Protein Expression and Purification 95 (2014) 219–225

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Kinetic characterization of recombinant Bacillus coagulans FDP-activated L-lactate dehydrogenase expressed in Escherichia coli and its substrate specificity Ting Jiang a, Yanbing Xu b, Xiucheng Sun b, Zhaojuan Zheng a, Jia Ouyang a,⇑ a b

College of Chemical Engineering, Nanjing Forestry University, Nanjing 210037, People’s Republic of China College of Forest Resources Environment, Nanjing Forestry University, Nanjing 210037, People’s Republic of China

a r t i c l e

i n f o

Article history: Received 14 October 2013 and in revised form 13 December 2013 Available online 8 January 2014 Keywords: Bacillus coagulans L-Lactate dehydrogenase Fructose 1,6-diphosphate Enzymatic properties Pyruvate esters

a b s t r a c t Bacillus coagulans is a homofermentative, acid-tolerant and thermophilic sporogenic lactic acid bacterium, which is capable of producing high yields of optically pure lactic acid. The L-(+)-lactate dehydrogenase (L-LDH) from B. coagulans is considered as an ideal biocatalyst for industrial production. In this study, the gene ldhL encoding a thermostable L-LDH was amplified from B. coagulans NL01 genomic DNA and successfully expressed in Escherichia coli BL21 (DE3). The recombinant enzyme was partially purified and its enzymatic properties were characterized. Sequence analysis demonstrated that the L-LDH was a fructose 1,6-diphosphate-activated NAD-dependent lactate dehydrogenase (L-nLDH). Its molecular weight was approximately 34–36 kDa. The Km and Vmax values of the purified L-nLDH for pyruvate were 1.91 ± 0.28 mM and 2613.57 ± 6.43 lmol (min mg)1, respectively. The biochemical properties of L-nLDH showed that the specific activity were up to 2323.29 U/mg with optimum temperature of 55 °C and pH of 6.5 in the pyruvate reduction and 351.01 U/mg with temperature of 55 °C and pH of 11.5 in the lactate oxidation. The enzyme also showed some activity in the absence of FDP, with a pH optimum of 4.0. Compared to other lactic acid bacterial L-nLDHs, the enzyme was found to be relatively stable at 50 °C. Ca2+, Ba2+, Mg2+ and Mn2+ ions had activated effects on the enzyme activity, and the enzyme was greatly inhibited by Ni2+ ion. Besides these, L-nLDH showed the higher specificity towards pyruvate esters, such as methyl pyruvate and ethyl pyruvate. Ó 2014 Elsevier Inc. All rights reserved.

Introduction 1 L-Lactate dehydrogenases (L-LDHs) (EC 1.1.1.27) are key enzymes responsible for lactic acid production in lactic acid bacteria (LAB). They are cytoplasmic, stereospecific and NAD-linked enzymes, accurately called NAD-dependent L-lactate dehydrogenases (L-nLDHs). They catalyze the last step of anaerobic glycosis, the reduction of pyruvate to L-lactate, concomitantly oxidizing NADH into NAD+. There are two types of L-nLDHs, non-allosteric L-nLDHs and allosteric L-nLDHs. In vertebrates and some LAB, e.g. Lactobacillus plantarum and Lactobacillus pentosus [1,2], the L-nLDHs are non-allosteric. In other LAB, e.g. Lactobacillus casei and Lactobacillus curvatus [3,4], the L-nLDHs are activated by fructose 1,6-diphosphate (FDP). These allosteric L-nLDHs are reported to exhibit much higher activities than the non-allosteric ones.

⇑ Corresponding author. Tel.: +86 025 85427587; fax: +86 025 83587330. E-mail address: [email protected] (J. Ouyang). Abbreviations used: L-LDHs, L-lactate dehydrogenases; LAB, lactic acid bacteria; FDP, fructose 1,6-diphosphate; IPTG, isopropyl-b-D-thiogalactopyranoside; PMSF, phenylmethylsulphonyl fluoride; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; ORF, open reading frame. 1

1046-5928/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pep.2013.12.014

In recent years, L-nLDHs had been among the most studied enzymes, including their purification and characterization. The exploration and research of FDP-activated L-nLDHs are considerably important, since these enzymes show excellent activities and have the potential application for the synthesis of chiral alcohols, hydroxyl or amino acids from ketones or keto acids [5,6]. Many bacterial FDP-activated L-nLDHs have been extensively studied and well reported. L-nLDH of L. casei shows unique allosteric properties and absolutely requires FDP for its catalytic activity under neutral conditions. However, the enzyme still exhibits its catalytic activity even in the absence of FDP under acidic conditions [3,7,8]. Arg173, His188 and His205 are considered as the pivotal residues for FDP combination and regulation [9–11]. Most characteristics of FDP-activated L-nLDHs are the same as the ones of non-allosteric L-nLDHs [12]. The native FDP-activated L-nLDHs often appeared to be a tetramer with four identical subunits [1,3,13]. It has recently been reported that the ldhL-encoded NAD-dependent L-LDH from Corynebacterium glutamicum ATCC 13032 operated in both direction of pyruvate reduction and L-lactate oxidation [14]. There have been recurrent reports of such reversible behavior by L-nLDHs over many years [15–17]. Arg109,

