CDCindependent in vitro infection of FDC by HIV-1
Fur. J. I m n i u n o l . 1 W 1 . 21; 1873-1878
Ingrid Stahmer, J. Pascal Zimmer , Martin Emst,
lhomas Iiehner - , Ricarda Finnem , Herbert Schmitz , Hans-D. Flad and Johannes Gerdes
Forschungsinstitut Borstel, Department of Immunology and Cell Biology, Borstel and Bernhard-Nocht-lnstituto,
Department of Virology, Hamburg
1873
Isolation of normal human follicular dendritic cells and CD44ndependent in vitro infection by human immunodeficiency virus (HIV-1)" Immunohistological and electron microscopy studies of lymph nodes from patients infected with the human immunodeficiency virus 1 (HIV-1) demonstrated that follicular dendritic cells (FDC), the antigen-presentingcells of the B cell system, contain and may produce the virus. To elucidate the mode of infection of FDC with HIV-1 in vitro we developed an improved method for the preparation of single-cell suspensions of viable FDC with high purity (>90% FDC).These isolated FDC were subjected to human Tcell leukemia virus IIIB infection,which was monitored after 4 days in culture using the polymerase chain reaction. We were able to demonstrate that normal human FDC are highly susceptible to infection by HIV-1. Inhibition experiments with the monoclonal antibody OKT4a demonstrate that this infection is independent of the CD4 molecule.
1 Introduction
2 Materials and methods
The B cell-dependent areas of human lymphoid tissue contain non-lymphoid non-phagocyticcells known as follicular dendriticcells (FDC; for reviews see [l-31). Because of their accessory functions, e.g. antigen trapping [4], these cells are essential for the germinal center reaction including the memory B cell formation [5]. FDC cannot readily be stained by routine histological methods, but can be detected by using the antibody R4/23 (DRC-l), which specifically reacts with FDC [6]. Immunohistological and electron microscopy studies demonstrated HIV-1 infection and virus budding of FDC [7-lo]. Therefore, it was suggested that these cells may play an important role in the pathogenesis of AIDS as a major virus reservoir, where infection of susceptible and permissive cells may occur continuously.Thus, there is an objective need for a better understanding of the mode of infection of FDCwith HIV-1. A prerequisite to investigate the infection mechanism is an in vitro system with isolated FDC. However, thusfar, preparation of FDC from normal lymphoid tissue yielded in cell suspensions containing only 10% to 50% FDC clusters with the FDC still being aggregated with each other and/or with lymphoid cells [ 5 , 11-14].Thus, the aim of our study was to develop a technique for the preparation of highly pure single-cell suspensionsof viable FDC and to elucidate whether these cells might be susceptible to HIV-1infection in vitro.
2.1 Preparation of tonsil cells
[I92811
Human tonsils obtained from healthy children by nonurgent tonsillectomy were minced and passed through a nylon mesh, washed three times in PBS followed by density gradient centrifugation on Ficoll sodium metrizoate. Cells of the interphase were washed three times in PBS containing 100 U/mlpenidin, 100 p g / d streptomycinand kept in culture under standard conditions in RPMI 1640 medium supplemented with 10% FCS. 2.2 Immunoeuzymatic staining Cytocentrifuge preparations of the interphase cell suspension and of cultured cells were immunostained with the R4/23 [6,11], and bound antibody alkaline-anti-alkaline phosphatase (APAAP) method as described [lS]. The APAAP immunostainings were controlled by (a) the use of secondary reagents only to confirm their species specificity; (b) the development of alkaline phosphatase alone to preclude staining due to endogenous enzyme activity and (c) by the use of murine primary isotype-matched control mAb with unrelated specificities against the target cells. All these controls consistently yielded the expected negative results and are thus not mentioned any more in the following.
2.3 Purification of viable FDC and depletion of CD4+ cells
* This work was supported by the Bundesministerium fiir For- Short-term cultures of the tonsillar cell interphase fraction schung und Technologie: AIDS Forschungsverbund Hamburg, Projekt A2.
Correspondence: Johanna Gerdes, Forschungsinstitut Borstel, Division Molecular Immunology, Parkallee 22, D-2061 Borstel, FRG
Abbreviations: FCD: Follicular dendritic cell HTLV: Human T-lymphocytotropicvirus MOI: Multiplicity of infection PCR: Polymerase chain reaction PI: Propidium iodide 0 VCH Verlagsgesellschaft mbH, D-6940 Weinheim, 1991
were incubated with antibody R4/23 which is of IgM class and a PE-conjugated mouse I@ anti-CD4 antibody (Dako, Hamburg, FRG). After three washes bound R4/23 was targeted with affinity-purified dchlorotriazinyl amino fluorescein (DTAF)-labeled F(ab')z fragments of goat anti-mouse IgM antibodies (Dianova, Hamburg, FRG). R4/23+CD4- cells were separated by cell sorting using a cytofluorograf system SOH (Ortho, Raritan, NY). The 0014-2980/91/0808-1873$3.50+ .25/0
1874
I. Stahmer, J. I? Zimmer, M. Ernst et al.
Eur. J. Immunol. 1991.21: 1873-1878
culture cells were lysed and PCR was performed using the primer pair SK 38 (ATAATCCACCTATCCCAGTAGGAGAGAAAT)/SK 39 (TITGGTCCTTGTCITATGTCCAGAATGC) [19]. For the amplification of previral DNA 15 pl of cell extracts was added to the amplificationmixture consisting of 50 pmol of each primer, 200 nm dNTP in 10 nm Tris-HC1, pH 8.3, supplemented with 50 nm KCl, 2 . 5 m ~MgC12, 0.02% gelatin and 2 U of Themzophilus aquaticus polymerase (Perkin-Elmer, Uberlingen, FRG). Thirty-five polymerase chain reaction (PCR) cycles were carried out on a DNAThermal Cycler (Perkin-Elmer)using the following conditions: (a) denaturation at 95 "C for 30 s; As the presence of certain B cell markers is still contro- (b) annealing at 56°C for 30 s; (c) elongation at 68°C for versial [17], in selected experiments, putatively contami- 120 s. The amplified fragment was specifically detected nating B cells were excluded by cell sorting after immuno- by liquid hybridization using a 32Pend-labeled SK 19 olistaining of the R4/23+, but CD4- and PI- cells with gonucleotide ATCCTGGGATTAAATAAAATAGTAAantibodies against CD19 (anti-CD19, Dako) and anti-IgD GAATGTATAGCCCTAC as probe [19]. Hybridization (Dianova). For control experiments R4/23-CD4- cells was carried out at 56°C for 30 min and subsequently 10 pl were isolated by cell sorting and used for in vitro infec- of each sample was separated on a 15% polyacrylamide gel, tion. which was subjected to autoradiography using Kodak X-Omat film at -70°C for 3 h.
sorting criteria were as follows: thresholds of 90" scatter and forward scatter were optimized for the scatter parameters of R4/23+ cells. Furthermore, lower threshold for green fluorescence was set to channel 20, whereas upper threshold for red fluorescence was set to channel 2. Cells obtained by this first sort were subsequently stained with propidium iodide (PI) [16]. To exclude dead cells (strong PI-dependent red fluorescence)we performed a second sort with the same criteria as those of the first sort. This second sort results in a cell population highly enriched in R4/23+CD4- and PI- cells.
