and Schon, E.A.: Sequence of a cDNA specifying subunit Vllc of human cytochrome ¢ oxidase. Nucleic Acids Res. 18 (1990) 684. Kozak, M.: Possible role of flanking nuclcotides in recoseition of the AUG initiator codon by cul(aryotlc ribosomes. Nucleic Acids Res. 9 (1981) 5233-5252. Kuhn-Nentwi8, L. and Kadenbach, B.: Isolation and properties of cytochrome c oxidase from rat fiver and quantification of immunological differences between isozymes from various rat tissues with subunitspecific antisera. Eur. J. Biochem. 149 (1985) 147-158. Kyte, J. and Doofittle, R.F.: A simple method For displaying the hydropathic character of a protein. J. Moi. Biol. 157 (1982) 105-132. Leary, JJ., Brigati, D.J. and Ward, D.C.: Rapid and se[Jsitivecolorimetric method For visualizing biotin-labeled DNA probes hybridized to DNA or RNA immobilized on nitrocellulose: Bio-blots. Prec. Natl. Acad. Sci. USA 80 (1983) 4045-4049. Lightowlers, R.N. and Capaldi, R.A.: Nucleotide sequence of the cDNA encoding subanit AED (Vlb) of beef heart cytochrome c oxidase. Nucl. Acids Res. 17 (1989) 5845. Maniatis, T., Pritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Merle, P. and Kadenbach, B.: Kinetic and structural differences between cytochrome c oxidases from beeffiver and heart. Eur. J. Biochem. 125 (1982) 239-244. Merle, P., laransch, J., Trapp, M., Scherka, R. and Kadenbach, B.: Immunologicaland chemical characterization of rat liwr cytochrome c oxidase. Biochim. Biophys. Acta 699 (1981) 222-230. Merril, C.R., Goldman, D. and Van Keuren, M.L.: Gel protein stains: Silver stain. Methods Enzymol. 104 (1984)441-447. Montecucco, C., Schiavo, G. and Bisson, R,: ATP bindingto bovine heart cytochrome c oxidase. Biochem. J. 234 (1986) 241-243. Otsuka, M., Mizumo, Y., Yoshida, M., K~awa, Y. and Ohta, S.: Nucleotide sequence or eDNA encoding human cytochrome c oxidase subunit Vie, Nucleic Acids Ras. 16 (1988) 10916. Power, S.D., Lochrie, M.A., Sevarino, K.A., Patterson, T.E. and Poyton, R.O.: The nuclear.coded subunits oryeast cytochrome c oxidase. J. Biol. Chem. 259 (1984) 6504-6570. Proudroot, N.J. and Brownlee, O.O.: 3' Non.coding region sequences in eukaryotic messenger RNA. Nature 263 (1976) 211-214. Rizzuto, R,, Nakase, H., Zeviani, M., DiManro, S. and Schon, E.A.: Subunit Va of human and bovine cytochrome c oxidase is highly converved. Gene 69 (1988) 245-256. Rizzuto, R., Nakase, H., Dan'as, B., Prancke, U., Pabrizi, G.M., Mensel, T., Walsh, F., Kadenbach, B., DiMauro, S. and Schon, E.A.: A Sene specifying subunit VIII of' human cytochrome c oxidase is localized to chromosome ! ! and is expressed in both muscle and non-muscle tissues. J. Biol. Chem. 264 (1989) 10595-10600. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencingwith chainterminating inhibitors. Prec. Natl. Acad. Sci. USA 74 (1977) $463-$467. Scha~er, H. and Von Jngow, O.: Tricine-sodium dodecyl sulfate-polya-

