Basic & Clinical Pharmacology & Toxicology, 2015, 117, 251–260
Doi: 10.1111/bcpt.12405
L-Arginine
Attenuates Cardiac Dysfunction, But Further Down-Regulates a-Myosin Heavy Chain Expression in Isoproterenol-Induced Cardiomyopathy
Eva Kralova1, Gabriel Doka1, Lenka Pivackova1, Jasna Srankova1, Kristina Kuracinova2, Pavol Janega2,3, Pavel Babal2, Jan Klimas1 and Peter Krenek1 Department of Pharmacology and Toxicology, Faculty of Pharmacy, Comenius University in Bratislava, Bratislava, Slovak Republic, 2Department of Pathology, Faculty of Medicine, Comenius University in Bratislava, Bratislava, Slovak Republic and 3Slovak Academy of Sciences, Institute of Normal and Pathological Anatomy, Bratislava, Slovak Republic
1
(Received 18 December 2014; Accepted 26 March 2015) Abstract: In view of previously reported increased capacity for nitric oxide production, we suggested that L-arginine (ARG), the nitric oxide synthase (NOS) substrate, supplementation would improve cardiac function in isoproterenol (ISO)-induced heart failure. Male Wistar rats were treated with ISO for 8 days (5 mg/kg/day, i.p.) or vehicle. ARG was given to control (ARG) and ISO-treated (ISO+ARG) rats in water (0.4 g/kg/day). ISO administration was associated with 40% mortality, ventricular hypertrophy, decreased heart rate, left ventricular dysfunction, fibrosis and ECG signs of ischaemia. RT-PCR showed increased mRNA levels of cardiac hypertrophy marker atrial natriuretic peptide, but not BNP, decreased expression of myosin heavy chain isoform MYH6 and unaltered expression of pathological MYH7. ISO increased the protein levels of endothelial nitric oxide synthase, but at the same time it markedly up-regulated mRNA and protein levels of gp91phox, a catalytical subunit of superoxide-producing NADPH oxidase. Fibrosis was markedly increased by ISO. ARG treatment moderately ameliorated left ventricular dysfunction, but was without effect on cardiac hypertrophy and fibrosis. Combination of ISO and ARG led to a decrease in cav-1 expression, a further increase in MYH7 expression and a down-regulation of MYH6 that inversely correlated with gp91phox mRNA levels. Although ARG, at least partially, improved ISO-impaired basal left ventricular systolic function, it failed to reduce cardiac hypertrophy, fibrosis, oxidative stress and mortality. The protection of contractile performance might be related to increased capacity for nitric oxide production and the up-regulation of MYH7 which may compensate for the marked down-regulation of the major MYH6 isoform.
L-arginine is the precursor of nitric oxide, a key regulatory molecule in the cardiovascular system. Decreased nitric oxide synthesis or bioavailability may result in endothelial dysfunction that is present in many cardiovascular diseases such as hypertension, atherosclerosis, erectile dysfunction, myocardial infarction (MI) and congestive heart failure [1]. Nitric oxide is synthesized by three isoforms of nitric oxide synthases, endothelial (eNOS), neuronal (nNOS) and inducible (iNOS), that can all be expressed in the heart [2]. Nitric oxide in the heart can regulate a number of functions such as heart rate, coronary flow, myocardial oxygen consumption, and contractility under both physiological and pathological conditions [2,3]. Nitric oxide has antihypertrophic properties for cardiac myocytes [4], can inhibit the development of cardiac fibrosis [5] and can induce angiogenesis [6], while nitric oxide deficiency can contribute to pathological cardiac remodelling [7]. However, under the conditions of oxidative stress, increased nitric oxide production may lead to cellular injury via toxic peroxynitrite formation [8]. L-arginine supplementation in human heart failure leads to an improvement of endothelium-dependent vasodilation and
Author for correspondence: Dr. Peter Krenek, Comenius University in Bratislava, Faculty of Pharmacy, Department of Pharmacology and Toxicology, Odbojárov 10, 83232 Bratislava, Slovak Republic (fax +421 2 50117 100, e-mail [email protected]).
improved exercise capacity and quality of life [9–11]. L-arginine as a substrate for nitric oxide synthases is able to improve endothelial function in spite of the fact that it is present in the plasma at much higher concentrations than the Km for nitric oxide synthase [12,13]. This ‘arginine paradox’ can be explained by the antagonism of endogenous NOS inhibitor, asymmetric dimethylarginine (ADMA), synthesized by hydrolysis of protein arginine residues methylated by protein arginine methyltransferases (Prmt). ADMA is increased in heart failure [14], and it can be hydrolysed by dimethylarginine dimethylaminohydrolases (Ddah) that were shown to be inhibited by oxidative stress [15], thus leading to higher ADMA levels and suppression of nitric oxide synthesis. In MI in the rat, ADMA levels were reported to be increased in the plasma and myocardial 7 days post-MI [16]. Isoproterenol (ISO)-induced cardiac hypertrophy and dysfunction bears similarities to MI [17], where the initial possible benefit of L-arginine administration [18] had been put into question in another clinical trial [19]. Although some authors reported decreased nitric oxide in ISO-induced heart failure, with a protective effect of L-arginine via polyamine pathways [20], we previously reported an increased nitric oxide synthesis capacity in ISO-induced heart failure while observing at the same time that the positive inotropic effect of nitric oxide was lost in the cardiac myocytes of ISO-treated rats [21]. We
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
EVA KRALOVA ET AL.
252
tested the hypothesis that improving L-arginine availability in ISO-induced cardiomyopathy would lead to positive haemodynamic and structural changes in the heart and favourably alter the markers of cardiac damage and myosin isoform shift. Materials and Methods Animals. We used male Wistar rats (18–20 weeks old) (n = 10–12 per group). Rats were kept under standard conditions and received food and water ad libitum. ISO (5 mg/kg) was administered for 8 days, once daily by intraperitoneal injection [21,22]. L-arginine (ARG) was administered for 8 days orally in drinking water (0.40 g/ kg/day) [23]. The animals in the third group received for 8 days the combination of ISO and L-arginine (ISO+ARG). Control animals (CON) received the vehicle of ISO (0.05% ascorbic acid in 0.9% NaCl, 0.5 ml intraperitoneally) and drinking water ad libitum. Separate groups of rats were used for ECG measurement, left ventricular catheterization and Western blot analyses. All studies were performed 24 hr after the last ISO administration. All procedures involving the use of experimental animals were approved by the State Veterinary and Food Administration of the Slovak Republic. The investigation conforms with the EU Directive 2010/63/EU for animal experiments and Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1985). Electrocardiography. To detect myocardial ischaemia, 12-lead electrocardiography was performed in rats anaesthetized with tribromoethanol (15 ml/kg of 2.5% solution per g of body-weight), which has good analgesic properties and has been demonstrated to have a less depressive influence on cardiac function than some other commonly used anaesthetic procedures [24]. Standard 12-leads ECG was recorded by electrocardiograph SEIVA EKG PRAKTIK VETERINARY 4v (SEIVA s.r.o., Czech Republic) using needle electrodes placed subcutaneously. Heart rate was evaluated as an ECG cycle length (RR duration). Duration of QT was determined from the onset of QRS complex to the end of T wave (i.e. in the crossing of the isoelectric line) in either of the simultaneously recorded leads. Six consecutive beats were evaluated, and the arithmetic means of RR, QRS and QT were obtained. Duration of QT was corrected according to rat cardiac cycle: QTc (in msec.) = QT/ (RR/150)1/2 [25]. In our experiments, the value of the normalization factor for rats was 150 msec. as it was the average cardiac cycle length. ST-segment depression was taken as a sign of ischaemic injury [21]. Left ventricular haemodynamics. To detect cardiac contractile abnormalities, left ventricular catheterization was performed in closedchest rats anaesthetized with tribromoethanol (15 ml of 2.5% solution per g of body-weight) placed on a 37°C table as we described previously [26]. Direct cannulation of the carotid artery was performed using custom-fashioned polyethylene tubing in anaesthetized rats. Polyethylene tubing (PE50, 0.58 mm ID 9 0.96 mm OD; Portex, Kent, UK) was inserted into the carotid artery, and pressure waveform was monitored, recorded and analysed after 10 min. of stabilization using SPEL Advanced Haemosys system (Experimetria Ltd., Budapest, Hungary). Data of systolic and diastolic blood pressure (sBP and dBP) were collected. Consecutively, values of pulse pressure (PP) and mean arterial pressure (MAP) were calculated. Pulse pressure was defined as PP = sBP dBP. MAP was defined as MAP = [(2 9 dBP) + sBP]/ 3. Heart rate, left ventricular pressure (LVP) and the first derivatives of left intraventricular pressure (rate of LVP development, +dP/dt and rate of LVP decline, dP/dt) were monitored continuously, recorded and analysed after 10 min. of stabilization. We also studied the effect
of b-adrenergic stimulation on the above parameters by injecting increasing doses of dobutamine into the left jugular vein as previously described [27]. Western blot analysis. For Western blot analysis, tissue samples from rats killed by CO2 asphyxiation were frozen in liquid nitrogen and stored at 20°C until further processing. Expressions of eNOS, iNOS, hsp90, caveolin-1 and caveolin-3 were determined by Western blot analysis with chemiluminescent detection (ECL Plus; GE Healthcare Europe GmbH, Freiburg, Germany) and compared with the expression of actin. In preliminary experiments, we verified that specific antieNOS, iNOS, hsp90, caveolin-1, caveolin-3, gp91phox, manganese superoxide dismutase (MnSOD) (BD Pharmingen, Franklin Lakes, NJ, USA) and anti-actin (Sigma-Aldrich, St.Louis, Missouri, USA) antibodies detected a single band of expected molecular weight in positive controls or ventricular homogenates and that the expression of actin was not changed by ISO administration. As a positive control for iNOS, we used homogenates from lungs of rats exposed to bacterial lipopolysaccharide (LPS, 3 mg/kg; Sigma-Aldrich) for 4 hr to increase the expression of iNOS. Quantification was performed as described previously [22]. RNA isolation and RT-qPCR. Left ventricle samples were snap-frozen in liquid nitrogen immediately after dissection and stored at 80°C until further processing. Total RNA was isolated by phenol/ chloroform/guanidinium thiocyanate extraction (TRI Reagentâ; SigmaAldrich) according to the manufacturer’s protocol. The quality of isolated RNA was controlled by electrophoresis in 2% agarose gel. Concentration of isolated total RNA was quantified by NanoDrop ND1000 Spectrophotometer. Reverse transcription (High Capacity cDNA Reverse Transcription Kitâ; Life Technologies, Bratislava, Slovakia) was performed on intact RNA samples, according to electrophoresis and A260/A280 ratios, using 2 lg RNA per reaction. Real-time qPCR (ABI Prism 7300; Applied Biosystems, Foster City, California, USA) analysis was performed using Maximaâ SYBR Green/ROX qPCR Master Mix Kit (Thermo Scientific Waltham, Massachusetts, USA). The sequences of primers used for target detection are shown in table 1. Relative expressions of the genes of interest were evaluated from quantification cycles by delta–delta method with multiple reference genes (ACTB, B2M). Histological analysis. The hearts were fixed 24 hr in 10% formalin, the apical half of the ventricles was routinely processed in paraffin, and 5-lm-thick slices were stained with haematoxylin and eosin. The slides were evaluated in a Nikon light microscope ECLIPSE 80i (Nikon Corporation, Tokyo, Japan). Deparaffinized and rehydrated 5lm-thick slices were stained with a modified technique with picrosirius red as follows: the slides were submerged in 0.2% phosphomolybden acid for clearing the cytoplasm, and then, the slides were stained with 0.1% sirius red F3BA in a saturated water solution of picric acid for 90 min. The slides were washed 2 min. in 0.01 N HCl, dehydrated and mounted. Four fields covering the whole slice surface were documented at 259 magnification with a digital camera (Imaging Source, Bremen, Germany) and evaluated with ImageJ software (National Institute of Health, Bethesda, MD, USA). Threshold values were determined for the particular colours of spectrum, the numbers of pixels of each colour were counted, and the percentage of the picture’s area was calculated. Statistical analysis. Results are expressed as average standard error of the mean. Means were compared using ANOVA with subsequent Tukey’s HSD multiple comparison test for normally distributed data or Kruskal–Wallis test followed by pairwise Wilcoxon test with Holm–Bonferroni correction for nonparametric data. Correlation was
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
L-Arginine
in Isoproterenol-Induced Cardiomyopathy
253
Table 1. Primer sequences for quantitative RT-PCR. Gene
GenBank accession number
Primer sequence (50 –30 )
PCR product length (bp)
Actb
NM_031144.2
81
B2M
NM_012512.1
Cybb
NM_023965.1
Ddah2
NM_031605.2
Myh6
NM_017239.2
Myh7
NM_017240.1
Myh7b
NM_001107794.2
Forward: CCGCGAGTACAACCTTCTTG Reverse: GCAGCGATATCGTCATCCA Forward: ATGGAGCTCTGAATCATCTGG Reverse: AGAAGATGGTGTGCTCATTGC Forward: TGGGAGACTGGACTGAGGGGCTA Reverse: GGCTGTACCAAAGGGCCCATCAA Forward: AGGCCTGAGGTTGATGGAGT Reverse: GTCCAGCGTAGCGTTCTCAT Forward: GCCCTTTGACATCCGCACAGAGT Reverse: TCTGCTGCATCACCTGGTCCTCC Forward: GCGGACATTGCCGAGTCCCAG Reverse: GCTCCAGGTCTCAGGGCTTCACA Forward: CCCGATTCTCAACACCAACACCTCT Reverse: CATCAGGCACCCAGACCCGT Forward: GGGGGTAGGATTGACAGGAT Reverse: GGATCTTTTGCGATCTGCTC Forward: GACCGGATCGGCGCAGTCAGT Reverse: GGAGTCTGCAGCCAGGAGGTCT Forward: GGGGCCCGCAAGGTCATTGG Reverse: CCACAGGCAGCTCCACCTCC
Nppa
NM_012612.2
Nppb
NM_031545.1
Prmt1
NM_024363.1
105 110 87 152 133 150 104 78 133
Actb, actin; B2M, b2-microglobulin; Cybb, gp91phox; Ddah2, dimethylarginine dimethylaminohydrolase 2; Myh6, myosin heavy chain 6 (a-myosin heavy chain); Myh7, myosin heavy chain 7 (b-myosin heavy chain); Myh7b, myosin heavy chain 7b; Nppa, atrial natriuretic peptide; Nppb, brain natriuretic peptide; Prmt1, protein arginine methyltransferase 1.