2.4 HIV infection and detection of proviral DNA 2.5 Preincubation with anti-CD4 antibody
Highly purified FDC as well as cells from the T cell line H9 were infected at a MOI (multiplicityof infection) of 0.5 with human Tcell leukemia virus (HTLV) IIIB [18] which was treated with DNase prior to application. After 4 days in
H9 cells or purified FDC (lo3cells) were preincubated with different concentrations of OKT4a antibody (Ortho, Nekkargemund, FRG) which specifically reacts with the gp120
Figure I. Immunostaining with R4/23 of cytocentrifuge preparation of tonsillar cell suspensions enriched in FDC. After density gradient centrifugation R4/23+ cells were clustered with each other andor with lymphoid cells (A). After 16-36 h of culture predominantly only single cells were stained with antibody R4/23 (B). AF'AAP staining; hemalum counterstaining.
Eur. J. Immunol. 1991. 21: 1873-1878
CD4-independent in v i m infection of FDC by ) w - 1
binding site [20]. After preincubation for 2 h, cells were subjected to HIV-1 infection. Proviral DNA was amplified and targeted as described above.
3 Results 3.1 Short-term culture of tonsil cells leads to disintegration of FDChymphocyte clusters
Immunostaining of interphase tonsil cells obtained by density gradient centrifugation revealed 5% -40% of R4/23+ FDC clusters which varied in size and cell type (Fig. 1A). After 16-36 h in culture under standard conditions, however, most of the clusters were spontaneously disintegrated and the majority of R4/23+ cells were single cells (Fig. 1B).
,001 0
8 uo
P
4
60
'I
40
0 20 1 20
80
40
90" Scatter
100
90" Scatter
I01
1875
3.2 Isolation of single-cell suspensions of viable FDC Short-term cultured tonsillar cells were immunostained with antibody R4/23 and with antibodies against CD4 and were sorted as described above. Fig. 2A demonstrates a typical dot plot analysis before the first sort. There were only two distinct cell populations, one of about 38% R4/23+ (green fluorescence, left panel), the other of about 28% CD4+ (red fluorescence, right panel). It is noteworthy that no double-stained cells could be detected. R4/23+ but CD4- cells were enriched by cell sorting and these cells were stained with PI. Fig. 2B demonstrates the dot plot cytograms of this fraction before the second cell sorting: 81.1% were R4/23+ (left panel), 7.7% proved to be dead cells as indicated by the strong PI-associated red fluorescence (upper population of the right panel). As elucidated by fluorescence microscopy, the lower weakly PI+ population consisted of PI+ cell debris and cells with PI attached to the cell membrane. There were still 6.1% contaminating CD4+ cells (right panel). R4/23+, but CD4- and PI- cells were further purified by a second sort. Fig. 2C shows the reanalysis of the cell suspension obtained: 93.3% were R4/23+ cells (left panel), and there was only 1% of strongly PI+ cells (right panel); no CD4+ cells could be detected in this fraction according to the FCM reanalysis (right panel). Furthermore, this R4/23+ cell population was completely negative for CD3 (data not shown). In selected experiments these FDC populationswere additionallydepleted of CD19+ and IgD+ cells and for controls we prepared R4/23-, CD4-, PI- cells.
Pi+
3.3 Susceptibility of FDC for HIV-1 infection in vitro 3.3.1 Detection of proviral DNA after in vitro infection of FDC with HIV-1
90" Scatter
90' Scatter
tool
--
1 1
20
Pi
+
L I
1 40
60
90" Scatter
00
100
1
20
40
60
00
100
90" Scatter
Figure 2. Preparation of highly purified cell suspensions of normal human FDC cell sorting. Short-term cultures with R4/23 (detected by green fluorescence) and antLCD4 antibody (detected by red fluorescence) and analyzed before sorting (A). In these cell suspensions no double-stained cells were detected (data not shown). The R4/23+ cells (green fluorescence above channel 20; red fluorescence below channel 2) were purified by cell sorting and subsequently stained with Pi (B). R4/23+, but CD4- and PI- cells were isolated by a second round of cell sorting. (C) Shows the reanalysis of this second sort: 93.3%were R4/23+cells (left paneI); only 1% were strongly PI+ (right panel). No CD4+ cells could be detected in this fraction according to the FCM reanalysis (right panel).
The cell suspensions prepared by cell sorting were subsequently infected with DNase-treated HTLV IIIB at an MOI of 0.5 and cells were analyzed by PCR on day 4. Fig. 3 demonstrates the susceptibilityof FDC for HIV-1infection using various cell numbers; lane 1 shows the positive control in which loo00 H9 cells were infected with HIV-1. Irrespective of whether loo00 (lane 2), 1000 (lane 3), 100 (lane 4) or 10 (lane 5 ) purified FDC were used we could detect proviral DNA, which was absent in all negative controls (lanes 6-11); proviral DNA was not found in lo00 H9 cells (lane 6) nor in 1000FDC (lane 7) which had been inoculated with heat-inactivated HIV-1. Furthermore 1000 cells of the R4/23-CD4-PI- control cell fraction subjected to active HIV-1 (lane 8) showed no hybridization signal. The same was true for untreated FDC alone (lane 9), DNase-treated HIV-1 alone (lane 10) and the PCR buffers used (lane 11). 3.3.2 Discriminiation of HIV-1 infectivity between R4/23+ and RUB- cells Since our sorted FDC contained 3%-8% R4/23- cells, it had to be excluded that these contaminating cells were responsible for the infection results obtained. For this purpose 20 cultures containing 10 or 100 celldculture were infected with DNase-treated HTLV IIIB.The same experiment was performed with R4/23- and CD4- sorted cells.
1876
Eur. J. Immunol. 1991.21: 1873-1878
I. Stahmer, J. P. Zimmer, M. Ernst et al.
Table 1. Number of HIV-1-infected cultures from R4/23+ and R4123- sorted cells
No. of Cell num- No. of HIV-1 cultures berlwell proviral DNA+ cultures
Cell source
R4/23+CD4-b'
10 10
R4/23-CD4-"
10 10
10 1M 10 100
Frequency of cultures containing no R4/23 cellsa)
10 10
5.1 x 10-1
0
6.1 x 10-5
- 0
1.2 x 10-3
3.7 x 10-43
The results of these experiments are presented in Thble 1. Statistical analysis was performed by a method similar to that used for limiting dilution analysis [21]. The frequency of cultures without R4/23- cells (Fo) was calculated by the Poisson formula: F O = ~ (m=the - ~ mean number of R4/23- cells per culture). In the experiment with 10 cells per culture the mean number of R4/23- cells was 0.67 and, therefore, the frequency of cultures without R4/23- cells was 51.1%, i.e. 5 out of 10 seeded cultures should not contain any R4/23- cells. If only the contaminating cells were responsible for the infection, proviral DNA should be detectable in only one half of the cultures. However, as shown in llible 1, all cultures were found to be infected. From that we conclude that contaminating cells were not responsible for the infection obtained. The same experiment was done with R4/23- and CD4- sorted control cells, which upon reanalysis were found to be 97.7% pure. If these cells were susceptible for HIV-1 infection, all these cultures should be positive for proviral DNA according to the Poisson formula. However, as demonstrated inllible 1, we found none of these cultures to be infected, which is additionalevidence that only the R4/23+ cells of our sorted' preparations were susceptible to HIV-1 infection. 3.4 Susceptibility of H9 cells and FDC to HIV-1 infection in the presence of anti-CD4 antibody OKT4a
Fig. 4 demonstrates that the HIV-1 infection of normal human FDC is CD4 independent. H9 cells or purified FDC
1 2 3 4
5
6
7 8 9 10 11
Figure 3. Susceptibility of various cell numbers of normal human FDC to HIV-1 infection. Proviral DNAwas amplified by PCR and detected by liquid hybridization. Lane 1: PCR of loo00 H9 cells infected with HIV-1; lane 2: PCR of 1Oo00, lane 3: 1o00, lane 4: 100,lane 5: 10purified FDC infected with HIV-1. Lane 6: loo0 H9 cells pretreated with heat-inactivated HIV-1. Lane 7: lo00 FDC pretreated with heat-inactivated HIV-1. Lane8: PCR of loo0 R4/23-CD4-PI- cell fraction treated with active HIV-1; lane 9: PCR of DNAse-treated HIV-1, lane 10: PCR of heat-inactivated HIV-1. Lane 11: buffer control.