crylmnide gel electrophoresis for the separation of" proteins in the range from I to 100 kDa. And. Biocbem. 166 (1987) 368-379. Schiavo, G. and Bisson, R.: Oxygen influmces the subunit structure of cytochrome c oxidase in the slime mold D ~ ,~eok~,sun. I. Biol. Chem. 264 (1989) 7129-7134. Schlerf, A., Droste, M., Winter, M. and Kadenbach, B.: Charactesizadoa of two different Senes (cDNA) for cytochrome c oxidase subunit Via from heart and liver of the rat. EMBO I. 7 (1988) 2387-2391. Short, J.M., Fernandez, J.M., Serge, J.A. and Huse, W.D.: ,1ZAP: A bacteriophage ,t expression vector with in rive excision properties. Nucleic Acids Res. 16 (1988) 7583-7(d}0. Sm~,ula, C. and Douglas, M.G.: Mitochondrial import of'the ADP/ATP carrier protein in Sacckaromycescerevb/ae.I. Biol. Chem. 263 (1988) 6783-6790. Smith, M., Leang, D.W., Gillam, S., Astall, C.R., Montgomery, D.L. and Hall, B.D.: Sequence ofthe Sene For iso-l-cytochrome-¢ in Sacckammyces cerevb~'ae.Cell 16 (1979) 753-761. Stadun, R.: Computer methods to locate signalsin nucleic acid sequences. Nucleic Acids Res. 12 (1984) 505-519. Steffens, G.C.M., Steffens, GJ. and Buse, G.: Studies on cytochrome ¢ oxidase, VIII. The amino acid sequence of polypeptide VII. Hoppe Seyler Z. Physiol. Chem. 360 (1979) 1641-1650. Suske, G., Mcnsel, T., Cordingley, M. and Kadenbach, B.: Molecular cloning and further characterization ofcDNAs for rat nuclear-encoded cytochrome c oxidase subunits Vic and VIIi. Eur. J. Biocbem. 168 (1987) 233-237. Taanman, J.-W., Schrase, C., Pomme,N., Bolhnis, P., De Vries, H. and AS3teribbe, E.: Nucleotide sequence ofcDNA encoding subanit Vib of human cytochrome c oxidase. Nucleic Acids Res. 17 (1989) 1766. Towbin, H., Staehefin, T. and Gordon, J.: Electrophoretic transf~er of proteins from polyacrylamidegels to nitrocellulose sheets: Procedure and some applications. Prec. Natl. Acad. Sci. USA 76 (1979) 4350-4354. Yon Heijne, O.: Mitochondrial targeting sequences may form amphiphilic helices. EMBO J. $ (1986) 1335-1342, Wright, R.M., Dircks, L.K. and Poyton, R.O.: Characterization of CO,~, the nuclear Sene encoding the yeast mitechondrial protein cytochrome c oxidase subunit Vlla. J. Biol. Chem. 261 (1986) 17183-17191. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved M13 ph~e cloning vectors and host strains: Nucleotide sequences of the MI3mpl8 and pUCI9 vectors. Gene 33 (1985) 103-119. Young, R.A. and Davis, R.W.: Efficient isolation of genes by using antibody probes. Prec. Natl. Acad. Sci. USA 80 (1983) 1194-1198. Zeviani, M., Nakagawa, M., Herbert, J., Lomax, M.I., Orossman, L.I., Sherbany, A.A., Miranda, A.P., DiMauro, S. and Schon, E.A.: lsolation of a eDNA clone encoding subunit IV of human cytochrome c oxidase. Gene $$ (1987) 205-217. Zeviani, M., Sakoda, S., Sherbany, A.A., Nakase, H., Rizzuto, R., Samitt, C.E., DiManro, S. and Schon, E.A.: Sequence of cDNAs encoding subunit Vb of human and bovine cytochrome c oxidase. Gene 65 (1988) !-II. Zimmermann, R., Paluch, U. and Neupert, W.: Cell-free synthesis of cytochrome c. FEBS Lett. 108 (1979a) 141-146. Zimmermann, R., Paluch, U., Sprinzl, M. and Neupert, W.: Cell-free synthesis of the mitochondrial ADP/ATP carrier protein of Neurospora crasso. Ear. J. Biochem. 99 (1979b) 247-252.