220

T. Jiang et al. / Protein Expression and Purification 95 (2014) 219–225

Asp168, Arg171 and His195 are involved in catalyzing the reversible reactions [18], pyruvate reduction (the forward reaction) and L-lactate oxidation (the inverse reaction). Usually, L-nLDHs mainly catalyze the forward reaction. The inverse reaction only gives activities under alkaline pH and high substrate concentrations [19]. The substrate recognition of L-nLDHs has been also studied. As shown in Fig. 1, in addition to pyruvate, some pyruvate analogs a-keto carboxylic acids, such as oxaloacetate [20], a-ketobutyrate [7], phenylpyruvate [21] and x-amino-a-keto acids [22] could be reduced by L-nLDHs. The catalytic reactions catalyzed by L. pentosus and L. casei enzymes are markedly inhibited by high concentrations of substrates, and the two types of L-nLDHs generally exhibit a broad substrate specificity regardless of their allosteric properties [20]. Bacillus coagulans is a facultative anaerobic thermophilic strain, which has an efficient metabolic pathway to conversion fermentable sugars into L-lactic acid [23–25]. Compared with other mesophilic LAB, such as L. casei [26] and L. pentosus [27], B. coagulans could grow optimally at 50–60 °C and produce optically pure lactic acid as the primary fermentation. Moreover, because of its higher fermentation temperature and higher L-lactic acid yields, the L-nLDH of B. coagulans appeared to be attractive as a potential thermostable and efficient biocatalyst. In this study, the cloning and expression of a FDP-activated L-nLDH from B. coagulans NL01 [28] in Escherichia coli BL21 (DE3) was described, as well as the results of the further characterization of this enzyme.

Materials and methods Materials FastPfu DNA polymerase was purchased from TransGen Biotech (Nanjing, China). T4 DNA ligase and all DNA Markers were from TaKaRa Biotechnology (Dalian, China). Isopropyl-b-D-thiogalactopyranoside (IPTG), ampicillin, stand proteins used as SDS–PAGE marker and all restriction enzymes were procured from Fermentas Life Sciences (GmbH, Hilden, Germany). HisTrap HP 5 mL was from GE Healthcare Life Sciences (USA). Tryptone, yeast extract and other reagents were obtained from Sigma–Aldrich (St. Louis, MO,

Fig. 1. The scheme of reactions catalyzed by L-nLDH.

USA) in analytical grade or higher. The bacterial strains, plasmids and primers used in this study are listed in Table 1. Cloning of the L-nLDH encoding gene Primers P1 and P2 were designed according to the L-lactate dehydrogenase gene (ldhL) sequences of B. coagulans 2–6 (Genbank accession No. CP002472.1). The total genomic DNA of B. coagulans NL01 was extracted with the Wizard genomic DNA purification kit (Promega, Madison, WI, USA) and used as the template for the amplification of ldhL gene. After digested with EcoRI and XhoI enzymes, the PCR product was ligated into pEASY-Blunt cloning vector. The verified recombinant plasmid Blunt-ldhL was sequenced to confirm the full length DNA sequence of ldhL gene at Huada Gene (Shanghai, China). Expression and purification of recombinant L-nLDH Following standard subcloning procedure, ldhL gene was inserted into the EcoRI-XhoI sites of pETDuet-1 expression vector (Novagen), which resulted in recombinant plasmid pETDuet-ldhL. pETDuet-ldhL was transformed into E. coli BL21 (DE3) cells to produce the expression strain BL21 (pETDuet-ldhL). E. coli BL21 (pETDuet-ldhL) cells were grown in conical flasks using LB medium containing 100 lg/mL ampicillin at 37 °C with shaking. When the OD600 of cell reached about 0.6–0.8, the expression of L-nLDH was initiated by adding IPTG to a final concentration of 1.0 mM. After induction at 16 °C and 170 rpm for 10 h, the cells were collected and washed with 1/15 M PBS buffer (19.1006 g Na2HPO412H2O and 1.8156 g KH2PO4 dissolved in 1000 mL distilled water, pH 7.4) three times. Then cells were resuspended in binding buffer (20 mM sodium phosphate, 500 mM sodium chloride, and 20 mM imidazole, pH 7.4) with 1 mM phenylmethylsulphonyl fluoride (PMSF) and 10% glycerol. The cell lysate formed was disrupted by sonication (200 W, pulse on, 6 s; pulse off, 6 s) on ice for 10 min using SCIENTZ JY 92-IIN sonicator (Ningbo, China) and centrifuged at 6000g for 30 min at 4 °C. Their supernatant was collected for further analysis. The His6-LDH fusion protein was purified with affinity chromatography on HisTrap HP 5 mL column (GE Healthcare, UK). The supernatant was filtered and loaded onto the column previously equilibrated with binding buffer. The target protein was eluted with 60% binding buffer and 40% elution buffer (20 mM sodium phosphate, 500 mM sodium chloride, 500 mM imidazole, pH 7.4) at a flow rate of 5.0 mL/min. The fractions containing the enzyme were analyzed on sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). The fusion protein were pooled and