a) Estimated according to the Poisson formula. b) R4/23+CD4- sorted cells with a purity of 93.3%. c) R4/23-CD4- sorted cells with a purity of 97.7%.
1 2 3 4 5 6 7 8 9 1011121314
.,
. )
Figure 4. Effect of anti-CD4 antibodies on HIV-1 infection of H9 cells and infection of isolated normal human FDC. Lanes 1-5: lo00 H9 cells pretreated with 10 pgml (l), 20 p g / d (?), 50 pg/ml (3), 100 pg/ml (4), 200 pglml (5) OKT4a antibody prior to infection. Lanes 6-10 show the same experiment with FDC. Lane 11:PCRof lo00 purified FDC additionally depleted of IgD+ and CD19+ cells incubated with heat-inactivated virus; lane 12: PCRof lo00 cells of the latter FDC population incubated with active HIV-1; lane 13: PCR of the latter FDC population pretreated with 200pg/d OKT4a prior to infection with active HIV-1. Lane 1 4 buffer control.
(103 cells) were preincubated for 2 h with different concentrations of OKT4a antibody and subsequently subjected to HIV-1 infection, and proviral DNA was targeted by PCR as described above. H9 cells pretreated with lOpg/ml of OKT4a still revealed proviral DNA after infection (lane l), whereas preincubation with 20 pg (lane 2), 50 pg (lane 3), 100 pg (lane 4) and 200 pg (lane 5 ) completely abolished infection of H9 cells. Lanes 6 to 10 demonstrate the same experiment with FDC. None of the OKT4a concentrations used, 10 pg (lane 6), 20 pg (lane 7), 50 pg (lane 8), lo0 pg (lane 9), 200 pg (lane 10) had any inhibitory effect on the susceptibility of FDC to W-1infection. Lanes 11 to 13 demonstrate experiments in which sorted FDC were additionally depleted of B cells (IgD+CD19+cells). While this cell population gave no signal with heat-inactivated virus (lane l l ) , proviral DNA could be demonstrated without (lane 12) or with 200 pg/ml OKT4a pretreatment of the cells (lane 13). Lane 14 demonstrates the buffer control of the latter experiments.Thus, in contrast to the infection of H9 cells the infection of FDC with HIV-1 cannot be inhibited by the anti-CD4 antibody OKT4a. 4 Discussion Earlier studies suggested that FDC might be an important virus reservoir [7-10,22-251. In the past, investigations of the mechanisms of infection have been hampered by the fact that protocols elaborated for isolation of FDC suffered from the major drawback that they only resulted in an enrichment of so-called FDC clusters [ll-14,261, i.e. FDC
Eur. J. Immunol. 1991. 21: 1873-1878
still attached to each other andor to lymphoid cells and M@, making it impossible to decide which cell type was the target for the virus [27]. The isolation procedure recently proposed by Nadler’s group [28] using cell sorting and anti-CD14 antibodies is also not appropriate for these investigations since CD14 is an integral component of many cells of the monocytoid/M@ cell lineage [29]. As demonstrated here these limitations could be overcome by using the antibody R4/23 (DRC-1) which is widely accepted as one of the most specific markers for FDC [6,11-14,22-271 in cell sorting. We are now able to prepare single-cell suspensions of FDC with purities 2 90% .Thus, for the first time investigations at the single-cell level of this cell type have become possible. By FCM analysis we could demonstrate that all cells which were found to be R4/23+ did not exhibit any reactivity with anti-CD4 antibody OKT4a. These results are in contrast to the data of Hancock and Atkins [30], who found weak immunoenzymatic CD4 reactivity on cells with dendritic morphology in germinal centers. However, in line with the data presented in this report for FDC isolated by sorting, we and other groups could not demonstrate CD4 positivity on FDC, neither in situ nor in isolated FDC clusters using a variety of immunoenzymatic staining methods [ l l , 26,31,32] including simultaneous double-labeling techniques [25].Thus, we assume that at least the majority of FDC are CD4-. Because relatively little is known concerning FDC, even PCR experiments assessing the rearrangement states of TcR genes could not yield a final proof of the purity of our FDC preparations. We, therefore, used CD4 negativity as a second discrimination parameter for sorting R4/23+ FDC. Using the sorting conditions for separating FDC we could demonstrate that normal human FDC are highly susceptible to HIV-1 infection in v i m . Furthermore, our results demonstrate that the in v i m infection of FDC is independent of the CD4 molecule. This observation has been also described for the infection of other cell types by HIV-1. Clapham et al. [33] found that brain and muscle cells could be infected with HIV-1 even in the presence of soluble CD4 or anti-CD4 antibody Leu3a and they concluded that the infection was not mediated via CD4. A CD44ndependent infection has also been reported in the presence of low levels of CD4 mRNA [34, 351. The precise mode of infection of FDC requires further investigation. CD4-independent HIV-1 infection mechanisms have been described: Larkin et al. [36] showed an infection via interactions of gp120 with carbohydrate moieties; others suggested that there may exist an alternative infection pathway which might be gp41 mediated [33]. Infection mechanisms via FcR or C receptors as proposed by Stein’s group [26] can be excluded for our in vitro model system, since our experiments were carried out in the absence of human anti-HIV-1 antibodies as well as active C components. Even though the precise mechanism of different infection by HIV-1 is not yet clear, our findings may shed light on the wide array of clinical symptoms which are thusfar regarded as a paradoxon, e.g. the frequent hypergammaglobulinemiaseen in AIDS-related complex (ARC) and AIDS patients. There are several reports suggesting a therapy of human HIV-1 infection by administration of soluble CD4 antigen [37, 381. It may well be that this therapeutic strategy leads to a prevention of infection of
CD4-independent in vitro infection of FDC by HIV-1
1877
susceptible CD4+ cells. However, this may increase the virus load of the germinal centers and FDC might more readily be infected and subsequently destroyed and depleted. In the light of our findings, it is tempting to assume that it is important to evaluate patients receiving such a therapy for FDC infection. Tonsils were kindly provided by Dr. Luhmann (Bad Segeberg, FRG).We thank Ilka Pidun, Bettina Barton and Renate Bergmann for excellent technical assistance.
Received February 6, 1991; in final revised form April 26, 1991.
