Knockdown of GPR137 by RNAi inhibits pancreatic cancer cell growth and induces apoptosis Xianping Cui1, Yanguo Liu2, Bo Wang3, Guozhe Xian1, Xin Liu1, Xingsong Tian4,*, Chengkun Qin1,* 1 Department of Hepatobiliary Surgery, Shandong Provincial Hospital affiliated to Shandong University, Jinan 250021, China 2 Department of Oncology, Qilu Hospital, Shandong University, Jinan 250012, China 3 Department of immunology, Shandong University School of Medicine, Jinan 250012, China 4 Department of Breast and Thyroid Surgery, Shandong Provincial Hospital affiliated to Shandong University, Jinan 250021, China
*Correspondence to: Dr. Xingsong Tian or Dr. Chengkun Qin, Shandong Provincial Hospital affiliated to Shandong University, 324 JingWu Road, Jinan 250021, China Tel.: +86 0531-68776200 Fax: +86 0531-87937741 E-mails: [email protected], [email protected]
Running title: GPR137 in pancreatic cancer
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/bab.1326. This article is protected by copyright. All rights reserved.
1
Abstract G-protein-coupled receptors (GPCRs), the largest family of cell-surface molecules involved in a number of biological and pathological processes, have recently emerged as key players in carcinogenesis and cancer progression. Orphan G protein-coupled receptors (oGPCRs) are a group of proteins lacking endogenous ligands. GPR137, one of the novel oGPCR genes, was discovered by homology screening. However, the biological role of GPR137 in cancers has not yet been discussed, and is of great therapeutic interest. In this study, we knocked down GPR137 via a lentivirus system in two human pancreatic cancer cell lines BXPC-3 and PANC-1. Knockdown of GPR137 strongly inhibited cell proliferation and colony formation. Flow cytometry showed that cell cycle was arrested in sub-G1 phase and apoptotic cells were significantly increased after GPR137 knockdown. Western blotting confirmed that GPR137 silencing induced apoptosis due to cleavage of PARP and upregulation of Caspase 3. Furthermore, lentivirus-mediated overexpression of GPR137 promoted the proliferation of PANC-1 cells, suggesting GPR137 as a potential oncogene in pancreatic cancer cells. Taken together, our results prove the importance of GPR137 as a crucial regulator in controlling cancer cell growth and apoptosis.
Keywords: GPR137; GPCR; pancreatic cancer; lentivirus
This article is protected by copyright. All rights reserved.
2
1. Introduction G-protein-coupled receptors (GPCRs) constitute the largest family of cell surface molecules involved in signal transduction during various biological and pathological processes. In recent years, a great number of GPCRs have shown to play a pivotal role in cancer formation and metastasis. In many cancers, the normal physiological functions of GPCRs are often hijacked by the malignant cells, so as to help them evade immune detection, proliferate autonomously, improve the oxygen and nutrient supply, and increase invasion and dissemination (Dorsam and Gutkind 2007). Many GPCRs are aberrantly expressed in various types of malignancies and may contribute to cancer progression (Li et al. 2005). PSGR, a human prostate tissue-specific gene belonging to the GPCR family, is associated with prostate cancer development and progression (Weng et al. 2005). Over-expression of GPR19 confers a specific benefit for lung cancer cell proliferation through accelerating cell cycle transition (Kastner et al. 2012). MAS-related GPCR, member D (MRGD), is highly expressed in lung cancer and involved in tumorigenesis (Nishimura et al. 2012). GPR4 has been known to play an important role in the tube formation of vascular endothelial cells, and its over-expression has been observed in multiple cancers (Ren et al. 2013). Orphan G protein-coupled receptors (oGPCRs) are a group of receptors lacking endogenous ligands, most of which were found by sequence similarity. Despite the advance of molecular biology and bioinformatics, the identification of endogenous ligands of oGPCRs has always been a challenge (Chung et al. 2008). GPR137 is a novel oGPCR gene discovered by homology screening which shares identity with PSGR (Vanti et al. 2003). Increasing evidences reveals that oGPCRs are also implicated in cancer cell proliferation and migration. GPR49 has been shown to be over-expressed in human colon and ovarian primary tumors (McClanahan et al. 2006). GPR55 has been implicated in the tumorigenesis of several cancers, such as cholangiocarcinoma, breast cancer, glioblastoma, prostate cancer, and ovarian cancer, This article is protected by copyright. All rights reserved.