Table 2. Gravimetric characteristics of experimental groups.
Body-weight (g) Ventricular weight (mg) VW/BW (mg/g)
CON
ISO
ARG
ARG+ISO
361 8 950 39 2.63 0.08
351 5 1263 24* 3.60 0.03*
356 6 912 36 2.56 0.10
351 10 1201 64*,** 3.41 0.10*,**
CON, controls; ARG, L-arginine-treated group; ISO, isoproterenol-treated group. Data are mean S.E.M. (n = 7–10 per group; *p < 0.05 versus CON, **p < 0.05 versus ARG). performed using Pearson correlation coefficient. All results were computed in GraphPad Prism 4.0 (GraphPad Software, Inc., San Diego, California, USA) or in R environment (version 2.15.1; R Foundation for Statistical Computing, Vienna, Austria).
Results Mortality and gravimetric data. Isoproterenol treatment was associated with a mortality rate of about 40% that was not ameliorated by L-arginine (fig. 1). Ventricular weight and VW/BW ratio were significantly greater in ISO rats than in control rats (p < 0.05 versus CON, table 2). L-arginine alone had no effect on heart weight, and it did not influence the increase of ventricular weight after ISO administration. Body-weight was not altered by ISO or ARG or their combinations. Electrocardiography. QT and QTc duration were significantly prolonged in the ISO and ISO+ARG groups. The duration of QRS was without changes in all medicated groups (table 3). ECG showed signs of myocardial ischaemia – depression of ST segment (negative
T wave) in the ISO groups irrespective of L-arginine treatment (table 3). Haemodynamic data. Arterial systolic and dBPs were decreased by ISO, and this decrease was not influenced by ARG. L-arginine alone had no effect on arterial blood pressure (table 3). Compared to the control group, systolic pressure in left ventricle (sLVP) was lower in the ISO group, indicating left ventricular dysfunction (p < 0.05 versus CON, table 3). When L-arginine was added to ISO treatment, sLVP was not different from the controls. ARG alone tended to increase sLVP without achieving statistical significance (table 3). Heart rate was lower in the ISO group than in the control group, confirming our previous study [21]. ARG did not influence the decreased heart rate (table 3). Under basal conditions, the rate of LVP development (+dp/dt) and the rate of LVP decline (dp/dt) were markedly lower after ISO administration (p < 0.05 versus CON, table 3). Larginine was able to restore +dp/dt and dp/dt to levels not significantly different from the control (table 3). Under badrenergic stimulation with increasing doses of dobutamine,
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
EVA KRALOVA ET AL.
254
tended to be decreased after the administration of ISO alone and was significantly down-regulated in ISO+ARG. The expression of gp91phox, a subunit of superoxide-producing Nox2, was markedly increased after ISO treatment, and this remained unaffected in the ISO+ARG group (table 4). The expression of MnSOD was not altered by any treatment (table 4).
Fig. 1. L-arginine does not prevent mortality induced by ISO. Kaplan– Meier survival curves demonstrated that the prevalence of death was significantly higher in the rats treated with ISO (p < 0.0001 by logrank test) and that L-arginine had no significant influence on this increased mortality. ISO, isoproterenol; ARG, L-arginine.
LVP and heart rate were lower in the ISO and ISO+ARG groups compared to controls (fig. 2). The indicator of left ventricular contractility (+dP/dt) was markedly reduced in the ISO group, while in the ISO+ARG group the contractile function was improved. The indicator of ventricular relaxation (dP/dt) showed a mild improvement only at the lowest dose of dobutamine used. Protein levels of nitric oxide signalling proteins and proteins involved in the regulation of oxidative stress. Confirming our previous data [21], we noted an increased eNOS expression after ISO treatment, and eNOS was also increased by ARG alone and in combination with ISO (fig. 3, table 4). We did not detect nNOS in left ventricular samples, which is consistent with previous data [21]. The expressions of iNOS, hsp90 and MnSOD were unaltered by ISO or ARG. The expression of the allosteric modulator of NOS, caveolin-1,
Messenger RNA levels of foetal genes and myosin isoforms. Real-time PCR analysis showed that the expression of atrial natriuretic peptide (ANP) was increased 15 times in the left ventricle of ISO-treated rats, with no effect of L-arginine (p < 0.05, fig. 4). Interestingly, brain natriuretic peptide expression was not altered by ISO, ARG or their combination (fig. 4). The level of the physiological Myh6 (a-myosin heavy chain) was down-regulated by ISO (39%, p < 0.05 versus Control, fig. 3) and unaltered by ARG alone, and it was further down-regulated when ISO treatment was combined with L-arginine administration (59%, p < 0.05 versus CON, p < 0.05 versus ISO, p < 0.05 versus ARG, fig. 4). Pathological Myh7 (b-myosin heavy chain) only tended to be increased after the administration of ISO alone (+40%, NS), but it was significantly up-regulated in the combined group ISO+ARG (+55%, p < 0.05 versus ARG). The expression of a quantitatively minor isoform of myosin heavy chain, Myh7b, was decreased by ISO alone (56%, p < 0.05 versus CON) and in the combined ISO+ARG group (45% versus ARG, p < 0.05), having a similar pattern of expression change like Myh6. The ratio of Myh6 versus all myosins was lower in the ISO group compared to control (p < 0.05), and it was further depressed in ISO+ARG group (p < 0.05 versus CON, p < 0.05 versus ISO, p < 0.05 versus ARG, fig. 4). Interestingly, Myh6 expression levels correlated inversely with gp91phox at the mRNA level in the ISO+ARG group (R2 = 0.7327, p = 0.0016), but not in others.
Table 3. Basic haemodynamic and electrocardiographic parameters. Control (CON) Arterial haemodynamics Systolic blood pressure (mmHg) Diastolic blood pressure (mmHg) Pulse pressure (mmHg) Mean arterial pressure (mmHg) Left ventricular haemodynamics Left ventricular pressure (mmHg) +dP/dt (mmHg/s) dP/dt (mmHg/s) Heart rate (bpm) Electrocardiography RR duration (ms) QT duration (ms) QTc duration (ms) QRS duration (ms) Occurrence of ST depression (N/n)
116 84 32 95
3 4 2 3
133 4839 3886 392
3 436 268 9
162 71 69 21 0/7
4 2 2 1
Isoproterenol (ISO) 107 75 32 85
4* 6 6 4*
121 3461 2638 354
4* 359* 140* 11*
187 5* 95 3* 85 3* 21 1 9/10*
L-arginine
(ARG)
120 85 35 103
3 5 5 6
142 5063 4177 400
5 331 239 16
160 74 72 21 0/7
6 2 3 1
Data are mean S.E.M. (n = 7–10 per group; *p < 0.05 versus CON, **p < 0.05 versus ARG, ***p < 0.05 versus ISO).
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
ARG+ISO 105 74 31 84
4*,** 5 2 4*,**
129 4351 3443 349
4 719 272*** 10*,**
184 7*,** 91 2*,** 82 2*,** 21 1 8/8*,**
L-Arginine
in Isoproterenol-Induced Cardiomyopathy
255
Fig. 2. L-arginine moderately improves ISO-induced impairment of the left ventricular function. Left ventricular haemodynamics. Responses of the left ventricular pressure (LVP), the heart rate (HR), the maximum rate of LVP development (+dP/dt) and the maximum rate of LVP decline (dP/ dt) to increased doses of dobutamine are shown. Data are presented as mean standard error of the mean; n = 6–8 per group; *p < 0.05 versus CON; #p < 0.05 versus ARG; †p < 0.05 versus ISO. ISO, isoproterenol; ARG, L-arginine; CON, control.
A
B
C
Fig. 3. L-arginine did not modify ISO-related alterations of nitric oxide signalling proteins. Representative Western blot autoluminograms. (A) proteins related to nitric oxide signalling pathways (eNOS, iNOS, hsp90, cav-1, cav-3); (B) proteins related to oxidative stress (gp91phox, MnSOD); (C) cytoskeletal proteins (a-actinin and b-actin). ISO, isoproterenol; ARG, L-arginine.