Table 1 Strains, plasmids, and oligonucleotide primers used in this study. Strain, plasmid, or primer

Relevant characteristics

Source or reference

u80 lacZDM15 D(lacZYA-argF) U169 recA1 endA1 hsdR17 supE44k-thi-1 F ompT gal dcm lon hsdSB(rBmB) k(DE3) E. coli BL21(DE3) harboring the plasmid pETDuet-ldhL Undomesticated wild strain capable of producing L-lactic acid

Novagen Novagen This study [28]

Cloning vector, Ampr, Kmr Expression vector, Ampr N-terminal His-tagged ldhL of B. coagulans NL01 in pETDuet-1

TransGen Biotech Novagen This study

Strain E. coli DH5a E. coli BL21(DE3) E. coli BL21 (pETDuet-ldhL) B. coagulans NL01 Plasmid pEASY-Blunt pETDuet-1 pETDuet-ldhL

Sequence (50 ? 30 )

Primer P1

AGGGGATCCAGGAAGATTATACATG

This study

P2

ACTGTCGACTTACAATATCGGGCC

This study

The underlined character indicates the introduction of restriction sites.

T. Jiang et al. / Protein Expression and Purification 95 (2014) 219–225

dialysed overnight against 50 mM phosphate buffer pH 7.4. The purified protein was concentrated using Amicon Ultra-4 (10 kDa MWCO, Millipore, USA) and stored at 4 °C before usage.

Enzyme assay and protein determination The assay of L-nLDH activity was performed for pyruvate reduction to lactate by measuring the decrease in absorbance of NADH at 340 nm with an Ultrospec™ 2100 pro (GE Healthcare, UK). The enzyme assay system contained CKBB buffer (0.6008 g citric acid, 0.3893 g KH2PO4, 0.1769 g boric acid and 0.5266 g barbitone dissolved in 1000 mL distilled water, pH 6.5), sodium pyruvate (10 mM), NADH (0.2 mM) and FDP (5 mM) in a total volume of 1 mL. The reaction was usually initiated by the addition of the enzyme and carried out at 55 °C unless otherwise noted.L-nLDH activity was also investigated in the direction of lactate oxidation to pyruvate by measuring the increase in absorbance of NADH at 340 nm. The enzyme assay system contained CKBB butter (pH 11.5), sodium lactate (1.2 M) and NAD+ (2 mM) in a total volume of 1 mL. The purified enzyme was added last to start the reaction. One unit was the amount of enzyme required to catalyze the oxidation or reduction of 1 lmol of NADH per min under the above assay conditions. Specific activity was expressed as units per mg of protein. The protein concentration was determined by the Bradford method using bovine serum albumin for calibration [29].

Determination of kinetic constants For kinetic experiments, the L-nLDH activities were determined under different pyruvate concentrations (0–40.0 mM) with the CKBB buffer (pH, 6.5) and 55 °C in the present of FDP. The reaction was monitored continuously and the initial velocities were determined.

221

Determination of the substrate activity Substrate activity of the recombinant L-nLDH was surveyed with several 20 mM 2-oxo acids (sodium pyruvate, sodium phenylpyruvate, sodium 2-oxobutyvate, sodium 4-methyl-2-oxovalerate, ethyl pyruvate and methyl pyruvate) in CKBB buffer at pH 6.5 and 55 °C in the direction of reduction. Results and discussion Sequence analysis of L-nLDH As described in Materials and methods, EcoRI-XhoI fragment including ldhL gene was cloned into pEASY-Blunt cloning vector, and the nucleotide sequences of the fragment were determined and deposited in the GenBank nucleotide sequence databases under the accession No. KF386111. The ldhL gene comprised a complete open reading frame (ORF) of 939 bases, encoding a protein of 312 amino acids. Additionally, the homology analysis indicated that it exhibited a high similarity with the putative L-nLDH from B. coagulans 2–6 [30]. Multiple alignment of the cloned L-nLDH with other L-nLDHs of various LAB was undertaken by using Clustal X2 [31] (Fig. 2). Among these proteins, the amino acid identity of B. coagulans L-nLDH was found to be 51.7% homology with L. casei L-nLDH, 44.8% with Lactobacillus helveticus L-nLDH, 46.9% with Lactococcus lactis L-nLDH, and 49.5% with Streptococcus mutans L-nLDH, respectively. All of the residues involved in substrate recognition (Asp 197, Thr 246 and Gln 102) [33] and the key catalytic residues (Arg 109, Asp 168, Arg 171 and His 195) [18] were conserved in B. coagulans NL01 L-nLDH. Moreover, the amino acids involved in activation by FDP (Arg 173 and His 188) were also found in L-nLDH [9–11]. These results indicated that the enzyme was a FDPactivated NAD-dependent lactate dehydrogenase. Expression and purification of the recombinant L-nLDH