3
suggesting it as a potential target for cancer therapy (Leyva-Illades and Demorrow 2013; Perez-Gomez et al. 2013; Ford et al. 2010; Petitet et al. 2006; Pineiro et al. 2011; Oka et al. 2010). To date, little is known about the biological role of GPR137 in human cancers, including pancreatic cancer. In the present study, in order to assess the effect of GPR137 in pancreatic cancer, we used a lentivirus-mediated RNA interference (RNAi) system to knock down GPR137 expression in two human pancreatic cancer cell lines BXPC-3 and PANC-1. A variety of in vitro cellular assays provided new insights into the regulatory role of GPR137 in pancreatic cancer cell proliferation and apoptosis, which may provide a reference for the development of new therapeutic strategies for pancreatic cancer.
2. Materials and methods 2.1. Lentiviral Vector Production. The
short
harpin
RNA
(shRNA)
sequence
GAACAAAGGCTACCTGGTATTCTCGAGAATACCAGGTAGCCTTTGTTCTTTTTT
(5’-3’)
was
designed to target human GPR137 gene (NM_001170726.1). It was cloned intopFH-L vector (Shanghai Hollybio, China) which contains the green fluorescent protein (GFP) gene as a reporter. Non-targeting shRNA
sequence
(5’-
CTAGCCCGGCCAAGGAAGTGCAATTGCATACTCGAGTATGCAATTGCACTTCCTTGGTTTTTTG TTAAT -3’) was used as control. Lentiviruses were generated by triple transfection of 80% confluent 293T cells with modified pFH-L plasmid and pVSVG-I and pCMV△R8.92 helper plasmids (Shanghai Hollybio, China) using Lipofectamine 2000 (Invitrogen, Carlsbad). After 72 h, lentivirus-mediated GPR137 shRNA (Lv-shGPR137) or control shRNA (Lv-shCon) were collected by purification and precipitation. In addition, the pLVTHM vector (Biovector Science Lab) encoding the full length cDNA of GPR137 was constructed. This article is protected by copyright. All rights reserved.
4
Positive colonies with inserted fragments were confirmed by DNA sequencing to generate pLVTHM-GPR137 expression plasmid. Cells were infected with recombined lentiviruses at a multiplicity of infection (MOI) of 20, and non-infected cells (Con) were used as negative controls.
2.2 Cell Culture. Human pancreatic cancer cell lines BXPC-3 and PANC-1 and human embryonic kidney cell line 293T were from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). These cell lines were grown in DMEM supplemented with 10% fetal bovine serum (FBS; Hyclone) and maintained in a humidified incubator containing 5% CO2 at 37°C.
2.3. Quantitative Real-Time PCR. Total RNA was extracted from cells using Trizol reagent (Invitrogen, Carlsbad), and cDNA was synthesized with random primers following the manufacturer’s protocol (MBI Fermantas, Vilnius, Lithuania). For quantitative real-time PCR (qRT-PCR), two sets of primers were used, GPR137: 5’ACCTGGGGAACAAAGGCTAC -3’ (forward) and 5’- TAGGACCGAGAGGCAAAGAC -3’ (reverse); Actin: 5’- GTGGACATCCGCAAAGAC -3’ (forward) and 5’- AAAGGGTGTAACGCAACTA -3’ (reverse). PCR reactions were performed on BioRad Connet Real-Time PCR platform using following system: 10 µL 2X SYBR premix ex-taq, 0.8 µL primers, 5 µL cDNA and 4.2 µL ddH2O. The cycling parameters were 95 °C for 30 s, 40 cycles of 95°C for 5 s and 60°C for 20 s. All samples were repeated at least three times. The data were analyzed with the comparative threshold cycle (ct) method [fold difference = 2–(
ct of target gene–
ct of reference)
].
This article is protected by copyright. All rights reserved.