Messenger RNA levels of protein arginine methyltransferase 1 (Prmt1) and dimethylaminoarginine hydrolase 2 (Ddah2). In the ISO and ISO+ARG groups, we observed a decreased expression of Prmt1 that is involved in the methylation of protein arginine residues and can be implicated in the synthesis of endogenous NOS inhibitor, ADMA, after the administration of ISO alone (24%, p < 0.07 versus CON) and ISO+ARG (30%, p < 0.05 versus ARG) (fig. 5). We also
observed a trend towards an increased expression of ADMAdegrading enzyme Ddah2 in the ISO group (+38%, p = 0.075) and a significant increase in the ISO+ARG group (+63%, p < 0.05 versus CON, ARG) (fig. 5). Histological analysis. Routine evaluation of haematoxylin-and-eosin-stained histology slides showed large areas of fibrosis in different stages of
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
EVA KRALOVA ET AL.
256
Table 4. Level of protein expression in left ventricular tissue determined by Western blot. CON
ISO
Nitric oxide signalling proteins eNOS 100 6 130 iNOS 100 7 108 hsp90 100 4 109 cav-1 100 7 74 cav-3 100 5 90 ROS-regulating enzymes gp91phox 100 7 346 MnSOD 100 7 94 Cytoskeletal proteins Actinin 100 7 94 b-actin 100 6 93
9* 14 9 8 5
ARG 138 110 101 82 92
12* 11 7 10 7
ARG+ISO 156 111 114 69 88
12* 14 11 9* 4
42* 8
107 14 102 7
379 44* 88 7
4 5
96 5 108 5
90 5 102 9
eNOS and iNOS, endothelial and inducible nitric oxide synthase; hsp90, heat-shock protein 90; cav-1 and cav-3, caveolin 1 and 3; gp91phox, haeme-binding subunit of NADPH oxidase; MnSOD, manganese superoxide dismutase; CON, control, ISO, isoproterenol; ARG, L-arginine. Data are mean S.E.M. (n = 10–13 per group; per cent of Control; *p < 0.05 versus CON).
maturation in the myocardium of heart ventricles with maximum in the subendocardial region. The picrosirius red detected only mature fibrous tissue by red colour staining in myocardial muscle. There was a significant increase of myocardial fibrosis after the induction of ischaemic damage by ISO administration. This increase was not affected by L-arginine administration (fig. 6). Discussion In the context of previously reported increased capacity for nitric oxide production [21], we tested the hypothesis that Larginine supplementation would improve left ventricular structure and function in ISO-induced cardiomyopathy. As expected, ISO administration induced cardiac hypertrophy and fibrosis. Surprisingly, L-arginine had no effect on the hypertrophic response to ISO, in spite of reports that nitric oxide in vitro [4] and eNOS up-regulation in cardiac myocytes in vivo [28] can attenuate cardiac hypertrophy induced by catecholamines. Bartunek et al. [23] reported that chronic Larginine treatment, at the same dose as used in our study, had no effect on left ventricular mass in rats with aortic stenosis, although it did increase cardiac cGMP levels and tended to increase cardiac constitutive nitric oxide synthase levels [23]. We observed that eNOS was up-regulated in the ISO+ARG group, which would further favour an antihypertrophic effect of the nitric oxide synthase substrate. The failure of L-arginine to decrease cardiac mass in our experiment could be due to decreased nitric oxide bioavailability, as discussed below, or the intensity of the hypertrophic stimulus, intermittent administration of ISO being more effective than constant infusion in inducing cardiac damage [29]. Alternatively, increased arginine degradation by arginases could limit the action of supplemented L-arginine. Arginase I is induced after MI in human
beings [30], and ISO administration to rats was found to bear similarities to MI [17]. There are reports that in heart failure and MI, the levels of the endogenous NOS inhibitor ADMA are increased [14]. We determined the expression of Prmt1 that is involved in the methylation of protein arginine residues and thus implicated in several processes, including ADMA production, but also other important signalling functions related to protein arginine methylation, such as regulation of gene expression [31]. Interestingly, we observed a decreased expression of Prmt1 in the ISO and ISO+ARG groups, so likely less ADMA production, and we observed increased expression of Ddah2 in the ISO+ARG group, which would favour increased ADMA degradation and consequently more nitric oxide synthesis. However, Ddah were shown to be inhibited by oxidative stress [15], so it is possible that ADMA degradation could be hampered in the ISO and ISO+ARG groups, where gp91phox expression was markedly increased. The decreased expression of Prmt1 could have other consequences, as methyl donor deficiency induces hypertrophic cardiomyopathy via decreased protein methylation by Prmt1 and acetylation by SIRT1 [32]. Isoproterenol treatment induced cardiac fibrosis, and L-arginine did not influence it. Several studies have shown decreased fibroblast proliferation and collagen synthesis after exposure to nitric oxide or natriuretic peptides that stimulate the formation of cGMP [5,33,34]. Arginine supplementation failed to reduce cardiac hypertrophy [35,36], fibrosis and left ventricular dysfunction in SHR rats [35], although conflicting results have also been reported [37]. L-arginine treatment attenuated the development of post-infarction fibrosis [38], and in one study, it reduced cardiac fibrosis also in ISOinduced heart failure [20]. The differences may be explained by different modes of arginine administration and dosage, as well as different duration of treatment. Isoproterenol increased the cardiac capacity for nitric oxide production that we expected to be further increased by ARG, which could, in theory, improve endothelial function. However, our previous data showed no change of endothelial function after ISO treatment in the aorta, where an up-regulation of eNOS was accompanied by increased cav-1 that could bind eNOS in an inhibitory complex [22]. In the left ventricle, we observed a decreased cav-1 expression in the left ventricle together with increased eNOS, which should improve nitric oxide production in the tissue. We previously reported that ISO treatment with an identical protocol leads to a loss of inhibitory effect of L-NAME on the fractional shortening in isolated cardiac myocytes [21]. The positive, albeit moderate, L-arginine effect on haemodynamics could thus be due to increased nitric oxide synthesis in the heart, although the finding of increased NADPH oxidase puts this in question, as it may lead to decreased availability of nitric oxide and the formation of peroxynitrite. We observed a marked ST-segment depression and a negative T wave after ISO treatment that indicates myocardial ischaemia [39]. L-arginine did not influence these changes; it is thus likely that it did not improve myocardial perfusion and it did not decrease myocardial oxygen consumption in vivo.
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
L-Arginine
ANP
20
*
Fold control
10 5 0
CON
ISO
Fold control
*
0.0
ISO
ISO
MYH7
CON
*# 0.5
ISO
ARG ISO+ARG
MYH6/total MHC
*
80
*
#
0.5
100
1.0
ISOARG
1.0
ARG ISO+ARG
MYH7B
ARG
1.5
0.0 CON
CON
2.0
*#+
0.5
1.5
Fold control
0.5
ARG ISO+ARG
1.0
0.0
1.0
MYH6
B 1.5
BNP
1.5
Fold control
Fold control
15
257
2.0
*#
Ratio (%)
A
in Isoproterenol-Induced Cardiomyopathy
*#+
60 40 20 0
0.0 CON
ISO
CON
ARG ISO+ARG
ISO
ARG ISO+ARG
Fig. 4. L-arginine did not modify ISO-induced up-regulation of ANP, but further decreased physiological MYH6 and increased MYH7 in ISO-treated rats. Left ventricular mRNA levels of selected foetal genes in left ventricular tissue determined by RT-PCR. (A) cardiac hypertrophy and failure-related factors. ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; (B) cardiac muscle myosin heavy chain genes Myh6, Myh7 and Myh7b. Mean S.E.M. (n = 5–9 per group; *p < 0.05 versus CON; #p < 0.05 versus ARG; †p < 0.05 versus ISO). ANP and BNP, atrial and brain natriuretic peptide; MYH6, MYH7 and MYH7b, myosin heavy chain 6, 7 and 7b; ISO, isoproterenol; ARG, L-arginine; CON, control.
Prmt1
1.0
p = 0.056
*
0.5
0.0
Ddah2
2.0
Fold control
Fold control
1.5
*#
1.5 1.0 0.5 0.0
CON
ISO
ARG
ISOARG
CON
ISO
ARG ISOARG
Fig. 5. L-arginine did not appreciably modify ISO-induced decrease of Prmt1 and increased Ddah2 in ISO-treated rats. Left ventricular mRNA levels of protein arginine methyltransferase 1 (Prmt1) and dimethylarginine dimethylaminohydrolase (Ddah2) determined by RT-PCR. CON, control; ISO, isoproterenol. *p < 0.05 versus CON, p < 0.05 versus L-arginine.
The gp91phox subunit of Nox2 superoxide-producing NADPH oxidase was markedly up-regulated after ISO treatment, but no concomitant up-regulation of superoxide-scavenging MnSOD was observed. This has not been reported to
date, although oxidative stress via increased NADPH oxidase activity was previously described in ISO-induced cardiac damage [40]. Oxidative stress associated with Nox2 induction could lead to nitrosative stress when nitric oxide production is
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
EVA KRALOVA ET AL.