5 References 1 Lennert, K., Kaiserling, E. and Muller-Hermelink, H. K., in Clarkson, B., Marks, l? A. andTill, J. (Eds.), Differentiation of normal and neoplastic hematopoietic cells, vol. 5, book B, Cold
Spring Harbor conferences on cell proliferation, Cold Spring Harbor 1978, p. 897. 2 Stein, H., Gerdes, J. and Mason, D.Y., Clin Haematol. 1982.3: 531. 3 Heinen, E., Corman, N. and Kinet-Denoel, C., Immunol. Today 1988. 9: 240. 4 Nossal, G. J.V., Abbot, A., Mitchell, J. and Lummus, Z., J. Exp. Med. 1968. 127: 277. 5 Klaus, G. G. B., Humphrey, J. H., Kunkl, A. and Dongworth, D. W., Immunol. Rev. 1980. 53: 3. 6 Naiem, M., Gerdes, J., Abdulaziz, Z., Stein, H. and Mason, D. Y., J. Clin. Pathol. 1983. 36: 167. 7 Tenner-RBcz, K., RAcz, l?, Dietrich, M. and Kern, P., Lancet 1985. i: 105. 8 Pileri, S., Rivano, M. T., Raise, E., Gualandi, G., Gobbi, M., Martuzzi, M., Gritti, F. M., Gerdes, J. and Stein, H., Histopathology 1986. 10: 1107. 9 Piris, M. A., Rivas, C., Morente, M., Rubio, C., Martin, C. and Olivia, H., A m . J. Clin. Pathol. 1987. 87: 716. 10 Armstrong, J. A. and Home, R., Lancet 1984. ii: 370. 11 Gerdes, J., Stein, H., Mason, D.Y. and Ziegler, A., Virchows Arch. [B] 1983. 42: 161. 12 Lilet-Leclercq,C., Radoux, D., Heinen, E., Kinet-Denoel, D., and Simar, L. J., J. Defraigne, J.-O., Houben-Defresne, M.-€! Immunol. Methods 1984. 66: 235. 13 Heinen, E., Lilet-Leclercq, C., Mason, D. Y., Stein, H., Boniver, J., Radoux, D., Kinet-Denoel, C. and Simar, L. J., Eur. J. Immunol. 1984. 14: 261. 14 Heinen, E., Braun, M., Louis, E., Cormann, N. ,Tsunoda, R., Kinet-Denoel, C., Lesage, F. and Simar, L. J., Adv. Exp. Med. Biol. 1988. 237: 181. 15 Cordell, J. L., Falini, B., Erber,W. N., Gosh, A. K., Abdulaziz, Z., MacDonald, S., hlford, K. A. F., Stein, H. and Mason, D. Y., J. Histochem. Cytochem. 1984.32: 219. 16 Parks, D. R., Hardy, R. R. and Herzenberg, L. A., Immunol. Today 1983. 4: 145. 17 Dorken, B., Moller, l?, Pezzutto, A., Schwartz-Albiez, R. and Moldenhauer, G., in Knapp, W. et al. (Eds.), Leucoyte Typing IV White Cell Differentiation Antigens, Oxford University Press, Oxford 1989, p. 34. 18 Popovic, M., Samgadharan, M. G., Read, E. and Gallo, R., Science 1984. 224: 497. 19 Ou, C.-Y., Kwok, S., Mitchell, S.W., Mack, D. H., Sninsky, S., Krebs, J. W., Feorino, F., Warfield, D. and Schochetman, G.. Science 1988. 239: 295. 20 Maddon, P. J., Dalgleish, A. G., McDougal, S. J., Clapham, P. R., Weiss, R. A. and Axel, R., Cell 1986. 47: 333. 21 Henry, C., Marbrook, J.,Vann, C., Kodlin, D. and Wofsy, C., in Mishell, B. B. and Shiigi, S. M. (Eds.), Selected methods in cellular immunology, W. H. Freeman and Co., San Francisco 1980, p. 138.
1878
I. Stahmer, J. F’. Zimmer, M. Ernst et al.
22 Schuurman, H.-J., Kluin, P.M., Gmelig-Meijlmg, E H. J. ,Van Unnik, J. A . M. and Kater, L., J. Pathol. 1985. 147: 269. 23 RAcz, F’.,Tenner-&cz, K., Kahl, C., Feller, A . C., Kern, I? and Dietrich, M., Prog. Allergy 1985. 37: 81. 24 Tenner-==, K., RAcz, I?, Schmidt, H., Dietrich, M., Kern, F!, Louie, A . , Gartner, S. and Popovic, M., AIDS 1988. 2: 299. 25 Tenner-&=, K., Bofill, H., Schulz-Meyer, A., Dietrich, M., Kern, I?, Weber, J., Pinching, A. J., Wernose-Dimarzo, F., Popovic, M., Klatzmann, O., Gluckman, J. C. and Janossy, G., Am. J. Pathol. 1986. 123: 9. 26 Sellheyer, K., Schwarting, R. and Stein, H., Clin. Exp. Immunol. 1989. 78: 431. 27 Biberfeld, I?, Chayt, K. J., Marselle, L. M., Biberfeld, G., Gallo, R. C. and Harper, M. E., Am. J. Pathol. 1986. 123: 436. 28 Schriever,F., Freedman, A . S., Freeman, G., Messner, E., Lee, G., Daley, J. and Nadler, L. M., J. Exp. Med. 1989. 169: 2043. 29 Hogg, N. and Norton, M. A . , in McMichael, A . J. et al. (Eds.), Leucocyfe typing III, Oxford University Press, Oxford 1987, p. 576. 30 Hancock,W.W. and Atkins, R. C., Transplant. Proc. 1984.16: 963.
Eur. J. Immunol. 1991. 21: 1873-1878 31 Van der Valk,I? ,Van der Loo, E. M., Janssen, J., Daha, M. R. and Meijer, C. J. L. M., VirchowArch. [B] 1984. 45: 169. 32 Petrasch, S., Perez-Alvarez, C., Schmitz, J., KOSCO,M. and Brittinger, G., Eur. J. Immunol. 1990. 20: 1013. 33 Clapham, P. R., Weber, J. N., Whitby, D., McIntosh, K., Dalgleish, A. G., Maddon, P. J., Deen, K. C., Sweet, R.W. and Weiss, R. A . , Nature 1990. 337: 368. 34 Monroe, J. E., Calender, A. and Mulder, C., J. Virol. 1988. 62: 3497. 35 Malkovsky, M., Philpott, K., Dalgleish, A . G., Mellor, A., Patterson, S. ,Webster, A . D. B., Edwards, A . J. and Maddon, RJ., Eur. J. Immunol. 1988. 18: 1315. 36 Larkin, M., Childs, R. A . ,Matthews,T. J.,Thiel, S., Mizouchi, T., Lawson, A. M., Savill, J. S., Haslett, C, Diaz, R. and Feizi, T., AIDS 1989. 3: 793. 37 llaunecker, A., Luke, W. and Karjalainen, K., Nature 1988. 331: 84. 38 Fisher, R. A . , Bertonis, J. M., Meier, W., Johnson, V. A . , Costopoulos, D. S., Liu, T.,Tizard, R., Walker, B. D., Hirsch, M. S., Schooley, R. T. and Flavell, R. A.,Nature 1988. 331: 76.