Effect of pH and temperature on enzyme activity The effect of pH on L-nLDH activity for pyruvate reduction to lactate was investigated in CKBB buffer of various pHs (3.0–11.0). The reaction conditions were the same as those mentioned previously. The pH stability of L-nLDH was tested by pre-incubated the enzyme at 37 °C for 2 h with different buffers in the pH range of 3.0–11.0. The optimal temperature for enzyme activity was determined by performing the standard assay procedure at temperatures between 30 °C and 80 °C. To examine temperature stability, the L-nLDH was pre-incubated at a range of temperatures (30–70 °C) for 10 min in CKBB buffer, pH 6.5. The relative activity was calculated using the sample with the highest activity as 100%. The optimum pH and temperature on lactate oxidation for L-nLDH activity were examined with CKBB buffer in the pH range of 7.0–12.25 and different temperatures at 30–85 °C. The relative activity was calculated using the sample with the highest activity as 100%.

The E. coli BL21 (pETDuet-ldhL) was induced with 1.0 mM IPTG for 10 h and a high level of fusion protein was obtained in soluble form. After cell sonication, the fusion protein was checked by SDS– PAGE (Fig. 3). No L-nLDH activity was detected in the E. coli cells carrying pETDuet-1, the crude extracts of E. coli BL21 (pETDuetldhL) showed the specific activity of 624.54 U/mg for pyruvate reduction after induction by IPTG. The expressed fusion protein was easily purified using Ni-NTA affinity column. Most of the recombinant protein (about 70%) was eluted, and the fraction containing pure fusion protein was analyzed by SDS–PAGE (Fig. 3). The electrophoretically pure enzyme migrated as a thick protein band of a subunit molecular weight of approximately 34–36 kDa. This was close to the theoretical mass based on the putative amino acids sequence. The specific activity of purified recombinant enzyme was 2323.29 U/mg, indicating a 3.72-fold increase in specific activity to that obtained from the cell-free extract, and the recovery yield of the enzyme was nearly 63.51%.

Effect of metal ions

Effect of FDP on L-nLDH activity

Ca2+, Mn2+, Mg2+, Ba2+, Ni2+, Zn2+, Co2+ and Cu2+ was separately added to the reaction mixture at a final concentration of 2 mM. The effect of the salts on L-nLDH activity were investigated by measuring the enzyme activity at 55 °C in CKBB buffer (pH 6.5), 10 mM sodium pyruvate, 0.2 mM NADH, 5 mM FDP and 2 mM metal ions. The relative activity was calculated using the sample without metal ion as 100%.

According to the sequence analysis of B. coagulans NL01 L-nLDH, the enzyme might be a FDP-activated L-nLDH. Thus, the effect of FDP on enzyme activity was further investigated (Fig. 4). Previous studies had showed that the FDP-activated L-nLDH existed in some LAB, such as Streptococcal species and L. casei [19]. In the present study, the recombinant L-nLDH from B. coagulans NL01 also had an absolute and specific requirement for FDP for maximum

222

T. Jiang et al. / Protein Expression and Purification 95 (2014) 219–225

Fig. 2. Multiple alignment of the amino acid sequences of L-lactate dehydrogenases from selected species. Species and accession numbers of sequences are as follows: L. casei ATCC 393 (Lcas), YP_001988625; L. helveticus DPC 4571 (Lhel), YP_001576807; L. lactis (Llac), AAB51674; S. mutans (Smut), NP_721502; B. coagulans NL01 (Bcoa), this study. The amino acid residues are numbered according to previously established numbering system [32]. Symbol presents: N: substrate recognition residues, Gln 102, Asp 197, Thr 246; .: catalytic residues, Arg 109, Asp 168, Arg 171, His 195; d: FDP-activated residues, Arg 173, His 188.

Specific activity (U/mg)

2000

1500

1000

500

0 0

2

4

6

8

10

FDP (mM) Fig. 4. Effect of FDP concentration on activity of L-lactate dehydrogenase. Values are the average ± SD of three separate determinations.

Fig. 3. SDS–PAGE analysis of expressed and purified recombinant L-nLDH. Lane 1, protein marker; Lane 2, crude cell extract of E. coli BL21 (DE3) harboring plasmid pETDuet-1; Lane 3, crude cell extract of E. coli BL21 (DE3) harboring plasmid pETDuet-ldhL without IPTG induction; Lane 4, crude cell extract of E. coli BL21 (DE3) harboring plasmid pETDuet-ldhL with IPTG induction; Lane 5, the purified L-nLDH.