258 A
CON
ARG
ISO
ISO+ARG
B
14.00
*
% of section area
12.00
200 μm *#
10.00 8.00 6.00 4.00 2.00 0.00
CON
ISO
ARG
ISO+ARG
Fig. 6. L-arginine failed to improve isoproterenol (ISO)-induced fibrosis of the left ventricle. (A) myocardium of the left ventricle. ISO administration led to focal fibrosis (ISO) of the myocardium with maximum in the subendocardial region (arrow). The administration of L-arginine did not prevent the fibrosis development (ISO+ARG). Control heart (CON) and after L-arginine administration alone (ARG). Picrosirius red, objective mag. 259. (B) morphometric evaluation of myocardial fibrosis detected with picrosirius red staining. L-arginine (ARG) administration did not affect fibrous tissue content in myocardium when compared with control (CON); ISO administration significantly increased myocardial fibrosis that was not prevented by L-arginine administration (ISO+ARG). *p < 0.05 versus CON, #p < 0.05 versus ARG
increased after L-arginine administration. Increased nitric oxide, superoxide and, subsequently, peroxynitrite formation during reperfusion of the heart leads to protein nitration and cellular injury. Blocking the nitric oxide synthases and superoxide production can ameliorate post-ischaemic recovery of myocardial function and coronary perfusion [41], intracoronary infusion of L-arginine aggravates myocardial stunning in dogs while augmenting protein tyrosine nitration [42] and, finally, peroxynitrite produced by iNOS and NADPH oxidase activities contributes to cytokine-induced myocardial contractile failure [43]. Nitrosative stress was reported in ISO-infused mice [44]. Peroxynitrite is a major contributor to cardiomyocyte apoptosis [45]. Together with our data, this indicates that Larginine supplementation could be detrimental for the heart in states where production of superoxide is augmented, due to
the possibility of an increased risk of toxic peroxynitrite formation. Consistent with previous reports [21], ISO impaired left ventricular performance. ISO decreased the expression of amyosin heavy chain (Myh6), the predominant isoform in the adult rat heart. In L-arginine-supplemented, ISO-treated rats, the degree of dysfunction was not as severe as with ISO alone. However, at the same time, we paradoxically observed an augmentation of the foetal isoform b-myosin heavy chain (Myh7) and a further decreased contribution of the major Myh6 isoform to total myosin mRNAs. b-Myosin heavy chain was reported to have a slower kinetics of force development and relaxation and a better economy of ATP hydrolysis with respect to force generation, albeit in different models than ISO-induced cardiomyopathy [46,47]. The inverse correlation
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
L-Arginine
in Isoproterenol-Induced Cardiomyopathy
between Myh6 expression with gp91phox at mRNA level in the ISO+ARG group, but not in other groups, indicates that oxidative and/or nitrosative stress could suppress Myh6 expression. This could indicate a possibly new and important regulatory mechanism of Myh6 expression by oxidative stress that would be worth a further study. There are several limitations in our study that need to be taken into account. We only measured mRNA levels of Myh6 and Myh7. However, during the development of pathological cardiac hypertrophy, the dynamically changing mRNA and protein levels of the myosins were reported to be superimposed [48]. We did not measure whether the levels of nitric oxide in the heart were altered by L-arginine. Regarding ARG administration, increased tissue cGMP levels after the same dose of ARG and increased tissue nitrite content were reported [23,49]. We cannot exclude that L-arginine administration affected other pathways, such as the polyamine pathways, that were reported to be suppressed in the ISO model by ARG administration [20]; however, the protocol of the study had a different mode of ARG administration and dose used. Conclusions We conclude that an 8-day treatment of rats with ISO resulted in cardiac hypertrophy and left ventricular dysfunction accompanied by oxidative stress. While L-arginine treatment moderately improved ventricular haemodynamics, it did not influence electrocardiographic abnormalities and modulators of oxidative stress and it failed to reduce cardiac hypertrophy, fibrosis and the overall mortality induced by ISO. The protection of contractile performance could be associated with increased eNOS-derived nitric oxide production, and the unexpected and paradoxical up-regulation of the more ATP consumption-efficient b-myosin heavy chain Myh7, which might compensate for the further loss of a-myosin heavy chain Myh6 in ISO+ARG group, possibly due to oxidative stress. Our data do not support the hypothesis that the administration of L-arginine would be beneficial in cardiac conditions associated with neurohumoural activation and oxidative stress. Acknowledgements This study was supported by APVV-0887-11 Molecular aspects of drug-induced heart failure and ventricular arrhythmias from the Slovak Research and Development Agency, and the grants 1/0294/15 and 1/0564/13 from the Science Grant Agency (VEGA), Slovak Republic. We thank Ms. Simona Kolembusova for her excellent technical assistance. Conflict of interest None declared. References 1 Endemann DH. Endothelial dysfunction. J Am Soc Nephrol 2004;15:1983–92. 2 Massion PB. Nitric oxide and cardiac function: ten years after, and continuing. Circ Res 2003;93:388–98.
259
3 Duncker DJ, Bache RJ. Regulation of coronary blood flow during exercise. Physiol Rev 2008;88:1009–86. 4 Calderone A, Thaik CM, Takahashi N, Chang DL, Colucci WS. Nitric oxide, atrial natriuretic peptide, and cyclic GMP inhibit the growth-promoting effects of norepinephrine in cardiac myocytes and fibroblasts. J Clin Invest 1998;101:812. 5 Takizawa T, Gu M, Chobanian AV, Brecher P. Effect of nitric oxide on DNA replication induced by angiotensin II in rat cardiac fibroblasts. Hypertension 1997;30:1035–40. 6 Duda DG, Fukumura D, Jain RK. Role of eNOS in neovascularization: NO for endothelial progenitor cells. Trends Mol Med 2004;10:143–5. 7 Bartunek J, Weinberg EO, Tajima M, Rohrbach S, Katz SE, Douglas PS et al. Chronic NG-nitro-L-arginine methyl ester-induced hypertension: novel molecular adaptation to systolic load in absence of hypertrophy. Circulation 2000;101:423–9. 8 Pacher P, Beckman JS, Liaudet L. Nitric oxide and peroxynitrite in health and disease. Physiol Rev 2007;87:315–424. 9 Rector TS, Bank AJ, Mullen KA, Tschumperlin LK, Sih R, Pillai K et al. Randomized, double-b, placebo-controlled study of supplemental oral L-arginine in patients with heart failure. Circulation 1996;93:2135–41. 10 Hambrecht R, Hilbrich L, Erbs S, Gielen S, Fiehn E, Schoene N et al. Correction of endothelial dysfunction in chronic heart failure: additional effects of exercise training and oral L-arginine supplementation. J Am Coll Cardiol 2000;35:706–13. 11 Doutreleau S, Mettauer B, Piquard F, Rouyer O, Schaefer A, Lonsdorfer J et al. Chronic L-arginine supplementation enhances endurance exercise tolerance in heart failure patients. Int J Sports Med 2006;27:567–72. 12 B€oger RH, Bode-B€oger SM. The clinical pharmacology of L-arginine. Annu Rev Pharmacol Toxicol 2001;41:79–99. 13 Bredt DS, Snyder SH. Isolation of nitric oxide synthetase, a calmodulin-requiring enzyme. Proc Natl Acad Sci USA 1990;87:682–5. 14 Visser M, Paulus WJ, Vermeulen MAR, Richir MC, Davids M, Wisselink W et al. The role of asymmetric dimethylarginine and arginine in the failing heart and its vasculature. Eur J Heart Fail 2010;12:1274–81. 15 Sydow K, M€unzel T. ADMA and oxidative stress. Atheroscler Suppl 2003;4:41–51. 16 Gray GA, Patrizio M, Sherry L, Miller AA, Malaki M, Wallace AF et al. Immunolocalisation and activity of DDAH I and II in the heart and modification post-myocardial infarction. Acta Histochem 2010;112:413–23. 17 Heather LC, Catchpole AF, Stuckey DJ, Cole MA, Carr CA, Clarke K. Isoproterenol induces in vivo functional and metabolic abnormalities; similar to those found in the infarcted rat heart. Acta Physiol Pol 2009;12:31. 18 Bednarz B, Jaxa-Chamiec T, Maciejewski P, Szpajer M, Janik K, Gniot J et al. Efficacy and safety of oral L-arginine in acute myocardial infarction. Results of the multicenter, randomized, doubleblind, placebo-controlled ARAMI pilot trial. Kardiol Pol 2005;62:421–7. 19 Schulman SP, Becker LC, Kass DA, Champion HC, Terrin ML, Forman S et al. L-arginine therapy in acute myocardial infarction: the vascular interaction with age in myocardial infarction (VINTAGE MI) randomized clinical trial. JAMA 2006;295:58– 64. 20 Lin Y, Wang L-N, Xi Y-H, Li H-Z, Xiao F-G, Zhao Y-J et al. Larginine inhibits isoproterenol-induced cardiac hypertrophy through nitric oxide and polyamine pathways. Basic Clin Pharmacol Toxicol 2008;103:124–30. 21 Krenek P, Kmecova J, Kucerova D, Bajuszova Z, Musil P, Gazova A et al. Isoproterenol-induced heart failure in the rat is associated with nitric oxide-dependent functional alterations of cardiac function. Eur J Heart Fail 2009;11:140–6.
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
260
EVA KRALOVA ET AL.
22 Krenek P, Klimas J, Kroslakova M, Gazova A, Plandorova J, Kucerova D et al. Increased expression of endothelial nitric oxide synthase and caveolin-1 in the aorta of rats with isoproterenolinduced cardiac hypertrophy. Can J Physiol Pharmacol 2006;84:1245–50. 23 Bartunek J, Dempsey S, Weinberg EO, Ito N, Tajima M, Rohrbach S et al. Chronic L-arginine treatment increases cardiac cyclic guanosine 50 -monophosphate in rats with aortic stenosis: effects on left ventricular mass and beta-adrenergic contractile reserve. J Am Coll Cardiol 1998;32:528–35. 24 Roth DM, Swaney JS, Dalton ND, Gilpin EA, Ross J Jr. Impact of anesthesia on cardiac function during echocardiography in mice. Am J Physiol Heart Circ Physiol 2002;282:H2134–40. 25 Kmecova J, Klimas J. Heart rate correction of the QT duration in rats. Eur J Pharmacol 2010;641:187–92. 26 Kirchhefer U, Klimas J, Baba HA, Buchwalow IB, Fabritz L, Huls M et al. Triadin is a critical determinant of cellular Ca cycling and contractility in the heart. Am J Physiol Heart Circ Physiol 2007;293:H3165–74. 27 Jankyova S, Kmecova J, Cernecka H, Mesarosova L, Musil P, Brnoliakova Z et al. Glucose and blood pressure lowering effects of Pycnogenolâ are inefficient to prevent prolongation of QT interval in experimental diabetic cardiomyopathy. Pathol Res Pract 2012;208:452–7. 28 Massion PB. Cardiomyocyte-restricted overexpression of endothelial nitric oxide synthase (NOS3) attenuates -adrenergic stimulation and reinforces vagal inhibition of cardiac contraction. Circulation 2004;110:2666–72. 29 Ma X, Song Y, Chen C, Fu Y, Shen Q, Li Z et al. Distinct actions of intermittent and sustained b-adrenoceptor stimulation on cardiac remodeling. Sci China Life Sci 2011;54:493–501. 30 Harpster MH, Bandyopadhyay S, Thomas DP, Ivanov PS, Keele JA, Pineguina N et al. Earliest changes in the left ventricular transcriptome post-myocardial infarction. Mamm Genome 2006; 17:701–15. 31 Nicholson TB, Chen T, Richard S. The physiological and pathophysiological role of PRMT1-mediated protein arginine methylation. Pharmacol Res 2009;60:466–74. 32 Garcia MM, Gueant-Rodriguez R-M, Pooya S, Brachet P, Alberto J-M, Jeannesson E et al. Methyl donor deficiency induces cardiomyopathy through altered methylation/acetylation of PGC-1a by PRMT1 and SIRT1. J Pathol 2011;225:324–35. 33 Hou J, Kato H, Cohen RA, Chobanian AV, Brecher P. Angiotensin II-induced cardiac fibrosis in the rat is increased by chronic inhibition of nitric oxide synthase. J Clin Invest 1995;96:2469. 34 Li P, Wang D, Lucas J, Oparil S, Xing D, Cao X et al. Atrial natriuretic peptide inhibits transforming growth factor -induced smad signaling and myofibroblast transformation in mouse cardiac fibroblasts. Circ Res 2008;102:185–92. 35 Brooks WW, Conrad CH, Robinson KG, Colucci WS, Bing OHL. L-arginine fails to prevent ventricular remodeling and heart failure in the spontaneously hypertensive rat. Am J Hypertens 2009; 22:228–34.