Fur. J. I m n i u n o l . 1 W 1 . 21; 1873-1878
Ingrid Stahmer, J. Pascal Zimmer , Martin Emst,
lhomas Iiehner - , Ricarda Finnem , Herbert Schmitz , Hans-D. Flad and Johannes Gerdes
Forschungsinstitut Borstel, Department of Immunology and Cell Biology, Borstel and Bernhard-Nocht-lnstituto,
Department of Virology, Hamburg
1873
Isolation of normal human follicular dendritic cells and CD44ndependent in vitro infection by human immunodeficiency virus (HIV-1)" Immunohistological and electron microscopy studies of lymph nodes from patients infected with the human immunodeficiency virus 1 (HIV-1) demonstrated that follicular dendritic cells (FDC), the antigen-presentingcells of the B cell system, contain and may produce the virus. To elucidate the mode of infection of FDC with HIV-1 in vitro we developed an improved method for the preparation of single-cell suspensions of viable FDC with high purity (>90% FDC).These isolated FDC were subjected to human Tcell leukemia virus IIIB infection,which was monitored after 4 days in culture using the polymerase chain reaction. We were able to demonstrate that normal human FDC are highly susceptible to infection by HIV-1. Inhibition experiments with the monoclonal antibody OKT4a demonstrate that this infection is independent of the CD4 molecule.
1 Introduction
2 Materials and methods
The B cell-dependent areas of human lymphoid tissue contain non-lymphoid non-phagocyticcells known as follicular dendriticcells (FDC; for reviews see [l-31). Because of their accessory functions, e.g. antigen trapping [4], these cells are essential for the germinal center reaction including the memory B cell formation [5]. FDC cannot readily be stained by routine histological methods, but can be detected by using the antibody R4/23 (DRC-l), which specifically reacts with FDC [6]. Immunohistological and electron microscopy studies demonstrated HIV-1 infection and virus budding of FDC [7-lo]. Therefore, it was suggested that these cells may play an important role in the pathogenesis of AIDS as a major virus reservoir, where infection of susceptible and permissive cells may occur continuously.Thus, there is an objective need for a better understanding of the mode of infection of FDCwith HIV-1. A prerequisite to investigate the infection mechanism is an in vitro system with isolated FDC. However, thusfar, preparation of FDC from normal lymphoid tissue yielded in cell suspensions containing only 10% to 50% FDC clusters with the FDC still being aggregated with each other and/or with lymphoid cells [ 5 , 11-14].Thus, the aim of our study was to develop a technique for the preparation of highly pure single-cell suspensionsof viable FDC and to elucidate whether these cells might be susceptible to HIV-1infection in vitro.
2.1 Preparation of tonsil cells
[I92811
Human tonsils obtained from healthy children by nonurgent tonsillectomy were minced and passed through a nylon mesh, washed three times in PBS followed by density gradient centrifugation on Ficoll sodium metrizoate. Cells of the interphase were washed three times in PBS containing 100 U/mlpenidin, 100 p g / d streptomycinand kept in culture under standard conditions in RPMI 1640 medium supplemented with 10% FCS. 2.2 Immunoeuzymatic staining Cytocentrifuge preparations of the interphase cell suspension and of cultured cells were immunostained with the R4/23 [6,11], and bound antibody alkaline-anti-alkaline phosphatase (APAAP) method as described [lS]. The APAAP immunostainings were controlled by (a) the use of secondary reagents only to confirm their species specificity; (b) the development of alkaline phosphatase alone to preclude staining due to endogenous enzyme activity and (c) by the use of murine primary isotype-matched control mAb with unrelated specificities against the target cells. All these controls consistently yielded the expected negative results and are thus not mentioned any more in the following.
2.3 Purification of viable FDC and depletion of CD4+ cells
* This work was supported by the Bundesministerium fiir For- Short-term cultures of the tonsillar cell interphase fraction schung und Technologie: AIDS Forschungsverbund Hamburg, Projekt A2.
Correspondence: Johanna Gerdes, Forschungsinstitut Borstel, Division Molecular Immunology, Parkallee 22, D-2061 Borstel, FRG
Abbreviations: FCD: Follicular dendritic cell HTLV: Human T-lymphocytotropicvirus MOI: Multiplicity of infection PCR: Polymerase chain reaction PI: Propidium iodide 0 VCH Verlagsgesellschaft mbH, D-6940 Weinheim, 1991
were incubated with antibody R4/23 which is of IgM class and a PE-conjugated mouse I@ anti-CD4 antibody (Dako, Hamburg, FRG). After three washes bound R4/23 was targeted with affinity-purified dchlorotriazinyl amino fluorescein (DTAF)-labeled F(ab')z fragments of goat anti-mouse IgM antibodies (Dianova, Hamburg, FRG). R4/23+CD4- cells were separated by cell sorting using a cytofluorograf system SOH (Ortho, Raritan, NY). The 0014-2980/91/0808-1873$3.50+ .25/0
1874
I. Stahmer, J. I? Zimmer, M. Ernst et al.
Eur. J. Immunol. 1991.21: 1873-1878
culture cells were lysed and PCR was performed using the primer pair SK 38 (ATAATCCACCTATCCCAGTAGGAGAGAAAT)/SK 39 (TITGGTCCTTGTCITATGTCCAGAATGC) [19]. For the amplification of previral DNA 15 pl of cell extracts was added to the amplificationmixture consisting of 50 pmol of each primer, 200 nm dNTP in 10 nm Tris-HC1, pH 8.3, supplemented with 50 nm KCl, 2 . 5 m ~MgC12, 0.02% gelatin and 2 U of Themzophilus aquaticus polymerase (Perkin-Elmer, Uberlingen, FRG). Thirty-five polymerase chain reaction (PCR) cycles were carried out on a DNAThermal Cycler (Perkin-Elmer)using the following conditions: (a) denaturation at 95 "C for 30 s; As the presence of certain B cell markers is still contro- (b) annealing at 56°C for 30 s; (c) elongation at 68°C for versial [17], in selected experiments, putatively contami- 120 s. The amplified fragment was specifically detected nating B cells were excluded by cell sorting after immuno- by liquid hybridization using a 32Pend-labeled SK 19 olistaining of the R4/23+, but CD4- and PI- cells with gonucleotide ATCCTGGGATTAAATAAAATAGTAAantibodies against CD19 (anti-CD19, Dako) and anti-IgD GAATGTATAGCCCTAC as probe [19]. Hybridization (Dianova). For control experiments R4/23-CD4- cells was carried out at 56°C for 30 min and subsequently 10 pl were isolated by cell sorting and used for in vitro infec- of each sample was separated on a 15% polyacrylamide gel, tion. which was subjected to autoradiography using Kodak X-Omat film at -70°C for 3 h.
sorting criteria were as follows: thresholds of 90" scatter and forward scatter were optimized for the scatter parameters of R4/23+ cells. Furthermore, lower threshold for green fluorescence was set to channel 20, whereas upper threshold for red fluorescence was set to channel 2. Cells obtained by this first sort were subsequently stained with propidium iodide (PI) [16]. To exclude dead cells (strong PI-dependent red fluorescence)we performed a second sort with the same criteria as those of the first sort. This second sort results in a cell population highly enriched in R4/23+CD4- and PI- cells.