5
2.4. Western Blotting. Cells were collected 5 days after lentivirus infection, washed twice with PBS, and suspended in lysis buffer (2% Mercaptoethanol, 20% Glycerol, 4% SDS in 100 mM Tris-HCl buffer, pH 6.8). After 15 min of incubation on ice, the cells were disrupted by ultrasound on ice. The lysates were cleared by centrifugation (12,000 g) at 4℃ for 15 min. Total protein concentration was determined by BCA Protein assay. Protein (20 μg) was loaded onto a 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore). Next, proteins were detected by rabbit anti-GPR137 (11929-1-AP, Proteintech Group, Inc.), rabbit anti-PARP (9542, Cell Signaling Technology) or rabbit anti-Caspase 3 (9661, Cell Signaling Technology) using an ECL kit (Amersham) and exposed to X-ray film. Mouse anti-GAPDH antibody (sc-32233, Santa Cruz, CA, USA) was used as a control to verify equal protein loading.
2.5. Cell Proliferation Assay by Methylthiazoletetrazolium. After infection for 4 days, BXPC-3 and PANC-1 cells were trypsinized and re-seeded in 96-well plates at a density of 3,000 cells per well, respectively. At indicated time points, cells were treated with methylthiazoletetrazolium (MTT) solution (5 mg/mL, 10 μL/well). After 4 h incubation at room temperature, 150 μL of acidic isopropanol (5% isopropanol, 10% SDS and 0.01 mol/L HCL) was added to each well to dissolve the crystals. After 10 min at room temperature, the absorbance of plate was recorded at 595 nm.
2.6. Colony Formation Assay. To observe the relative long-term inhibitory effect of Lv-shGPR137, colony formation assay was performed on BXPC-3 cells with three different treatments: Lv-shGPR137, Lv-shCon and Con. In brief, This article is protected by copyright. All rights reserved.
6
lentivirus-transduced BXPC-3 cells were re-seeded in 6-well plates at a density of 900 cells/well and allowed to grow for 16 days to form natural colonies. At the end of time point, cells were washed by PBS, treated with crystal purple, and washed 3 times by ddH2O. Then the colonies were photographed with a digital camera and the number of colonies was counted. All samples were repeated at least three times.
2.7 Cell Cycle Analysis by Fluorescence-activated Cells Sorting (FACS). Flow cytometry with PI staining was applied to analyze the cell cycle distribution. BXPC-3 cells with three different treatments (Lv-shGPR137, Lv-shCon and Con) for 3 days were seeded in 6-cm dishes with a density of 200,000 cells/dish. After 48 h, cells were collected for fixation and PI staining. Briefly, cells were washed with PBS, fixed with 70% cold ethanol, and suspended in propidium iodide (PI)-containing PBS buffer (100 μg/mL PI and 10 μg/mL RNase A). After 30 min of incubation, a FACS caliber II sorter and Cell Quest FACS system (BD Biosciences, USA) was used to conduct a flow cytometry analysis. The percentages of cells in sub-G1, G0/G1, S and G2/M phases were statistically analyzed.
2.8. Apoptosis Analysis by Flow Cytometry BXPC-3 cells were subjected to three different treatments (Lv-shGPR137, Lv-shCon, and Con) for 6 days. Then cells were washed and re-seeded in 6 cm dishes at a density of 70,000 cells/dish. After 96 h of incubation, the cells were collected and subjected to Annexin V-APC/7-AAD double staining according to the manufacture’s instruction (KGA1026, KeyGEN Biotech, Nanjing, China). Flow cytometry analysis was performed on FACS caliber II sorter and Cell Quest FACS system (BD Biosciences, USA).
This article is protected by copyright. All rights reserved.
7
2.9. Statistical Analysis. All data were expressed as the mean ± SD of three independent experiments. Statistical significance was calculated with Student’s t-test. A P-value of less than 0.05 was considered statistically significant.
2.10. Ethical approval statement All experimental research that is reported in the manuscript has been performed with the approval of Institutional Ethics Committee of Shandong University.