36 Kristek F. Long-term administration of L-arginine did not influence blood pressure, heart rate, cardiac hypertrophy or arterial wall thickness of spontaneously hypertensive rats. Exp Physiol 1998;83:595–603. 37 Chang H, Wu CY, Hsu Y, Chen HI. Reduction of ventricular hypertrophy and fibrosis in spontaneously hypertensive rats by Larginine. Chin J Physiol 2005;48:15. 38 Xu X, Zhao W, Lao S, Wilson BS, Erikson JM, Zhang JQ. Effects of exercise and L-arginine on ventricular remodeling and oxidative stress. Med Sci Sports Exerc 2010;42:346–54. 39 Muller JE, Maroko PR, Braunwald E. Evaluation of precordial electrocardiographic mapping as a means of assessing changes in myocardial ischemic injury. Circulation 1975;52:16–27. 40 Zhang G-X, Ohmori K, Nagai Y, Fujisawa Y, Nishiyama A, Abe Y et al. Role of AT1 receptor in isoproterenol-induced cardiac hypertrophy and oxidative stress in mice. J Mol Cell Cardiol 2007;42:804–11. 41 Zweier J. Measurement of nitric oxide and peroxynitrite generation in the postischemic heart. Evidence for peroxynitrite-mediated reperfusion injury. J Biol Chem 1996;271:29223–30. 42 Mori E, Haramaki N, Ikeda H, Imaizumi T. Intra-coronary administration of L-arginine aggravates myocardial stunning through production of peroxynitrite in dogs. Cardiovasc Res 1998;40:113–23. 43 Ferdinandy P, Danial H, Ambrus I, Rothery RA, Schulz R. Peroxynitrite is a major contributor to cytokine-induced myocardial contractile failure. Circ Res 2000;87:241–7. 44 Hu A. Chronic beta-adrenergic receptor stimulation induces cardiac apoptosis and aggravates myocardial ischemia/reperfusion injury by provoking inducible nitric-oxide synthase-mediated nitrative stress. J Pharmacol Exp Ther 2006;318:469–75. 45 Levrand S, Vannay-Bouchiche C, Pesse B, Pacher P, Feihl F, Waeber B et al. Peroxynitrite is a major trigger of cardiomyocyte apoptosis in vitro and in vivo. Free Radic Biol Med 2006;41:886– 95. 46 Holubarsch C, Goulette RP, Litten RZ, Martin BJ, Mulieri LA, Alpert NR. The economy of isometric force development, myosin isoenzyme pattern and myofibrillar ATPase activity in normal and hypothyroid rat myocardium. Circ Res 1985;56:78–86. 47 Sugiura S, Kobayakawa N, Fujita H, Yamashita H, Momomura SI, Chaen S et al. Comparison of unitary displacements and forces between 2 cardiac myosin isoforms by the optical trap technique : molecular basis for cardiac adaptation. Circ Res 1998;82:1029–34. 48 Izumo S, Lompre AM, Matsuoka R, Koren G, Schwartz K, NadalGinard B et al. Myosin heavy chain messenger RNA and protein isoform transitions during cardiac hypertrophy. Interaction between hemodynamic and thyroid hormone-induced signals. J Clin Invest 1987;79:970. 49 Matsuoka H, Nakata M, Kohno K, Koga Y, Nomura G, Toshima H et al. Chronic L-arginine administration attenuates cardiac hypertrophy in spontaneously hypertensive rats. Hypertension 1996;27: 14–8.
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
Doi: 10.1111/bcpt.12405
L-Arginine
Attenuates Cardiac Dysfunction, But Further Down-Regulates a-Myosin Heavy Chain Expression in Isoproterenol-Induced Cardiomyopathy
Eva Kralova1, Gabriel Doka1, Lenka Pivackova1, Jasna Srankova1, Kristina Kuracinova2, Pavol Janega2,3, Pavel Babal2, Jan Klimas1 and Peter Krenek1 Department of Pharmacology and Toxicology, Faculty of Pharmacy, Comenius University in Bratislava, Bratislava, Slovak Republic, 2Department of Pathology, Faculty of Medicine, Comenius University in Bratislava, Bratislava, Slovak Republic and 3Slovak Academy of Sciences, Institute of Normal and Pathological Anatomy, Bratislava, Slovak Republic
1
(Received 18 December 2014; Accepted 26 March 2015) Abstract: In view of previously reported increased capacity for nitric oxide production, we suggested that L-arginine (ARG), the nitric oxide synthase (NOS) substrate, supplementation would improve cardiac function in isoproterenol (ISO)-induced heart failure. Male Wistar rats were treated with ISO for 8 days (5 mg/kg/day, i.p.) or vehicle. ARG was given to control (ARG) and ISO-treated (ISO+ARG) rats in water (0.4 g/kg/day). ISO administration was associated with 40% mortality, ventricular hypertrophy, decreased heart rate, left ventricular dysfunction, fibrosis and ECG signs of ischaemia. RT-PCR showed increased mRNA levels of cardiac hypertrophy marker atrial natriuretic peptide, but not BNP, decreased expression of myosin heavy chain isoform MYH6 and unaltered expression of pathological MYH7. ISO increased the protein levels of endothelial nitric oxide synthase, but at the same time it markedly up-regulated mRNA and protein levels of gp91phox, a catalytical subunit of superoxide-producing NADPH oxidase. Fibrosis was markedly increased by ISO. ARG treatment moderately ameliorated left ventricular dysfunction, but was without effect on cardiac hypertrophy and fibrosis. Combination of ISO and ARG led to a decrease in cav-1 expression, a further increase in MYH7 expression and a down-regulation of MYH6 that inversely correlated with gp91phox mRNA levels. Although ARG, at least partially, improved ISO-impaired basal left ventricular systolic function, it failed to reduce cardiac hypertrophy, fibrosis, oxidative stress and mortality. The protection of contractile performance might be related to increased capacity for nitric oxide production and the up-regulation of MYH7 which may compensate for the marked down-regulation of the major MYH6 isoform.
L-arginine is the precursor of nitric oxide, a key regulatory molecule in the cardiovascular system. Decreased nitric oxide synthesis or bioavailability may result in endothelial dysfunction that is present in many cardiovascular diseases such as hypertension, atherosclerosis, erectile dysfunction, myocardial infarction (MI) and congestive heart failure [1]. Nitric oxide is synthesized by three isoforms of nitric oxide synthases, endothelial (eNOS), neuronal (nNOS) and inducible (iNOS), that can all be expressed in the heart [2]. Nitric oxide in the heart can regulate a number of functions such as heart rate, coronary flow, myocardial oxygen consumption, and contractility under both physiological and pathological conditions [2,3]. Nitric oxide has antihypertrophic properties for cardiac myocytes [4], can inhibit the development of cardiac fibrosis [5] and can induce angiogenesis [6], while nitric oxide deficiency can contribute to pathological cardiac remodelling [7]. However, under the conditions of oxidative stress, increased nitric oxide production may lead to cellular injury via toxic peroxynitrite formation [8]. L-arginine supplementation in human heart failure leads to an improvement of endothelium-dependent vasodilation and
Author for correspondence: Dr. Peter Krenek, Comenius University in Bratislava, Faculty of Pharmacy, Department of Pharmacology and Toxicology, Odbojárov 10, 83232 Bratislava, Slovak Republic (fax +421 2 50117 100, e-mail [email protected]).
improved exercise capacity and quality of life [9–11]. L-arginine as a substrate for nitric oxide synthases is able to improve endothelial function in spite of the fact that it is present in the plasma at much higher concentrations than the Km for nitric oxide synthase [12,13]. This ‘arginine paradox’ can be explained by the antagonism of endogenous NOS inhibitor, asymmetric dimethylarginine (ADMA), synthesized by hydrolysis of protein arginine residues methylated by protein arginine methyltransferases (Prmt). ADMA is increased in heart failure [14], and it can be hydrolysed by dimethylarginine dimethylaminohydrolases (Ddah) that were shown to be inhibited by oxidative stress [15], thus leading to higher ADMA levels and suppression of nitric oxide synthesis. In MI in the rat, ADMA levels were reported to be increased in the plasma and myocardial 7 days post-MI [16]. Isoproterenol (ISO)-induced cardiac hypertrophy and dysfunction bears similarities to MI [17], where the initial possible benefit of L-arginine administration [18] had been put into question in another clinical trial [19]. Although some authors reported decreased nitric oxide in ISO-induced heart failure, with a protective effect of L-arginine via polyamine pathways [20], we previously reported an increased nitric oxide synthesis capacity in ISO-induced heart failure while observing at the same time that the positive inotropic effect of nitric oxide was lost in the cardiac myocytes of ISO-treated rats [21]. We
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
EVA KRALOVA ET AL.