2.4 HIV infection and detection of proviral DNA 2.5 Preincubation with anti-CD4 antibody
Highly purified FDC as well as cells from the T cell line H9 were infected at a MOI (multiplicityof infection) of 0.5 with human Tcell leukemia virus (HTLV) IIIB [18] which was treated with DNase prior to application. After 4 days in
H9 cells or purified FDC (lo3cells) were preincubated with different concentrations of OKT4a antibody (Ortho, Nekkargemund, FRG) which specifically reacts with the gp120
Figure I. Immunostaining with R4/23 of cytocentrifuge preparation of tonsillar cell suspensions enriched in FDC. After density gradient centrifugation R4/23+ cells were clustered with each other andor with lymphoid cells (A). After 16-36 h of culture predominantly only single cells were stained with antibody R4/23 (B). AF'AAP staining; hemalum counterstaining.
Eur. J. Immunol. 1991. 21: 1873-1878
CD4-independent in v i m infection of FDC by ) w - 1
binding site [20]. After preincubation for 2 h, cells were subjected to HIV-1 infection. Proviral DNA was amplified and targeted as described above.
3 Results 3.1 Short-term culture of tonsil cells leads to disintegration of FDChymphocyte clusters
Immunostaining of interphase tonsil cells obtained by density gradient centrifugation revealed 5% -40% of R4/23+ FDC clusters which varied in size and cell type (Fig. 1A). After 16-36 h in culture under standard conditions, however, most of the clusters were spontaneously disintegrated and the majority of R4/23+ cells were single cells (Fig. 1B).
,001 0
8 uo
P
4
60
'I
40
0 20 1 20
80
40
90" Scatter
100
90" Scatter
I01
1875
3.2 Isolation of single-cell suspensions of viable FDC Short-term cultured tonsillar cells were immunostained with antibody R4/23 and with antibodies against CD4 and were sorted as described above. Fig. 2A demonstrates a typical dot plot analysis before the first sort. There were only two distinct cell populations, one of about 38% R4/23+ (green fluorescence, left panel), the other of about 28% CD4+ (red fluorescence, right panel). It is noteworthy that no double-stained cells could be detected. R4/23+ but CD4- cells were enriched by cell sorting and these cells were stained with PI. Fig. 2B demonstrates the dot plot cytograms of this fraction before the second cell sorting: 81.1% were R4/23+ (left panel), 7.7% proved to be dead cells as indicated by the strong PI-associated red fluorescence (upper population of the right panel). As elucidated by fluorescence microscopy, the lower weakly PI+ population consisted of PI+ cell debris and cells with PI attached to the cell membrane. There were still 6.1% contaminating CD4+ cells (right panel). R4/23+, but CD4- and PI- cells were further purified by a second sort. Fig. 2C shows the reanalysis of the cell suspension obtained: 93.3% were R4/23+ cells (left panel), and there was only 1% of strongly PI+ cells (right panel); no CD4+ cells could be detected in this fraction according to the FCM reanalysis (right panel). Furthermore, this R4/23+ cell population was completely negative for CD3 (data not shown). In selected experiments these FDC populationswere additionallydepleted of CD19+ and IgD+ cells and for controls we prepared R4/23-, CD4-, PI- cells.
Pi+
3.3 Susceptibility of FDC for HIV-1 infection in vitro 3.3.1 Detection of proviral DNA after in vitro infection of FDC with HIV-1
90" Scatter
90' Scatter
tool
--
1 1
20
Pi
+
L I
1 40
60
90" Scatter
00
100
1
20
40
60
00
100
90" Scatter
Figure 2. Preparation of highly purified cell suspensions of normal human FDC cell sorting. Short-term cultures with R4/23 (detected by green fluorescence) and antLCD4 antibody (detected by red fluorescence) and analyzed before sorting (A). In these cell suspensions no double-stained cells were detected (data not shown). The R4/23+ cells (green fluorescence above channel 20; red fluorescence below channel 2) were purified by cell sorting and subsequently stained with Pi (B). R4/23+, but CD4- and PI- cells were isolated by a second round of cell sorting. (C) Shows the reanalysis of this second sort: 93.3%were R4/23+cells (left paneI); only 1% were strongly PI+ (right panel). No CD4+ cells could be detected in this fraction according to the FCM reanalysis (right panel).
The cell suspensions prepared by cell sorting were subsequently infected with DNase-treated HTLV IIIB at an MOI of 0.5 and cells were analyzed by PCR on day 4. Fig. 3 demonstrates the susceptibilityof FDC for HIV-1infection using various cell numbers; lane 1 shows the positive control in which loo00 H9 cells were infected with HIV-1. Irrespective of whether loo00 (lane 2), 1000 (lane 3), 100 (lane 4) or 10 (lane 5 ) purified FDC were used we could detect proviral DNA, which was absent in all negative controls (lanes 6-11); proviral DNA was not found in lo00 H9 cells (lane 6) nor in 1000FDC (lane 7) which had been inoculated with heat-inactivated HIV-1. Furthermore 1000 cells of the R4/23-CD4-PI- control cell fraction subjected to active HIV-1 (lane 8) showed no hybridization signal. The same was true for untreated FDC alone (lane 9), DNase-treated HIV-1 alone (lane 10) and the PCR buffers used (lane 11). 3.3.2 Discriminiation of HIV-1 infectivity between R4/23+ and RUB- cells Since our sorted FDC contained 3%-8% R4/23- cells, it had to be excluded that these contaminating cells were responsible for the infection results obtained. For this purpose 20 cultures containing 10 or 100 celldculture were infected with DNase-treated HTLV IIIB.The same experiment was performed with R4/23- and CD4- sorted cells.
1876
Eur. J. Immunol. 1991.21: 1873-1878
I. Stahmer, J. P. Zimmer, M. Ernst et al.
Table 1. Number of HIV-1-infected cultures from R4/23+ and R4123- sorted cells
No. of Cell num- No. of HIV-1 cultures berlwell proviral DNA+ cultures
Cell source
R4/23+CD4-b'
10 10
R4/23-CD4-"
10 10
10 1M 10 100
Frequency of cultures containing no R4/23 cellsa)
10 10
5.1 x 10-1
0
6.1 x 10-5
- 0
1.2 x 10-3
3.7 x 10-43
The results of these experiments are presented in Thble 1. Statistical analysis was performed by a method similar to that used for limiting dilution analysis [21]. The frequency of cultures without R4/23- cells (Fo) was calculated by the Poisson formula: F O = ~ (m=the - ~ mean number of R4/23- cells per culture). In the experiment with 10 cells per culture the mean number of R4/23- cells was 0.67 and, therefore, the frequency of cultures without R4/23- cells was 51.1%, i.e. 5 out of 10 seeded cultures should not contain any R4/23- cells. If only the contaminating cells were responsible for the infection, proviral DNA should be detectable in only one half of the cultures. However, as shown in llible 1, all cultures were found to be infected. From that we conclude that contaminating cells were not responsible for the infection obtained. The same experiment was done with R4/23- and CD4- sorted control cells, which upon reanalysis were found to be 97.7% pure. If these cells were susceptible for HIV-1 infection, all these cultures should be positive for proviral DNA according to the Poisson formula. However, as demonstrated inllible 1, we found none of these cultures to be infected, which is additionalevidence that only the R4/23+ cells of our sorted' preparations were susceptible to HIV-1 infection. 3.4 Susceptibility of H9 cells and FDC to HIV-1 infection in the presence of anti-CD4 antibody OKT4a
Fig. 4 demonstrates that the HIV-1 infection of normal human FDC is CD4 independent. H9 cells or purified FDC
1 2 3 4
5
6
7 8 9 10 11
Figure 3. Susceptibility of various cell numbers of normal human FDC to HIV-1 infection. Proviral DNAwas amplified by PCR and detected by liquid hybridization. Lane 1: PCR of loo00 H9 cells infected with HIV-1; lane 2: PCR of 1Oo00, lane 3: 1o00, lane 4: 100,lane 5: 10purified FDC infected with HIV-1. Lane 6: loo0 H9 cells pretreated with heat-inactivated HIV-1. Lane 7: lo00 FDC pretreated with heat-inactivated HIV-1. Lane8: PCR of loo0 R4/23-CD4-PI- cell fraction treated with active HIV-1; lane 9: PCR of DNAse-treated HIV-1, lane 10: PCR of heat-inactivated HIV-1. Lane 11: buffer control.