catalytic activity. When there was no FDP in the reaction mixture, the purified enzyme exhibited no marked catalytic activity for pyruvate reduction to lactate. Adding FDP concentration to 5 mM could increase the specific activity by 1958.50 U/mg. Several studies suggested that the activation of the enzyme by FDP occurred through enhancement of the enzyme affinity for its substrates and the apparent enzyme activity [8,34]. A further increase in FDP concentration did not give a further rise in the activity. Our result indicated that the required FDP concentration (5 mM) for L-nLDH of B. coagulans was higher than that of other bacteria, 2 mM for C. glutamicum [14], 1 mM for Clostridium thermocellum [35] and 0.2 mM for Thermus caldophilus [15]. Moreover, in previous studies, those L-nLDHs were found to be inhibited by higher concentration of FDP [35,15]. However, in our study, a further

increase in FDP concentration did not give an evident inhibitory effect on L-nLDH activity. The kinetic constants, Km and Vmax were calculated using Lineweaver–Burk plot. In the presence of FDP (5 mM), the recombinant L-nLDH from B. coagulans NL01 showed a Km of 1.91 ± 0.28 mM and Vmax of 2613.57 ± 6.43 lmol (min mg)1. However, the values of Km of L. casei [20], C. thermocellum [35] and C. glutamicum [14] L-nLDHs were 0.4, 0.3 and 0.85 mM, respectively. They were all lower than that of B. coagulans NL01 L-nLDH, but the value of Vmax of B. coagulans NL01 L-nLDH was the highest. Effect of pH, temperature and metal ions on L-nLDHs activity The pH profiles for the purified L-nLDH were shown in Fig. 5a. activity was determined in both directions in CKBB buffer. For the pyruvate reduction, in the absence of FDP, the optimal pH was found to be 4.0, and no activity could be observed in the neutral pH region. The addition of FDP led to a marked shift in the pH optimum from 4.0 to 6.5. Such obvious shift in the pH optimum was also found for L-LDH of Streptococcus lactis C10 [36]. These results suggested that the addition of FDP could broaden the pH L-nLDH

223

T. Jiang et al. / Protein Expression and Purification 95 (2014) 219–225

Relative activity (%)

Specific activity (U/mg)

100

(a)

2000 1500 1000 500

(c)

80 60 40 20

0 0

2

4

6

8

10

12

2

4

6

(b)

10

12

(d)

100

Relative activity (%)

100

Relative activity (%)

8

pH

pH

80 60 40 20

80 60 40 20

0 20

30

40

50

60

70

80

90

0 20

30

40

O

50

60

70

80

Temperature (OC)

Temperature ( C)

Fig. 5. Characterization of the purified recombinant L-lactate dehydrogenase. (a) Effect of pH on enzyme activity. Symbols represent: 4, pyruvate reduction without FDP; h, pyruvate reduction with 5 mM FDP; s, lactate oxidation. (b) Effect of temperature on enzyme activity in the direction of pyruvate reduction. (c) Effect of pH on enzyme stability. (d) Effect of temperature on enzyme stability. For (a) and (c), the enzyme was incubated in CKBB buffer of various pHs at 55 °C and 37 °C. For (b) and (d), the enzyme was incubated under various temperatures at pH 6.5. Values are the average ± SD of three separate determinations.

Effect of metal ions on L-nLDHs activity The role of metal ions on activity of the recombinant L-nLDH was tested by adding metal salts (finally concentration, 2 mM) to

the assay buffer (Fig. 6). Mn2+ was regarded to have the positive effect for L-LDHs from different bacterial sources [7,8,36]. De Vries et al. reported that Mg2+ was unable to replace the Mn2+ requirement for the L. casei L-LDH. Holland et al. [8] found that activation at pH values above the optimum was not specific for Mn2+, other divalent metals, Co2+, Cu2+, Cd2+, and Ni2+ but not Mg2+, would effectively substitute for Mn2+. In the present work, Ca2+, Ba2+ and Mg2+ ions were as effective as Mn2+ at pH 6.5. Ni2+, Zn2+, Co2+, and Cu2+ ions inhibited the enzyme activity, especially the Ni2+ ion. Additionally, the activation was increased with the increasement of Ca2+ concentration in reaction mixture. Substrate activity of L-nLDH L-nLDH is an efficient catalyst that could be used in the enantioselective reduction of a-keto acids to a-hydroxy acids. This

120

Relative activity (%)

profile, especially towards neutral pH values. The pH profiles of the enzyme with and without FDP was agreement with many other FDP-activated L-nLDHs [8,15,16]. As for lactate oxidation, the L-nLDH had the specific activity of 351.01 U/mg at an optimum pH of 11.5. It seemed to be that oxidation of lactate required an alkaline pH and a high concentration of substrates. This shift of pH resembled those of enzymes from Thermoanaero bacterethanolicus [37] and C. glutamicum [14]. Several other FDP-activated L-nLDHs in Lactobacillus species, Staphylococcus epidermidis and the Streptococci do not oxidize lactate or the reaction is very weak [19]. Our data indicated that B. coagulans NL01 L-nLDH was a new reversible, FDP-activated L-nLDH. Fig. 5b showed temperature profiles for the purified L-nLDH in the direction of pyruvate reduction. The optimum temperature of the enzyme reaction for both directions was at 55 °C. After incubation in CKBB buffer at 37 °C for 2 h, the recombinant L-nLDH retained more than 80% of its activity at pH between 5.5 and 8.0 (Fig. 5c). But incubation of L-nLDH at acidic or alkaline pHs resulted in a rapid inactivation of the enzyme. Thermostability was investigated by pre-incubation of the enzyme solution at pH 6.5 and different temperatures (Fig. 5d). At 50 °C, the half-time for inactivation was about 4 h and no residual activity was determined after 9 h (the data not shown). When the temperature was over 50 °C, the residual activity decreased quickly. B. coagulans belongs to a class of microorganisms which has enzymes that show higher thermostability than those from related mesophilic species [23]. The good stability of recombinant L-nLDH from B. coagulans makes it a better candidate for industrial application.