252
tested the hypothesis that improving L-arginine availability in ISO-induced cardiomyopathy would lead to positive haemodynamic and structural changes in the heart and favourably alter the markers of cardiac damage and myosin isoform shift. Materials and Methods Animals. We used male Wistar rats (18–20 weeks old) (n = 10–12 per group). Rats were kept under standard conditions and received food and water ad libitum. ISO (5 mg/kg) was administered for 8 days, once daily by intraperitoneal injection [21,22]. L-arginine (ARG) was administered for 8 days orally in drinking water (0.40 g/ kg/day) [23]. The animals in the third group received for 8 days the combination of ISO and L-arginine (ISO+ARG). Control animals (CON) received the vehicle of ISO (0.05% ascorbic acid in 0.9% NaCl, 0.5 ml intraperitoneally) and drinking water ad libitum. Separate groups of rats were used for ECG measurement, left ventricular catheterization and Western blot analyses. All studies were performed 24 hr after the last ISO administration. All procedures involving the use of experimental animals were approved by the State Veterinary and Food Administration of the Slovak Republic. The investigation conforms with the EU Directive 2010/63/EU for animal experiments and Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1985). Electrocardiography. To detect myocardial ischaemia, 12-lead electrocardiography was performed in rats anaesthetized with tribromoethanol (15 ml/kg of 2.5% solution per g of body-weight), which has good analgesic properties and has been demonstrated to have a less depressive influence on cardiac function than some other commonly used anaesthetic procedures [24]. Standard 12-leads ECG was recorded by electrocardiograph SEIVA EKG PRAKTIK VETERINARY 4v (SEIVA s.r.o., Czech Republic) using needle electrodes placed subcutaneously. Heart rate was evaluated as an ECG cycle length (RR duration). Duration of QT was determined from the onset of QRS complex to the end of T wave (i.e. in the crossing of the isoelectric line) in either of the simultaneously recorded leads. Six consecutive beats were evaluated, and the arithmetic means of RR, QRS and QT were obtained. Duration of QT was corrected according to rat cardiac cycle: QTc (in msec.) = QT/ (RR/150)1/2 [25]. In our experiments, the value of the normalization factor for rats was 150 msec. as it was the average cardiac cycle length. ST-segment depression was taken as a sign of ischaemic injury [21]. Left ventricular haemodynamics. To detect cardiac contractile abnormalities, left ventricular catheterization was performed in closedchest rats anaesthetized with tribromoethanol (15 ml of 2.5% solution per g of body-weight) placed on a 37°C table as we described previously [26]. Direct cannulation of the carotid artery was performed using custom-fashioned polyethylene tubing in anaesthetized rats. Polyethylene tubing (PE50, 0.58 mm ID 9 0.96 mm OD; Portex, Kent, UK) was inserted into the carotid artery, and pressure waveform was monitored, recorded and analysed after 10 min. of stabilization using SPEL Advanced Haemosys system (Experimetria Ltd., Budapest, Hungary). Data of systolic and diastolic blood pressure (sBP and dBP) were collected. Consecutively, values of pulse pressure (PP) and mean arterial pressure (MAP) were calculated. Pulse pressure was defined as PP = sBP dBP. MAP was defined as MAP = [(2 9 dBP) + sBP]/ 3. Heart rate, left ventricular pressure (LVP) and the first derivatives of left intraventricular pressure (rate of LVP development, +dP/dt and rate of LVP decline, dP/dt) were monitored continuously, recorded and analysed after 10 min. of stabilization. We also studied the effect
of b-adrenergic stimulation on the above parameters by injecting increasing doses of dobutamine into the left jugular vein as previously described [27]. Western blot analysis. For Western blot analysis, tissue samples from rats killed by CO2 asphyxiation were frozen in liquid nitrogen and stored at 20°C until further processing. Expressions of eNOS, iNOS, hsp90, caveolin-1 and caveolin-3 were determined by Western blot analysis with chemiluminescent detection (ECL Plus; GE Healthcare Europe GmbH, Freiburg, Germany) and compared with the expression of actin. In preliminary experiments, we verified that specific antieNOS, iNOS, hsp90, caveolin-1, caveolin-3, gp91phox, manganese superoxide dismutase (MnSOD) (BD Pharmingen, Franklin Lakes, NJ, USA) and anti-actin (Sigma-Aldrich, St.Louis, Missouri, USA) antibodies detected a single band of expected molecular weight in positive controls or ventricular homogenates and that the expression of actin was not changed by ISO administration. As a positive control for iNOS, we used homogenates from lungs of rats exposed to bacterial lipopolysaccharide (LPS, 3 mg/kg; Sigma-Aldrich) for 4 hr to increase the expression of iNOS. Quantification was performed as described previously [22]. RNA isolation and RT-qPCR. Left ventricle samples were snap-frozen in liquid nitrogen immediately after dissection and stored at 80°C until further processing. Total RNA was isolated by phenol/ chloroform/guanidinium thiocyanate extraction (TRI Reagentâ; SigmaAldrich) according to the manufacturer’s protocol. The quality of isolated RNA was controlled by electrophoresis in 2% agarose gel. Concentration of isolated total RNA was quantified by NanoDrop ND1000 Spectrophotometer. Reverse transcription (High Capacity cDNA Reverse Transcription Kitâ; Life Technologies, Bratislava, Slovakia) was performed on intact RNA samples, according to electrophoresis and A260/A280 ratios, using 2 lg RNA per reaction. Real-time qPCR (ABI Prism 7300; Applied Biosystems, Foster City, California, USA) analysis was performed using Maximaâ SYBR Green/ROX qPCR Master Mix Kit (Thermo Scientific Waltham, Massachusetts, USA). The sequences of primers used for target detection are shown in table 1. Relative expressions of the genes of interest were evaluated from quantification cycles by delta–delta method with multiple reference genes (ACTB, B2M). Histological analysis. The hearts were fixed 24 hr in 10% formalin, the apical half of the ventricles was routinely processed in paraffin, and 5-lm-thick slices were stained with haematoxylin and eosin. The slides were evaluated in a Nikon light microscope ECLIPSE 80i (Nikon Corporation, Tokyo, Japan). Deparaffinized and rehydrated 5lm-thick slices were stained with a modified technique with picrosirius red as follows: the slides were submerged in 0.2% phosphomolybden acid for clearing the cytoplasm, and then, the slides were stained with 0.1% sirius red F3BA in a saturated water solution of picric acid for 90 min. The slides were washed 2 min. in 0.01 N HCl, dehydrated and mounted. Four fields covering the whole slice surface were documented at 259 magnification with a digital camera (Imaging Source, Bremen, Germany) and evaluated with ImageJ software (National Institute of Health, Bethesda, MD, USA). Threshold values were determined for the particular colours of spectrum, the numbers of pixels of each colour were counted, and the percentage of the picture’s area was calculated. Statistical analysis. Results are expressed as average standard error of the mean. Means were compared using ANOVA with subsequent Tukey’s HSD multiple comparison test for normally distributed data or Kruskal–Wallis test followed by pairwise Wilcoxon test with Holm–Bonferroni correction for nonparametric data. Correlation was
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
L-Arginine
in Isoproterenol-Induced Cardiomyopathy
253
Table 1. Primer sequences for quantitative RT-PCR. Gene
GenBank accession number
Primer sequence (50 –30 )
PCR product length (bp)
Actb
NM_031144.2
81
B2M
NM_012512.1
Cybb
NM_023965.1
Ddah2
NM_031605.2
Myh6
NM_017239.2
Myh7
NM_017240.1
Myh7b
NM_001107794.2
Forward: CCGCGAGTACAACCTTCTTG Reverse: GCAGCGATATCGTCATCCA Forward: ATGGAGCTCTGAATCATCTGG Reverse: AGAAGATGGTGTGCTCATTGC Forward: TGGGAGACTGGACTGAGGGGCTA Reverse: GGCTGTACCAAAGGGCCCATCAA Forward: AGGCCTGAGGTTGATGGAGT Reverse: GTCCAGCGTAGCGTTCTCAT Forward: GCCCTTTGACATCCGCACAGAGT Reverse: TCTGCTGCATCACCTGGTCCTCC Forward: GCGGACATTGCCGAGTCCCAG Reverse: GCTCCAGGTCTCAGGGCTTCACA Forward: CCCGATTCTCAACACCAACACCTCT Reverse: CATCAGGCACCCAGACCCGT Forward: GGGGGTAGGATTGACAGGAT Reverse: GGATCTTTTGCGATCTGCTC Forward: GACCGGATCGGCGCAGTCAGT Reverse: GGAGTCTGCAGCCAGGAGGTCT Forward: GGGGCCCGCAAGGTCATTGG Reverse: CCACAGGCAGCTCCACCTCC
Nppa
NM_012612.2
Nppb
NM_031545.1
Prmt1
NM_024363.1
105 110 87 152 133 150 104 78 133
Actb, actin; B2M, b2-microglobulin; Cybb, gp91phox; Ddah2, dimethylarginine dimethylaminohydrolase 2; Myh6, myosin heavy chain 6 (a-myosin heavy chain); Myh7, myosin heavy chain 7 (b-myosin heavy chain); Myh7b, myosin heavy chain 7b; Nppa, atrial natriuretic peptide; Nppb, brain natriuretic peptide; Prmt1, protein arginine methyltransferase 1.
Table 2. Gravimetric characteristics of experimental groups.
Body-weight (g) Ventricular weight (mg) VW/BW (mg/g)
CON
ISO
ARG
ARG+ISO
361 8 950 39 2.63 0.08
351 5 1263 24* 3.60 0.03*
356 6 912 36 2.56 0.10
351 10 1201 64*,** 3.41 0.10*,**
CON, controls; ARG, L-arginine-treated group; ISO, isoproterenol-treated group. Data are mean S.E.M. (n = 7–10 per group; *p < 0.05 versus CON, **p < 0.05 versus ARG). performed using Pearson correlation coefficient. All results were computed in GraphPad Prism 4.0 (GraphPad Software, Inc., San Diego, California, USA) or in R environment (version 2.15.1; R Foundation for Statistical Computing, Vienna, Austria).
Results Mortality and gravimetric data. Isoproterenol treatment was associated with a mortality rate of about 40% that was not ameliorated by L-arginine (fig. 1). Ventricular weight and VW/BW ratio were significantly greater in ISO rats than in control rats (p < 0.05 versus CON, table 2). L-arginine alone had no effect on heart weight, and it did not influence the increase of ventricular weight after ISO administration. Body-weight was not altered by ISO or ARG or their combinations. Electrocardiography. QT and QTc duration were significantly prolonged in the ISO and ISO+ARG groups. The duration of QRS was without changes in all medicated groups (table 3). ECG showed signs of myocardial ischaemia – depression of ST segment (negative
T wave) in the ISO groups irrespective of L-arginine treatment (table 3). Haemodynamic data. Arterial systolic and dBPs were decreased by ISO, and this decrease was not influenced by ARG. L-arginine alone had no effect on arterial blood pressure (table 3). Compared to the control group, systolic pressure in left ventricle (sLVP) was lower in the ISO group, indicating left ventricular dysfunction (p < 0.05 versus CON, table 3). When L-arginine was added to ISO treatment, sLVP was not different from the controls. ARG alone tended to increase sLVP without achieving statistical significance (table 3). Heart rate was lower in the ISO group than in the control group, confirming our previous study [21]. ARG did not influence the decreased heart rate (table 3). Under basal conditions, the rate of LVP development (+dp/dt) and the rate of LVP decline (dp/dt) were markedly lower after ISO administration (p < 0.05 versus CON, table 3). Larginine was able to restore +dp/dt and dp/dt to levels not significantly different from the control (table 3). Under badrenergic stimulation with increasing doses of dobutamine,
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
EVA KRALOVA ET AL.
254
tended to be decreased after the administration of ISO alone and was significantly down-regulated in ISO+ARG. The expression of gp91phox, a subunit of superoxide-producing Nox2, was markedly increased after ISO treatment, and this remained unaffected in the ISO+ARG group (table 4). The expression of MnSOD was not altered by any treatment (table 4).
Fig. 1. L-arginine does not prevent mortality induced by ISO. Kaplan– Meier survival curves demonstrated that the prevalence of death was significantly higher in the rats treated with ISO (p < 0.0001 by logrank test) and that L-arginine had no significant influence on this increased mortality. ISO, isoproterenol; ARG, L-arginine.
LVP and heart rate were lower in the ISO and ISO+ARG groups compared to controls (fig. 2). The indicator of left ventricular contractility (+dP/dt) was markedly reduced in the ISO group, while in the ISO+ARG group the contractile function was improved. The indicator of ventricular relaxation (dP/dt) showed a mild improvement only at the lowest dose of dobutamine used. Protein levels of nitric oxide signalling proteins and proteins involved in the regulation of oxidative stress. Confirming our previous data [21], we noted an increased eNOS expression after ISO treatment, and eNOS was also increased by ARG alone and in combination with ISO (fig. 3, table 4). We did not detect nNOS in left ventricular samples, which is consistent with previous data [21]. The expressions of iNOS, hsp90 and MnSOD were unaltered by ISO or ARG. The expression of the allosteric modulator of NOS, caveolin-1,
Messenger RNA levels of foetal genes and myosin isoforms. Real-time PCR analysis showed that the expression of atrial natriuretic peptide (ANP) was increased 15 times in the left ventricle of ISO-treated rats, with no effect of L-arginine (p < 0.05, fig. 4). Interestingly, brain natriuretic peptide expression was not altered by ISO, ARG or their combination (fig. 4). The level of the physiological Myh6 (a-myosin heavy chain) was down-regulated by ISO (39%, p < 0.05 versus Control, fig. 3) and unaltered by ARG alone, and it was further down-regulated when ISO treatment was combined with L-arginine administration (59%, p < 0.05 versus CON, p < 0.05 versus ISO, p < 0.05 versus ARG, fig. 4). Pathological Myh7 (b-myosin heavy chain) only tended to be increased after the administration of ISO alone (+40%, NS), but it was significantly up-regulated in the combined group ISO+ARG (+55%, p < 0.05 versus ARG). The expression of a quantitatively minor isoform of myosin heavy chain, Myh7b, was decreased by ISO alone (56%, p < 0.05 versus CON) and in the combined ISO+ARG group (45% versus ARG, p < 0.05), having a similar pattern of expression change like Myh6. The ratio of Myh6 versus all myosins was lower in the ISO group compared to control (p < 0.05), and it was further depressed in ISO+ARG group (p < 0.05 versus CON, p < 0.05 versus ISO, p < 0.05 versus ARG, fig. 4). Interestingly, Myh6 expression levels correlated inversely with gp91phox at the mRNA level in the ISO+ARG group (R2 = 0.7327, p = 0.0016), but not in others.