a) Estimated according to the Poisson formula. b) R4/23+CD4- sorted cells with a purity of 93.3%. c) R4/23-CD4- sorted cells with a purity of 97.7%.
1 2 3 4 5 6 7 8 9 1011121314
.,
. )
Figure 4. Effect of anti-CD4 antibodies on HIV-1 infection of H9 cells and infection of isolated normal human FDC. Lanes 1-5: lo00 H9 cells pretreated with 10 pgml (l), 20 p g / d (?), 50 pg/ml (3), 100 pg/ml (4), 200 pglml (5) OKT4a antibody prior to infection. Lanes 6-10 show the same experiment with FDC. Lane 11:PCRof lo00 purified FDC additionally depleted of IgD+ and CD19+ cells incubated with heat-inactivated virus; lane 12: PCRof lo00 cells of the latter FDC population incubated with active HIV-1; lane 13: PCR of the latter FDC population pretreated with 200pg/d OKT4a prior to infection with active HIV-1. Lane 1 4 buffer control.
(103 cells) were preincubated for 2 h with different concentrations of OKT4a antibody and subsequently subjected to HIV-1 infection, and proviral DNA was targeted by PCR as described above. H9 cells pretreated with lOpg/ml of OKT4a still revealed proviral DNA after infection (lane l), whereas preincubation with 20 pg (lane 2), 50 pg (lane 3), 100 pg (lane 4) and 200 pg (lane 5 ) completely abolished infection of H9 cells. Lanes 6 to 10 demonstrate the same experiment with FDC. None of the OKT4a concentrations used, 10 pg (lane 6), 20 pg (lane 7), 50 pg (lane 8), lo0 pg (lane 9), 200 pg (lane 10) had any inhibitory effect on the susceptibility of FDC to W-1infection. Lanes 11 to 13 demonstrate experiments in which sorted FDC were additionally depleted of B cells (IgD+CD19+cells). While this cell population gave no signal with heat-inactivated virus (lane l l ) , proviral DNA could be demonstrated without (lane 12) or with 200 pg/ml OKT4a pretreatment of the cells (lane 13). Lane 14 demonstrates the buffer control of the latter experiments.Thus, in contrast to the infection of H9 cells the infection of FDC with HIV-1 cannot be inhibited by the anti-CD4 antibody OKT4a. 4 Discussion Earlier studies suggested that FDC might be an important virus reservoir [7-10,22-251. In the past, investigations of the mechanisms of infection have been hampered by the fact that protocols elaborated for isolation of FDC suffered from the major drawback that they only resulted in an enrichment of so-called FDC clusters [ll-14,261, i.e. FDC
Eur. J. Immunol. 1991. 21: 1873-1878
still attached to each other andor to lymphoid cells and M@, making it impossible to decide which cell type was the target for the virus [27]. The isolation procedure recently proposed by Nadler’s group [28] using cell sorting and anti-CD14 antibodies is also not appropriate for these investigations since CD14 is an integral component of many cells of the monocytoid/M@ cell lineage [29]. As demonstrated here these limitations could be overcome by using the antibody R4/23 (DRC-1) which is widely accepted as one of the most specific markers for FDC [6,11-14,22-271 in cell sorting. We are now able to prepare single-cell suspensions of FDC with purities 2 90% .Thus, for the first time investigations at the single-cell level of this cell type have become possible. By FCM analysis we could demonstrate that all cells which were found to be R4/23+ did not exhibit any reactivity with anti-CD4 antibody OKT4a. These results are in contrast to the data of Hancock and Atkins [30], who found weak immunoenzymatic CD4 reactivity on cells with dendritic morphology in germinal centers. However, in line with the data presented in this report for FDC isolated by sorting, we and other groups could not demonstrate CD4 positivity on FDC, neither in situ nor in isolated FDC clusters using a variety of immunoenzymatic staining methods [ l l , 26,31,32] including simultaneous double-labeling techniques [25].Thus, we assume that at least the majority of FDC are CD4-. Because relatively little is known concerning FDC, even PCR experiments assessing the rearrangement states of TcR genes could not yield a final proof of the purity of our FDC preparations. We, therefore, used CD4 negativity as a second discrimination parameter for sorting R4/23+ FDC. Using the sorting conditions for separating FDC we could demonstrate that normal human FDC are highly susceptible to HIV-1 infection in v i m . Furthermore, our results demonstrate that the in v i m infection of FDC is independent of the CD4 molecule. This observation has been also described for the infection of other cell types by HIV-1. Clapham et al. [33] found that brain and muscle cells could be infected with HIV-1 even in the presence of soluble CD4 or anti-CD4 antibody Leu3a and they concluded that the infection was not mediated via CD4. A CD44ndependent infection has also been reported in the presence of low levels of CD4 mRNA [34, 351. The precise mode of infection of FDC requires further investigation. CD4-independent HIV-1 infection mechanisms have been described: Larkin et al. [36] showed an infection via interactions of gp120 with carbohydrate moieties; others suggested that there may exist an alternative infection pathway which might be gp41 mediated [33]. Infection mechanisms via FcR or C receptors as proposed by Stein’s group [26] can be excluded for our in vitro model system, since our experiments were carried out in the absence of human anti-HIV-1 antibodies as well as active C components. Even though the precise mechanism of different infection by HIV-1 is not yet clear, our findings may shed light on the wide array of clinical symptoms which are thusfar regarded as a paradoxon, e.g. the frequent hypergammaglobulinemiaseen in AIDS-related complex (ARC) and AIDS patients. There are several reports suggesting a therapy of human HIV-1 infection by administration of soluble CD4 antigen [37, 381. It may well be that this therapeutic strategy leads to a prevention of infection of
CD4-independent in vitro infection of FDC by HIV-1
1877
susceptible CD4+ cells. However, this may increase the virus load of the germinal centers and FDC might more readily be infected and subsequently destroyed and depleted. In the light of our findings, it is tempting to assume that it is important to evaluate patients receiving such a therapy for FDC infection. Tonsils were kindly provided by Dr. Luhmann (Bad Segeberg, FRG).We thank Ilka Pidun, Bettina Barton and Renate Bergmann for excellent technical assistance.
Received February 6, 1991; in final revised form April 26, 1991.