100 80 60 40 20 0

None Ca2+Mn2+Mg 2+Ba2+ Co2+Cu2+ Zn2+Ni2+

Metal ions (2 mM) Fig. 6. Effect of different metal ions on purified L-lactate dehydrogenase. The relative activity was calculated using the sample without metal ion as 100%. Values are the average ± SD of three separate determinations.

224

T. Jiang et al. / Protein Expression and Purification 95 (2014) 219–225

Table 2 Substrate activity of L-lactate dehydrogenases.

Reference

Substrate (20 mM)

Specific activity (U/mg)

Sodium pyruvate Sodium 2-oxobutyvate Sodium phenylpyruvate monohydrate Sodium 4-methyl-2-oxovalerate Ethyl pyruvate Methyl pyruvate

2053.60 ± 50.31 112.32 ± 19.10 50.52 ± 13.35 0.41 ± 0.20 1136.05 ± 32.45 1274.05 ± 36.76

Values are the average ± SD of three separate determinations.

enzyme-catalyzed reduction provides a practical method for preparing a range of 2-hydroxy acids with high ee [38]. Therefore, an UV spectrophotometer analysis was performed to investigate the substrate activity of L-nLDH in the present study. The purified B. coagulans NL01 L-nLDH showed the highest activity towards pyruvate (Table 2). But for other pyruvate analogs with larger groups, only a slight activity was found on sodium 2-oxobutyvate and sodium phenylpyruvate, respectively. Moreover, the enzyme activity of L-nLDH for sodium 4-methyl-2-oxovalerate had been detected barely. A possible explanation is that these pyruvate analogs have the different length and size of the hydrophobic group attached to the carbonyl group, which result in the substrates that are unfavorable compared with pyruvate [20,39]. Interestingly, methyl pyruvate and ethyl pyruvate were found to show the higher specificity of the enzyme, which was not reported previously. Ethyl lactate is a green, economically viable and alternative solvent. Traditionally, it was produced by the enantioselective hydrogenation of ethyl pyruvate [40]. In view of the high specific activity of L-nLDH on ethyl pyruvate, a further study to explore the L-nLDH of B. coagulans NL01 as catalyst in organic synthesis was meaningful.

Conclusion In the present study, we cloned, sequenced, and expressed ldhL gene from a thermophilic strain, B. coagulans NL01, and demonstrated its high activity toward pyruvate. The specific activity of FDP-activated L-nLDH from B. coagulans NL01 was 2323.29 U/mg toward pyruvate and 351.01 U/mg toward lactate. The recombinant L-nLDH showed its best performance at pH 6.5 and 55 °C. In addition, the enzyme was stable under a wide range of pH and thermostable at 50 °C. Ca2+, Ba2+, Mg2+ and Mn2+ ions had activated effects on the enzyme, and Ni2+, Zn2+, Co2+ and Cu2+ ions had negative effects. In addition, this L-nLDH exhibited activities toward methyl pyruvate and ethyl pyruvate. To our knowledge, this was the first report demonstrating that methyl pyruvate and ethyl pyruvate could be reduced by L-nLDH. The L-nLDH of B. coagulans NL01 could be a promising alternative for production of methyl lactate and ethyl lactate, and this would be further studied in our following work.

Acknowledgments This study was supported by the National Natural Science Foundation of China (31200443), Program for New Century Excellent Talents in University (NCET-0988), and Excellent Youth Foundation of Jiangsu Province of China (BK2012038). The authors are also grateful to the National Hi-tech Research and Development Program of China (2012AA022301) and PAPD for partial funding of this study.