Table 3. Basic haemodynamic and electrocardiographic parameters. Control (CON) Arterial haemodynamics Systolic blood pressure (mmHg) Diastolic blood pressure (mmHg) Pulse pressure (mmHg) Mean arterial pressure (mmHg) Left ventricular haemodynamics Left ventricular pressure (mmHg) +dP/dt (mmHg/s) dP/dt (mmHg/s) Heart rate (bpm) Electrocardiography RR duration (ms) QT duration (ms) QTc duration (ms) QRS duration (ms) Occurrence of ST depression (N/n)
116 84 32 95
3 4 2 3
133 4839 3886 392
3 436 268 9
162 71 69 21 0/7
4 2 2 1
Isoproterenol (ISO) 107 75 32 85
4* 6 6 4*
121 3461 2638 354
4* 359* 140* 11*
187 5* 95 3* 85 3* 21 1 9/10*
L-arginine
(ARG)
120 85 35 103
3 5 5 6
142 5063 4177 400
5 331 239 16
160 74 72 21 0/7
6 2 3 1
Data are mean S.E.M. (n = 7–10 per group; *p < 0.05 versus CON, **p < 0.05 versus ARG, ***p < 0.05 versus ISO).
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
ARG+ISO 105 74 31 84
4*,** 5 2 4*,**
129 4351 3443 349
4 719 272*** 10*,**
184 7*,** 91 2*,** 82 2*,** 21 1 8/8*,**
L-Arginine
in Isoproterenol-Induced Cardiomyopathy
255
Fig. 2. L-arginine moderately improves ISO-induced impairment of the left ventricular function. Left ventricular haemodynamics. Responses of the left ventricular pressure (LVP), the heart rate (HR), the maximum rate of LVP development (+dP/dt) and the maximum rate of LVP decline (dP/ dt) to increased doses of dobutamine are shown. Data are presented as mean standard error of the mean; n = 6–8 per group; *p < 0.05 versus CON; #p < 0.05 versus ARG; †p < 0.05 versus ISO. ISO, isoproterenol; ARG, L-arginine; CON, control.
A
B
C
Fig. 3. L-arginine did not modify ISO-related alterations of nitric oxide signalling proteins. Representative Western blot autoluminograms. (A) proteins related to nitric oxide signalling pathways (eNOS, iNOS, hsp90, cav-1, cav-3); (B) proteins related to oxidative stress (gp91phox, MnSOD); (C) cytoskeletal proteins (a-actinin and b-actin). ISO, isoproterenol; ARG, L-arginine.
Messenger RNA levels of protein arginine methyltransferase 1 (Prmt1) and dimethylaminoarginine hydrolase 2 (Ddah2). In the ISO and ISO+ARG groups, we observed a decreased expression of Prmt1 that is involved in the methylation of protein arginine residues and can be implicated in the synthesis of endogenous NOS inhibitor, ADMA, after the administration of ISO alone (24%, p < 0.07 versus CON) and ISO+ARG (30%, p < 0.05 versus ARG) (fig. 5). We also
observed a trend towards an increased expression of ADMAdegrading enzyme Ddah2 in the ISO group (+38%, p = 0.075) and a significant increase in the ISO+ARG group (+63%, p < 0.05 versus CON, ARG) (fig. 5). Histological analysis. Routine evaluation of haematoxylin-and-eosin-stained histology slides showed large areas of fibrosis in different stages of
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
EVA KRALOVA ET AL.
256
Table 4. Level of protein expression in left ventricular tissue determined by Western blot. CON
ISO
Nitric oxide signalling proteins eNOS 100 6 130 iNOS 100 7 108 hsp90 100 4 109 cav-1 100 7 74 cav-3 100 5 90 ROS-regulating enzymes gp91phox 100 7 346 MnSOD 100 7 94 Cytoskeletal proteins Actinin 100 7 94 b-actin 100 6 93
9* 14 9 8 5
ARG 138 110 101 82 92
12* 11 7 10 7
ARG+ISO 156 111 114 69 88
12* 14 11 9* 4
42* 8
107 14 102 7
379 44* 88 7
4 5
96 5 108 5
90 5 102 9
eNOS and iNOS, endothelial and inducible nitric oxide synthase; hsp90, heat-shock protein 90; cav-1 and cav-3, caveolin 1 and 3; gp91phox, haeme-binding subunit of NADPH oxidase; MnSOD, manganese superoxide dismutase; CON, control, ISO, isoproterenol; ARG, L-arginine. Data are mean S.E.M. (n = 10–13 per group; per cent of Control; *p < 0.05 versus CON).
maturation in the myocardium of heart ventricles with maximum in the subendocardial region. The picrosirius red detected only mature fibrous tissue by red colour staining in myocardial muscle. There was a significant increase of myocardial fibrosis after the induction of ischaemic damage by ISO administration. This increase was not affected by L-arginine administration (fig. 6). Discussion In the context of previously reported increased capacity for nitric oxide production [21], we tested the hypothesis that Larginine supplementation would improve left ventricular structure and function in ISO-induced cardiomyopathy. As expected, ISO administration induced cardiac hypertrophy and fibrosis. Surprisingly, L-arginine had no effect on the hypertrophic response to ISO, in spite of reports that nitric oxide in vitro [4] and eNOS up-regulation in cardiac myocytes in vivo [28] can attenuate cardiac hypertrophy induced by catecholamines. Bartunek et al. [23] reported that chronic Larginine treatment, at the same dose as used in our study, had no effect on left ventricular mass in rats with aortic stenosis, although it did increase cardiac cGMP levels and tended to increase cardiac constitutive nitric oxide synthase levels [23]. We observed that eNOS was up-regulated in the ISO+ARG group, which would further favour an antihypertrophic effect of the nitric oxide synthase substrate. The failure of L-arginine to decrease cardiac mass in our experiment could be due to decreased nitric oxide bioavailability, as discussed below, or the intensity of the hypertrophic stimulus, intermittent administration of ISO being more effective than constant infusion in inducing cardiac damage [29]. Alternatively, increased arginine degradation by arginases could limit the action of supplemented L-arginine. Arginase I is induced after MI in human
beings [30], and ISO administration to rats was found to bear similarities to MI [17]. There are reports that in heart failure and MI, the levels of the endogenous NOS inhibitor ADMA are increased [14]. We determined the expression of Prmt1 that is involved in the methylation of protein arginine residues and thus implicated in several processes, including ADMA production, but also other important signalling functions related to protein arginine methylation, such as regulation of gene expression [31]. Interestingly, we observed a decreased expression of Prmt1 in the ISO and ISO+ARG groups, so likely less ADMA production, and we observed increased expression of Ddah2 in the ISO+ARG group, which would favour increased ADMA degradation and consequently more nitric oxide synthesis. However, Ddah were shown to be inhibited by oxidative stress [15], so it is possible that ADMA degradation could be hampered in the ISO and ISO+ARG groups, where gp91phox expression was markedly increased. The decreased expression of Prmt1 could have other consequences, as methyl donor deficiency induces hypertrophic cardiomyopathy via decreased protein methylation by Prmt1 and acetylation by SIRT1 [32]. Isoproterenol treatment induced cardiac fibrosis, and L-arginine did not influence it. Several studies have shown decreased fibroblast proliferation and collagen synthesis after exposure to nitric oxide or natriuretic peptides that stimulate the formation of cGMP [5,33,34]. Arginine supplementation failed to reduce cardiac hypertrophy [35,36], fibrosis and left ventricular dysfunction in SHR rats [35], although conflicting results have also been reported [37]. L-arginine treatment attenuated the development of post-infarction fibrosis [38], and in one study, it reduced cardiac fibrosis also in ISOinduced heart failure [20]. The differences may be explained by different modes of arginine administration and dosage, as well as different duration of treatment. Isoproterenol increased the cardiac capacity for nitric oxide production that we expected to be further increased by ARG, which could, in theory, improve endothelial function. However, our previous data showed no change of endothelial function after ISO treatment in the aorta, where an up-regulation of eNOS was accompanied by increased cav-1 that could bind eNOS in an inhibitory complex [22]. In the left ventricle, we observed a decreased cav-1 expression in the left ventricle together with increased eNOS, which should improve nitric oxide production in the tissue. We previously reported that ISO treatment with an identical protocol leads to a loss of inhibitory effect of L-NAME on the fractional shortening in isolated cardiac myocytes [21]. The positive, albeit moderate, L-arginine effect on haemodynamics could thus be due to increased nitric oxide synthesis in the heart, although the finding of increased NADPH oxidase puts this in question, as it may lead to decreased availability of nitric oxide and the formation of peroxynitrite. We observed a marked ST-segment depression and a negative T wave after ISO treatment that indicates myocardial ischaemia [39]. L-arginine did not influence these changes; it is thus likely that it did not improve myocardial perfusion and it did not decrease myocardial oxygen consumption in vivo.
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
L-Arginine
ANP
20
*
Fold control
10 5 0
CON
ISO
Fold control
*
0.0
ISO
ISO
MYH7
CON
*# 0.5
ISO
ARG ISO+ARG
MYH6/total MHC
*
80
*
#
0.5
100
1.0
ISOARG
1.0
ARG ISO+ARG
MYH7B
ARG
1.5
0.0 CON
CON
2.0
*#+
0.5
1.5
Fold control
0.5
ARG ISO+ARG
1.0
0.0
1.0
MYH6
B 1.5
BNP
1.5
Fold control
Fold control
15
257
2.0
*#
Ratio (%)
A
in Isoproterenol-Induced Cardiomyopathy
*#+
60 40 20 0
0.0 CON
ISO
CON
ARG ISO+ARG
ISO
ARG ISO+ARG
Fig. 4. L-arginine did not modify ISO-induced up-regulation of ANP, but further decreased physiological MYH6 and increased MYH7 in ISO-treated rats. Left ventricular mRNA levels of selected foetal genes in left ventricular tissue determined by RT-PCR. (A) cardiac hypertrophy and failure-related factors. ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; (B) cardiac muscle myosin heavy chain genes Myh6, Myh7 and Myh7b. Mean S.E.M. (n = 5–9 per group; *p < 0.05 versus CON; #p < 0.05 versus ARG; †p < 0.05 versus ISO). ANP and BNP, atrial and brain natriuretic peptide; MYH6, MYH7 and MYH7b, myosin heavy chain 6, 7 and 7b; ISO, isoproterenol; ARG, L-arginine; CON, control.
Prmt1
1.0
p = 0.056
*
0.5
0.0
Ddah2
2.0
Fold control
Fold control
1.5
*#
1.5 1.0 0.5 0.0
CON
ISO
ARG
ISOARG
CON
ISO
ARG ISOARG
Fig. 5. L-arginine did not appreciably modify ISO-induced decrease of Prmt1 and increased Ddah2 in ISO-treated rats. Left ventricular mRNA levels of protein arginine methyltransferase 1 (Prmt1) and dimethylarginine dimethylaminohydrolase (Ddah2) determined by RT-PCR. CON, control; ISO, isoproterenol. *p < 0.05 versus CON, p < 0.05 versus L-arginine.