5 References 1 Lennert, K., Kaiserling, E. and Muller-Hermelink, H. K., in Clarkson, B., Marks, l? A. andTill, J. (Eds.), Differentiation of normal and neoplastic hematopoietic cells, vol. 5, book B, Cold
Spring Harbor conferences on cell proliferation, Cold Spring Harbor 1978, p. 897. 2 Stein, H., Gerdes, J. and Mason, D.Y., Clin Haematol. 1982.3: 531. 3 Heinen, E., Corman, N. and Kinet-Denoel, C., Immunol. Today 1988. 9: 240. 4 Nossal, G. J.V., Abbot, A., Mitchell, J. and Lummus, Z., J. Exp. Med. 1968. 127: 277. 5 Klaus, G. G. B., Humphrey, J. H., Kunkl, A. and Dongworth, D. W., Immunol. Rev. 1980. 53: 3. 6 Naiem, M., Gerdes, J., Abdulaziz, Z., Stein, H. and Mason, D. Y., J. Clin. Pathol. 1983. 36: 167. 7 Tenner-RBcz, K., RAcz, l?, Dietrich, M. and Kern, P., Lancet 1985. i: 105. 8 Pileri, S., Rivano, M. T., Raise, E., Gualandi, G., Gobbi, M., Martuzzi, M., Gritti, F. M., Gerdes, J. and Stein, H., Histopathology 1986. 10: 1107. 9 Piris, M. A., Rivas, C., Morente, M., Rubio, C., Martin, C. and Olivia, H., A m . J. Clin. Pathol. 1987. 87: 716. 10 Armstrong, J. A. and Home, R., Lancet 1984. ii: 370. 11 Gerdes, J., Stein, H., Mason, D.Y. and Ziegler, A., Virchows Arch. [B] 1983. 42: 161. 12 Lilet-Leclercq,C., Radoux, D., Heinen, E., Kinet-Denoel, D., and Simar, L. J., J. Defraigne, J.-O., Houben-Defresne, M.-€! Immunol. Methods 1984. 66: 235. 13 Heinen, E., Lilet-Leclercq, C., Mason, D. Y., Stein, H., Boniver, J., Radoux, D., Kinet-Denoel, C. and Simar, L. J., Eur. J. Immunol. 1984. 14: 261. 14 Heinen, E., Braun, M., Louis, E., Cormann, N. ,Tsunoda, R., Kinet-Denoel, C., Lesage, F. and Simar, L. J., Adv. Exp. Med. Biol. 1988. 237: 181. 15 Cordell, J. L., Falini, B., Erber,W. N., Gosh, A. K., Abdulaziz, Z., MacDonald, S., hlford, K. A. F., Stein, H. and Mason, D. Y., J. Histochem. Cytochem. 1984.32: 219. 16 Parks, D. R., Hardy, R. R. and Herzenberg, L. A., Immunol. Today 1983. 4: 145. 17 Dorken, B., Moller, l?, Pezzutto, A., Schwartz-Albiez, R. and Moldenhauer, G., in Knapp, W. et al. (Eds.), Leucoyte Typing IV White Cell Differentiation Antigens, Oxford University Press, Oxford 1989, p. 34. 18 Popovic, M., Samgadharan, M. G., Read, E. and Gallo, R., Science 1984. 224: 497. 19 Ou, C.-Y., Kwok, S., Mitchell, S.W., Mack, D. H., Sninsky, S., Krebs, J. W., Feorino, F., Warfield, D. and Schochetman, G.. Science 1988. 239: 295. 20 Maddon, P. J., Dalgleish, A. G., McDougal, S. J., Clapham, P. R., Weiss, R. A. and Axel, R., Cell 1986. 47: 333. 21 Henry, C., Marbrook, J.,Vann, C., Kodlin, D. and Wofsy, C., in Mishell, B. B. and Shiigi, S. M. (Eds.), Selected methods in cellular immunology, W. H. Freeman and Co., San Francisco 1980, p. 138.
1878
I. Stahmer, J. F’. Zimmer, M. Ernst et al.
22 Schuurman, H.-J., Kluin, P.M., Gmelig-Meijlmg, E H. J. ,Van Unnik, J. A . M. and Kater, L., J. Pathol. 1985. 147: 269. 23 RAcz, F’.,Tenner-&cz, K., Kahl, C., Feller, A . C., Kern, I? and Dietrich, M., Prog. Allergy 1985. 37: 81. 24 Tenner-==, K., RAcz, I?, Schmidt, H., Dietrich, M., Kern, F!, Louie, A . , Gartner, S. and Popovic, M., AIDS 1988. 2: 299. 25 Tenner-&=, K., Bofill, H., Schulz-Meyer, A., Dietrich, M., Kern, I?, Weber, J., Pinching, A. J., Wernose-Dimarzo, F., Popovic, M., Klatzmann, O., Gluckman, J. C. and Janossy, G., Am. J. Pathol. 1986. 123: 9. 26 Sellheyer, K., Schwarting, R. and Stein, H., Clin. Exp. Immunol. 1989. 78: 431. 27 Biberfeld, I?, Chayt, K. J., Marselle, L. M., Biberfeld, G., Gallo, R. C. and Harper, M. E., Am. J. Pathol. 1986. 123: 436. 28 Schriever,F., Freedman, A . S., Freeman, G., Messner, E., Lee, G., Daley, J. and Nadler, L. M., J. Exp. Med. 1989. 169: 2043. 29 Hogg, N. and Norton, M. A . , in McMichael, A . J. et al. (Eds.), Leucocyfe typing III, Oxford University Press, Oxford 1987, p. 576. 30 Hancock,W.W. and Atkins, R. C., Transplant. Proc. 1984.16: 963.
Eur. J. Immunol. 1991. 21: 1873-1878 31 Van der Valk,I? ,Van der Loo, E. M., Janssen, J., Daha, M. R. and Meijer, C. J. L. M., VirchowArch. [B] 1984. 45: 169. 32 Petrasch, S., Perez-Alvarez, C., Schmitz, J., KOSCO,M. and Brittinger, G., Eur. J. Immunol. 1990. 20: 1013. 33 Clapham, P. R., Weber, J. N., Whitby, D., McIntosh, K., Dalgleish, A. G., Maddon, P. J., Deen, K. C., Sweet, R.W. and Weiss, R. A . , Nature 1990. 337: 368. 34 Monroe, J. E., Calender, A. and Mulder, C., J. Virol. 1988. 62: 3497. 35 Malkovsky, M., Philpott, K., Dalgleish, A . G., Mellor, A., Patterson, S. ,Webster, A . D. B., Edwards, A . J. and Maddon, RJ., Eur. J. Immunol. 1988. 18: 1315. 36 Larkin, M., Childs, R. A . ,Matthews,T. J.,Thiel, S., Mizouchi, T., Lawson, A. M., Savill, J. S., Haslett, C, Diaz, R. and Feizi, T., AIDS 1989. 3: 793. 37 llaunecker, A., Luke, W. and Karjalainen, K., Nature 1988. 331: 84. 38 Fisher, R. A . , Bertonis, J. M., Meier, W., Johnson, V. A . , Costopoulos, D. S., Liu, T.,Tizard, R., Walker, B. D., Hirsch, M. S., Schooley, R. T. and Flavell, R. A.,Nature 1988. 331: 76.