[1] H. Taguchi, T. Ohta, Unusual amino acid substitution in the anion-binding site of Lactobacillus plantarum non-allosteric L-lactate dehydrogenase, Eur. J. Biochem. 209 (1992) 993–998. [2] H. Uchikoba, S. Fushinobu, T. Wakagi, M. Konno, H. Taguchi, H. Matsuzawa, Crystal structure of non-allosteric L-lactate dehydrogenase from Lactobacillus pentosus at 2.3 Å resolution: specific interactions at subunit interfaces, Proteins 46 (2002) 206–214. [3] R. Hensel, U. Mayr, C.Y. Yang, The complete primary structure of the allosteric L-lactate dehydrogenase from Lactobacillus casei, Eur. J. Biochem. 134 (1983) 503–511. [4] U. Mayr, R. Hensel, M. Deparade, H.E. Pauly, G. Pfleider, W.E. Trommer, Structure–function relationship in the allosteric L-lactate dehydrogenases from Lactobacillus casei and Lactobacillus curvatus, Eur. J. Biochem. 126 (1982) 549– 558. [5] W. Hummel, M.R. Kula, Dehydrogenases for the synthesis of chiral compounds, Eur. J. Biochem. 184 (1989) 1–13. [6] W. Hummel, Large-scale applications of NAD(P)-dependent oxidoreductases: recent developments, Trends Biotechnol. 17 (1999) 487–492. [7] R. Hensel, U. Mayr, K.O. Stetter, O. Kandler, Comparative studies of lactate dehydrogenases in lactic-acid bacteria. I. Purification and kinetics of the allosteric L-lactic acid dehydrogenases of Lactobacillus casei ssp. casei, Lactobacillus curvatus, Arch. Microbiol. 112 (1977) 81–93. [8] R. Holland, G.G. Pritchard, Regulation of the L-lactate dehydrogenase from Lactobacillus casei by fructose-1,6-diphosphate and metal ions, J. Bacteriol. 121 (1975) 777–784. [9] K. Arai, A. Hishida, M. Ishiyama, T. Kamata, H. Uchikoba, S. Fushinobu, H. Matsuzawa, H. Taguchi, An absolute requirement of fructose 1,6-bisphosphate for the Lactobacillus casei L-lactate dehydrogenase activity induced by a single amino acid substitution, Protein Eng. 15 (2002) 35–41. [10] A.R. Clarke, T. Atkinson, J.J. Holbrook, From analysis to synthesis: new ligand binding sites on the lactate dehydrogenase framework, Trends Biochem. Sci. 14 (101–105) (1989) 145–148. [11] H. Matsuzawa, M. Machida, K. Kunai, Y. Ito, T. Ohta, Identification of an allosteric site residue of a fructose 1,6-bisphosphate-dependent L-lactate dehydrogenase of Thermus caldophilus GK24: production of a non-allosteric form by protein engineering, FEBS Lett. 233 (1988) 375–378. [12] M. Buehner, H.J. Hechht, R. Hensel, U. Mayr, Crystallization and preliminary crystallographic analysis at low resolution of the allosteric L-lactate dehydrogenase from Lactobacillus casei, J. Mol. Biol. 162 (1982) 819–838. [13] K. Kunal, M. Machida, H. Matsuzawa, T. Ohta, Nucleotide sequence and characteristics of the gene for L-lactate dehydrogenase of Thermus caldophilus GK24 and the deduced amino-acid sequence of the enzyme, Eur. J. Biochem. 160 (1986) 433–440. [14] M.A. Sharkey, A.A. Maher, A. Guyonvarch, P.C. Engel, Kinetic characterization of recombinant Corynebacterium glutamicum NAD+-dependent LDH overexpressed in E. coli and tits rescue of an lldD phenotype in C. glutamicum: the issue of reversibility re-examined, Arch. Microbiol. 193 (2011) 731–740. [15] H. Taguchi, M. Yamashita, H. Matsuzawa, T. Ohta, Heat-stable and fructose 1,6bisphosphate-activated L-lactate dehydrogenase from an extremely thermophilic bacterium, J. Biochem. 91 (1982) 1343–1348. [16] H.A. Jonas, R.F. Anders, G.R. Jago, Factors affecting the activity of the lactate dehydrogenase of Streptococcus cremoris, J. Bacteriol. 111 (1972) 397–403. [17] M. Özkan, E.I. Yilmaz, L.R. Lee, G. Özcengiz, Cloning and expression of the Clostridium thermocellum L-lactate dehydrogenase gene in Escherichia coli and enzyme characterization, Can. J. Microbiol. 50 (2004) 845–851. [18] C.R. Dunn, H.M. Wilks, D.J. Halsall, T. Atkinson, A.R. Clarke, H. Muirhead, J.J. Holbrook, Design and synthesis of new enzymes based on the lactate dehydrogenase framework, Philos. Trans. R. Soc. B 332 (1991) 177–184. [19] E.I. Farvie, Bacterial lactate dehydrogenases, Microbiol. Rev. 44 (1980) 106–139. [20] K. Arai, T. Kamata, H. Uchikoba, S. Fushinobu, H. Matsuzawa, H. Taguchi, Some Lactobacillus L-lactate dehydrogenases exhibit comparable catalytic activities for pyruvate and oxaloacetate, J. Bacteriol. 183 (2001) 397–400. [21] Z.J. Zheng, C.Q. Ma, C. Gao, F.S. Li, J.Y. Qin, H.W. Zhang, K. Wang, P. Xu, Efficient conversion of phenylpyruvic acid to phenyllactic acid by using whole cells of Bacillus coagulans SDM, PLoS One 6 (2011) e19030. [22] J.K. Hogan, C.A. Pittol, J.B. Jones, M. Gold, Improved specificity toward substrates with positively charged side chains by site-directed mutagenesis of the L-lactate dehydrogenase of Bacillus stearothermophilus, Biochemistry 34 (1995) 4225–4230. [23] M.A. Patel, M.S. Ou, R.H. Harbrucker, H.C. Aldrich, M.L. Buszko, L.O. Ingram, K.T. Shanmugam, Isolation and characterization of acid-tolerant, thermophilic bacteria for effective fermentation of biomass-derived sugars to lactic acid, Appl. Environ. Microbiol. 72 (2006) 3228–3235. [24] J.Y. Qin, B. Zhao, X.W. Wang, L.M. Wang, B. Yu, Y.H. Ma, C.Q. Ma, H.Z. Tang, J.B. Sun, P. Xu, Non-sterilized fermentative production of polymer-grade L-lactic acid by a newly isolated thermophilic strain Bacillus sp. 2–6, PLoS One 4 (2009) e4359. [25] N.K. Budhavaram, Z.L. Fan, Production of lactic acid from paper sludge using acid-tolerant, thermophilic Bacillus coagulan strains, Bioresour. Technol. 100 (2009) 5966–5972. [26] X.Y. Ge, J. Yuan, H. Qin, W.G. Zhang, Improvement of L-lactic acid production by osmotic-tolerant mutant of Lactobacillus casei at high temperature, Appl. Microbiol. Biotechnol. 89 (2011) 73–78.