3. Results 3.1 Knockdown of GPR137 by Lentivirus-Mediated RNAi in BXPC-3 and PANC-1 Cells. In order to clarify the biological function of GPR137 in pancreatic cancer, a lentivirus-mediated RNAi system was used. BXPC-3 and PANC-1 cells were subjected to three different treatment (Lv-shGPR137, Lv-shCon and Con), and then the efficiency of infection (>80%) was detected after 72 h (Figure 1A and B). Then the knockdown efficiency of Lv-shGPR137 was observed by qRT-PCR. As shown in Figure 1C and E, the relative expression of GPR137 in BXPC-3 and PANC-1 cells treated with Lv-shGPR137 was significantly inhibited (71.6%, P
*Correspondence to: Dr. Xingsong Tian or Dr. Chengkun Qin, Shandong Provincial Hospital affiliated to Shandong University, 324 JingWu Road, Jinan 250021, China Tel.: +86 0531-68776200 Fax: +86 0531-87937741 E-mails: [email protected], [email protected]
Running title: GPR137 in pancreatic cancer
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/bab.1326. This article is protected by copyright. All rights reserved.
1
Abstract G-protein-coupled receptors (GPCRs), the largest family of cell-surface molecules involved in a number of biological and pathological processes, have recently emerged as key players in carcinogenesis and cancer progression. Orphan G protein-coupled receptors (oGPCRs) are a group of proteins lacking endogenous ligands. GPR137, one of the novel oGPCR genes, was discovered by homology screening. However, the biological role of GPR137 in cancers has not yet been discussed, and is of great therapeutic interest. In this study, we knocked down GPR137 via a lentivirus system in two human pancreatic cancer cell lines BXPC-3 and PANC-1. Knockdown of GPR137 strongly inhibited cell proliferation and colony formation. Flow cytometry showed that cell cycle was arrested in sub-G1 phase and apoptotic cells were significantly increased after GPR137 knockdown. Western blotting confirmed that GPR137 silencing induced apoptosis due to cleavage of PARP and upregulation of Caspase 3. Furthermore, lentivirus-mediated overexpression of GPR137 promoted the proliferation of PANC-1 cells, suggesting GPR137 as a potential oncogene in pancreatic cancer cells. Taken together, our results prove the importance of GPR137 as a crucial regulator in controlling cancer cell growth and apoptosis.
Keywords: GPR137; GPCR; pancreatic cancer; lentivirus
This article is protected by copyright. All rights reserved.
2
1. Introduction G-protein-coupled receptors (GPCRs) constitute the largest family of cell surface molecules involved in signal transduction during various biological and pathological processes. In recent years, a great number of GPCRs have shown to play a pivotal role in cancer formation and metastasis. In many cancers, the normal physiological functions of GPCRs are often hijacked by the malignant cells, so as to help them evade immune detection, proliferate autonomously, improve the oxygen and nutrient supply, and increase invasion and dissemination (Dorsam and Gutkind 2007). Many GPCRs are aberrantly expressed in various types of malignancies and may contribute to cancer progression (Li et al. 2005). PSGR, a human prostate tissue-specific gene belonging to the GPCR family, is associated with prostate cancer development and progression (Weng et al. 2005). Over-expression of GPR19 confers a specific benefit for lung cancer cell proliferation through accelerating cell cycle transition (Kastner et al. 2012). MAS-related GPCR, member D (MRGD), is highly expressed in lung cancer and involved in tumorigenesis (Nishimura et al. 2012). GPR4 has been known to play an important role in the tube formation of vascular endothelial cells, and its over-expression has been observed in multiple cancers (Ren et al. 2013). Orphan G protein-coupled receptors (oGPCRs) are a group of receptors lacking endogenous ligands, most of which were found by sequence similarity. Despite the advance of molecular biology and bioinformatics, the identification of endogenous ligands of oGPCRs has always been a challenge (Chung et al. 2008). GPR137 is a novel oGPCR gene discovered by homology screening which shares identity with PSGR (Vanti et al. 2003). Increasing evidences reveals that oGPCRs are also implicated in cancer cell proliferation and migration. GPR49 has been shown to be over-expressed in human colon and ovarian primary tumors (McClanahan et al. 2006). GPR55 has been implicated in the tumorigenesis of several cancers, such as cholangiocarcinoma, breast cancer, glioblastoma, prostate cancer, and ovarian cancer, This article is protected by copyright. All rights reserved.
3
suggesting it as a potential target for cancer therapy (Leyva-Illades and Demorrow 2013; Perez-Gomez et al. 2013; Ford et al. 2010; Petitet et al. 2006; Pineiro et al. 2011; Oka et al. 2010). To date, little is known about the biological role of GPR137 in human cancers, including pancreatic cancer. In the present study, in order to assess the effect of GPR137 in pancreatic cancer, we used a lentivirus-mediated RNA interference (RNAi) system to knock down GPR137 expression in two human pancreatic cancer cell lines BXPC-3 and PANC-1. A variety of in vitro cellular assays provided new insights into the regulatory role of GPR137 in pancreatic cancer cell proliferation and apoptosis, which may provide a reference for the development of new therapeutic strategies for pancreatic cancer.
2. Materials and methods 2.1. Lentiviral Vector Production. The
short
harpin
RNA
(shRNA)
sequence
GAACAAAGGCTACCTGGTATTCTCGAGAATACCAGGTAGCCTTTGTTCTTTTTT
(5’-3’)
was
designed to target human GPR137 gene (NM_001170726.1). It was cloned intopFH-L vector (Shanghai Hollybio, China) which contains the green fluorescent protein (GFP) gene as a reporter. Non-targeting shRNA
sequence
(5’-
CTAGCCCGGCCAAGGAAGTGCAATTGCATACTCGAGTATGCAATTGCACTTCCTTGGTTTTTTG TTAAT -3’) was used as control. Lentiviruses were generated by triple transfection of 80% confluent 293T cells with modified pFH-L plasmid and pVSVG-I and pCMV△R8.92 helper plasmids (Shanghai Hollybio, China) using Lipofectamine 2000 (Invitrogen, Carlsbad). After 72 h, lentivirus-mediated GPR137 shRNA (Lv-shGPR137) or control shRNA (Lv-shCon) were collected by purification and precipitation. In addition, the pLVTHM vector (Biovector Science Lab) encoding the full length cDNA of GPR137 was constructed. This article is protected by copyright. All rights reserved.
4
Positive colonies with inserted fragments were confirmed by DNA sequencing to generate pLVTHM-GPR137 expression plasmid. Cells were infected with recombined lentiviruses at a multiplicity of infection (MOI) of 20, and non-infected cells (Con) were used as negative controls.
2.2 Cell Culture. Human pancreatic cancer cell lines BXPC-3 and PANC-1 and human embryonic kidney cell line 293T were from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). These cell lines were grown in DMEM supplemented with 10% fetal bovine serum (FBS; Hyclone) and maintained in a humidified incubator containing 5% CO2 at 37°C.
2.3. Quantitative Real-Time PCR. Total RNA was extracted from cells using Trizol reagent (Invitrogen, Carlsbad), and cDNA was synthesized with random primers following the manufacturer’s protocol (MBI Fermantas, Vilnius, Lithuania). For quantitative real-time PCR (qRT-PCR), two sets of primers were used, GPR137: 5’ACCTGGGGAACAAAGGCTAC -3’ (forward) and 5’- TAGGACCGAGAGGCAAAGAC -3’ (reverse); Actin: 5’- GTGGACATCCGCAAAGAC -3’ (forward) and 5’- AAAGGGTGTAACGCAACTA -3’ (reverse). PCR reactions were performed on BioRad Connet Real-Time PCR platform using following system: 10 µL 2X SYBR premix ex-taq, 0.8 µL primers, 5 µL cDNA and 4.2 µL ddH2O. The cycling parameters were 95 °C for 30 s, 40 cycles of 95°C for 5 s and 60°C for 20 s. All samples were repeated at least three times. The data were analyzed with the comparative threshold cycle (ct) method [fold difference = 2–(
ct of target gene–
ct of reference)
].
This article is protected by copyright. All rights reserved.
5
2.4. Western Blotting. Cells were collected 5 days after lentivirus infection, washed twice with PBS, and suspended in lysis buffer (2% Mercaptoethanol, 20% Glycerol, 4% SDS in 100 mM Tris-HCl buffer, pH 6.8). After 15 min of incubation on ice, the cells were disrupted by ultrasound on ice. The lysates were cleared by centrifugation (12,000 g) at 4℃ for 15 min. Total protein concentration was determined by BCA Protein assay. Protein (20 μg) was loaded onto a 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore). Next, proteins were detected by rabbit anti-GPR137 (11929-1-AP, Proteintech Group, Inc.), rabbit anti-PARP (9542, Cell Signaling Technology) or rabbit anti-Caspase 3 (9661, Cell Signaling Technology) using an ECL kit (Amersham) and exposed to X-ray film. Mouse anti-GAPDH antibody (sc-32233, Santa Cruz, CA, USA) was used as a control to verify equal protein loading.