T. Jiang et al. / Protein Expression and Purification 95 (2014) 219–225 [27] G. Bustos, A.B. Moldes, J.M. Cruz, J.M. Domínguez, Influence of the metabolism pathway on lactic acid production from hemicellulosic trimming vine shoots hydrolyzates using Lactobacillus pentosus, Biotechnol. Prog. 21 (2005) 793– 798. [28] J. Ouyang, C. Cai, H. Chen, T. Jiang, Efficient non-sterilized fermentation of biomass-derived xylose to lactic acid by a thermotolerant Bacillus coagulans NL01, Appl. Biochem. Biotechnol. 168 (2012) 2387–2397. [29] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [30] F. Su, B. Yu, J. Sun, H.Y. Ou, B. Zhao, L. Wang, J.Y. Oin, H.Z. Tang, F. Tao, M. Jarek, M. Scharfe, C.Q. Ma, Y.H. Ma, P. Xu, Genome sequence of the thermophilic strain Bacillus coagulans 2–6, an efficient producer of high-optical-purity Llactic acid, J. Bacteriol. 193 (2011) 4563–4564. [31] J.D. Thompson, T.J. Gibson, F. Plewniak, F. Jeanmougin, D.G. Higgins, The CLUSTAL-X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools, Nucleic Acids Res. 24 (1997) 4876–4882. [32] W. Eventoff, M.G. Rossmann, S.S. Taylor, H.J. Torff, H. Meyer, W. Keil, H.H. Klltz, Structural adaptations of lactate dehydrogenase isozyme, Proc. Natl. Acad. Sci. USA 74 (1977) 2677–2681. [33] A.R. Clarke, C.J. Smith, K.W. Hart, H.M. Wilks, W.N. Chia, T.V. Lee, J.J. Birktoft, L.J. Banaszak, D.A. Barstow, T. Atkinson, J.J. Holbrook, Rational construction of a

[34]

[35]

[36]

[37]

[38]

[39]

[40]

225

2-hydroxyacid dehydrogenase with new substrate specificity, Biochem. Biophys. Res. Commun. 148 (1987) 15–23. A.T. Brown, C.L. Wittenberger, Fructose-1,6-diphosphate-dependent lactate dehydrogenase from a Cariogenic Streptococcus: purification and regulatory properties, J. Bacteriol. 110 (1972) 604–615. P. Assa, M. Ozkan, G. Ozcengiz, Thermostability and regulation of Clostridium thermocellum L-lactate dehydrogenase expressed in Escherichia coli, Ann. Microbiol. 55 (2005) 193–197. V.L. Crow, G.G. Pritchard, Fructose 1,6-diphosphate-activated L-lactate dehydrogenase from Streptococcus lactis: kinetic properties and factors affecting activation, J. Bacteriol. 131 (1977) 82–91. Q. Zhou, W.L. Shao, Molecular genetic characterization of the thermostable Llactate dehydrogenase gene (ldhL) of Thermoanaero bacterethanolicus JW200 and biochemical characterization of the enzyme, Biochemistry 75 (2010) 526–530. M.J. Kim, G.M. Whitesides, L-Lactate dehydrogenase: substrate specificity and use as a catalyst in the synthesis of homochiral 2-hydroxy acids, J. Am. Chem. Soc. 110 (1988) 2959–2964. A. Razeto, S. Kochhar, H. Hottinger, M. Dauter, K.S. Wilson, V.S. Lamzin, Domain closure, substrate specificity and catalysis of D-lactate dehydrogenase from Lactobacillus bulgaricus, J. Mol. Biol. 318 (2002) 109–119. V. Morawsky, U. Prüße, L. Witte, K.D. Vorlop, Transformation of cinchonidine during the enantioselective hydrogenation of ethyl pyruvate to ethyl lactate, Catal. Commun. 1 (2000) 15–20.