2.5. Cell Proliferation Assay by Methylthiazoletetrazolium. After infection for 4 days, BXPC-3 and PANC-1 cells were trypsinized and re-seeded in 96-well plates at a density of 3,000 cells per well, respectively. At indicated time points, cells were treated with methylthiazoletetrazolium (MTT) solution (5 mg/mL, 10 μL/well). After 4 h incubation at room temperature, 150 μL of acidic isopropanol (5% isopropanol, 10% SDS and 0.01 mol/L HCL) was added to each well to dissolve the crystals. After 10 min at room temperature, the absorbance of plate was recorded at 595 nm.
2.6. Colony Formation Assay. To observe the relative long-term inhibitory effect of Lv-shGPR137, colony formation assay was performed on BXPC-3 cells with three different treatments: Lv-shGPR137, Lv-shCon and Con. In brief, This article is protected by copyright. All rights reserved.
6
lentivirus-transduced BXPC-3 cells were re-seeded in 6-well plates at a density of 900 cells/well and allowed to grow for 16 days to form natural colonies. At the end of time point, cells were washed by PBS, treated with crystal purple, and washed 3 times by ddH2O. Then the colonies were photographed with a digital camera and the number of colonies was counted. All samples were repeated at least three times.
2.7 Cell Cycle Analysis by Fluorescence-activated Cells Sorting (FACS). Flow cytometry with PI staining was applied to analyze the cell cycle distribution. BXPC-3 cells with three different treatments (Lv-shGPR137, Lv-shCon and Con) for 3 days were seeded in 6-cm dishes with a density of 200,000 cells/dish. After 48 h, cells were collected for fixation and PI staining. Briefly, cells were washed with PBS, fixed with 70% cold ethanol, and suspended in propidium iodide (PI)-containing PBS buffer (100 μg/mL PI and 10 μg/mL RNase A). After 30 min of incubation, a FACS caliber II sorter and Cell Quest FACS system (BD Biosciences, USA) was used to conduct a flow cytometry analysis. The percentages of cells in sub-G1, G0/G1, S and G2/M phases were statistically analyzed.
2.8. Apoptosis Analysis by Flow Cytometry BXPC-3 cells were subjected to three different treatments (Lv-shGPR137, Lv-shCon, and Con) for 6 days. Then cells were washed and re-seeded in 6 cm dishes at a density of 70,000 cells/dish. After 96 h of incubation, the cells were collected and subjected to Annexin V-APC/7-AAD double staining according to the manufacture’s instruction (KGA1026, KeyGEN Biotech, Nanjing, China). Flow cytometry analysis was performed on FACS caliber II sorter and Cell Quest FACS system (BD Biosciences, USA).
This article is protected by copyright. All rights reserved.
7
2.9. Statistical Analysis. All data were expressed as the mean ± SD of three independent experiments. Statistical significance was calculated with Student’s t-test. A P-value of less than 0.05 was considered statistically significant.
2.10. Ethical approval statement All experimental research that is reported in the manuscript has been performed with the approval of Institutional Ethics Committee of Shandong University.
3. Results 3.1 Knockdown of GPR137 by Lentivirus-Mediated RNAi in BXPC-3 and PANC-1 Cells. In order to clarify the biological function of GPR137 in pancreatic cancer, a lentivirus-mediated RNAi system was used. BXPC-3 and PANC-1 cells were subjected to three different treatment (Lv-shGPR137, Lv-shCon and Con), and then the efficiency of infection (>80%) was detected after 72 h (Figure 1A and B). Then the knockdown efficiency of Lv-shGPR137 was observed by qRT-PCR. As shown in Figure 1C and E, the relative expression of GPR137 in BXPC-3 and PANC-1 cells treated with Lv-shGPR137 was significantly inhibited (71.6%, P