The gp91phox subunit of Nox2 superoxide-producing NADPH oxidase was markedly up-regulated after ISO treatment, but no concomitant up-regulation of superoxide-scavenging MnSOD was observed. This has not been reported to
date, although oxidative stress via increased NADPH oxidase activity was previously described in ISO-induced cardiac damage [40]. Oxidative stress associated with Nox2 induction could lead to nitrosative stress when nitric oxide production is
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
EVA KRALOVA ET AL.
258 A
CON
ARG
ISO
ISO+ARG
B
14.00
*
% of section area
12.00
200 μm *#
10.00 8.00 6.00 4.00 2.00 0.00
CON
ISO
ARG
ISO+ARG
Fig. 6. L-arginine failed to improve isoproterenol (ISO)-induced fibrosis of the left ventricle. (A) myocardium of the left ventricle. ISO administration led to focal fibrosis (ISO) of the myocardium with maximum in the subendocardial region (arrow). The administration of L-arginine did not prevent the fibrosis development (ISO+ARG). Control heart (CON) and after L-arginine administration alone (ARG). Picrosirius red, objective mag. 259. (B) morphometric evaluation of myocardial fibrosis detected with picrosirius red staining. L-arginine (ARG) administration did not affect fibrous tissue content in myocardium when compared with control (CON); ISO administration significantly increased myocardial fibrosis that was not prevented by L-arginine administration (ISO+ARG). *p < 0.05 versus CON, #p < 0.05 versus ARG
increased after L-arginine administration. Increased nitric oxide, superoxide and, subsequently, peroxynitrite formation during reperfusion of the heart leads to protein nitration and cellular injury. Blocking the nitric oxide synthases and superoxide production can ameliorate post-ischaemic recovery of myocardial function and coronary perfusion [41], intracoronary infusion of L-arginine aggravates myocardial stunning in dogs while augmenting protein tyrosine nitration [42] and, finally, peroxynitrite produced by iNOS and NADPH oxidase activities contributes to cytokine-induced myocardial contractile failure [43]. Nitrosative stress was reported in ISO-infused mice [44]. Peroxynitrite is a major contributor to cardiomyocyte apoptosis [45]. Together with our data, this indicates that Larginine supplementation could be detrimental for the heart in states where production of superoxide is augmented, due to
the possibility of an increased risk of toxic peroxynitrite formation. Consistent with previous reports [21], ISO impaired left ventricular performance. ISO decreased the expression of amyosin heavy chain (Myh6), the predominant isoform in the adult rat heart. In L-arginine-supplemented, ISO-treated rats, the degree of dysfunction was not as severe as with ISO alone. However, at the same time, we paradoxically observed an augmentation of the foetal isoform b-myosin heavy chain (Myh7) and a further decreased contribution of the major Myh6 isoform to total myosin mRNAs. b-Myosin heavy chain was reported to have a slower kinetics of force development and relaxation and a better economy of ATP hydrolysis with respect to force generation, albeit in different models than ISO-induced cardiomyopathy [46,47]. The inverse correlation
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
L-Arginine
in Isoproterenol-Induced Cardiomyopathy
between Myh6 expression with gp91phox at mRNA level in the ISO+ARG group, but not in other groups, indicates that oxidative and/or nitrosative stress could suppress Myh6 expression. This could indicate a possibly new and important regulatory mechanism of Myh6 expression by oxidative stress that would be worth a further study. There are several limitations in our study that need to be taken into account. We only measured mRNA levels of Myh6 and Myh7. However, during the development of pathological cardiac hypertrophy, the dynamically changing mRNA and protein levels of the myosins were reported to be superimposed [48]. We did not measure whether the levels of nitric oxide in the heart were altered by L-arginine. Regarding ARG administration, increased tissue cGMP levels after the same dose of ARG and increased tissue nitrite content were reported [23,49]. We cannot exclude that L-arginine administration affected other pathways, such as the polyamine pathways, that were reported to be suppressed in the ISO model by ARG administration [20]; however, the protocol of the study had a different mode of ARG administration and dose used. Conclusions We conclude that an 8-day treatment of rats with ISO resulted in cardiac hypertrophy and left ventricular dysfunction accompanied by oxidative stress. While L-arginine treatment moderately improved ventricular haemodynamics, it did not influence electrocardiographic abnormalities and modulators of oxidative stress and it failed to reduce cardiac hypertrophy, fibrosis and the overall mortality induced by ISO. The protection of contractile performance could be associated with increased eNOS-derived nitric oxide production, and the unexpected and paradoxical up-regulation of the more ATP consumption-efficient b-myosin heavy chain Myh7, which might compensate for the further loss of a-myosin heavy chain Myh6 in ISO+ARG group, possibly due to oxidative stress. Our data do not support the hypothesis that the administration of L-arginine would be beneficial in cardiac conditions associated with neurohumoural activation and oxidative stress. Acknowledgements This study was supported by APVV-0887-11 Molecular aspects of drug-induced heart failure and ventricular arrhythmias from the Slovak Research and Development Agency, and the grants 1/0294/15 and 1/0564/13 from the Science Grant Agency (VEGA), Slovak Republic. We thank Ms. Simona Kolembusova for her excellent technical assistance. Conflict of interest None declared. References 1 Endemann DH. Endothelial dysfunction. J Am Soc Nephrol 2004;15:1983–92. 2 Massion PB. Nitric oxide and cardiac function: ten years after, and continuing. Circ Res 2003;93:388–98.
259
3 Duncker DJ, Bache RJ. Regulation of coronary blood flow during exercise. Physiol Rev 2008;88:1009–86. 4 Calderone A, Thaik CM, Takahashi N, Chang DL, Colucci WS. Nitric oxide, atrial natriuretic peptide, and cyclic GMP inhibit the growth-promoting effects of norepinephrine in cardiac myocytes and fibroblasts. J Clin Invest 1998;101:812. 5 Takizawa T, Gu M, Chobanian AV, Brecher P. Effect of nitric oxide on DNA replication induced by angiotensin II in rat cardiac fibroblasts. Hypertension 1997;30:1035–40. 6 Duda DG, Fukumura D, Jain RK. Role of eNOS in neovascularization: NO for endothelial progenitor cells. Trends Mol Med 2004;10:143–5. 7 Bartunek J, Weinberg EO, Tajima M, Rohrbach S, Katz SE, Douglas PS et al. Chronic NG-nitro-L-arginine methyl ester-induced hypertension: novel molecular adaptation to systolic load in absence of hypertrophy. Circulation 2000;101:423–9. 8 Pacher P, Beckman JS, Liaudet L. Nitric oxide and peroxynitrite in health and disease. Physiol Rev 2007;87:315–424. 9 Rector TS, Bank AJ, Mullen KA, Tschumperlin LK, Sih R, Pillai K et al. Randomized, double-b, placebo-controlled study of supplemental oral L-arginine in patients with heart failure. Circulation 1996;93:2135–41. 10 Hambrecht R, Hilbrich L, Erbs S, Gielen S, Fiehn E, Schoene N et al. Correction of endothelial dysfunction in chronic heart failure: additional effects of exercise training and oral L-arginine supplementation. J Am Coll Cardiol 2000;35:706–13. 11 Doutreleau S, Mettauer B, Piquard F, Rouyer O, Schaefer A, Lonsdorfer J et al. Chronic L-arginine supplementation enhances endurance exercise tolerance in heart failure patients. Int J Sports Med 2006;27:567–72. 12 B€oger RH, Bode-B€oger SM. The clinical pharmacology of L-arginine. Annu Rev Pharmacol Toxicol 2001;41:79–99. 13 Bredt DS, Snyder SH. Isolation of nitric oxide synthetase, a calmodulin-requiring enzyme. Proc Natl Acad Sci USA 1990;87:682–5. 14 Visser M, Paulus WJ, Vermeulen MAR, Richir MC, Davids M, Wisselink W et al. The role of asymmetric dimethylarginine and arginine in the failing heart and its vasculature. Eur J Heart Fail 2010;12:1274–81. 15 Sydow K, M€unzel T. ADMA and oxidative stress. Atheroscler Suppl 2003;4:41–51. 16 Gray GA, Patrizio M, Sherry L, Miller AA, Malaki M, Wallace AF et al. Immunolocalisation and activity of DDAH I and II in the heart and modification post-myocardial infarction. Acta Histochem 2010;112:413–23. 17 Heather LC, Catchpole AF, Stuckey DJ, Cole MA, Carr CA, Clarke K. Isoproterenol induces in vivo functional and metabolic abnormalities; similar to those found in the infarcted rat heart. Acta Physiol Pol 2009;12:31. 18 Bednarz B, Jaxa-Chamiec T, Maciejewski P, Szpajer M, Janik K, Gniot J et al. Efficacy and safety of oral L-arginine in acute myocardial infarction. Results of the multicenter, randomized, doubleblind, placebo-controlled ARAMI pilot trial. Kardiol Pol 2005;62:421–7. 19 Schulman SP, Becker LC, Kass DA, Champion HC, Terrin ML, Forman S et al. L-arginine therapy in acute myocardial infarction: the vascular interaction with age in myocardial infarction (VINTAGE MI) randomized clinical trial. JAMA 2006;295:58– 64. 20 Lin Y, Wang L-N, Xi Y-H, Li H-Z, Xiao F-G, Zhao Y-J et al. Larginine inhibits isoproterenol-induced cardiac hypertrophy through nitric oxide and polyamine pathways. Basic Clin Pharmacol Toxicol 2008;103:124–30. 21 Krenek P, Kmecova J, Kucerova D, Bajuszova Z, Musil P, Gazova A et al. Isoproterenol-induced heart failure in the rat is associated with nitric oxide-dependent functional alterations of cardiac function. Eur J Heart Fail 2009;11:140–6.
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
260
EVA KRALOVA ET AL.
22 Krenek P, Klimas J, Kroslakova M, Gazova A, Plandorova J, Kucerova D et al. Increased expression of endothelial nitric oxide synthase and caveolin-1 in the aorta of rats with isoproterenolinduced cardiac hypertrophy. Can J Physiol Pharmacol 2006;84:1245–50. 23 Bartunek J, Dempsey S, Weinberg EO, Ito N, Tajima M, Rohrbach S et al. Chronic L-arginine treatment increases cardiac cyclic guanosine 50 -monophosphate in rats with aortic stenosis: effects on left ventricular mass and beta-adrenergic contractile reserve. J Am Coll Cardiol 1998;32:528–35. 24 Roth DM, Swaney JS, Dalton ND, Gilpin EA, Ross J Jr. Impact of anesthesia on cardiac function during echocardiography in mice. Am J Physiol Heart Circ Physiol 2002;282:H2134–40. 25 Kmecova J, Klimas J. Heart rate correction of the QT duration in rats. Eur J Pharmacol 2010;641:187–92. 26 Kirchhefer U, Klimas J, Baba HA, Buchwalow IB, Fabritz L, Huls M et al. Triadin is a critical determinant of cellular Ca cycling and contractility in the heart. Am J Physiol Heart Circ Physiol 2007;293:H3165–74. 27 Jankyova S, Kmecova J, Cernecka H, Mesarosova L, Musil P, Brnoliakova Z et al. Glucose and blood pressure lowering effects of Pycnogenolâ are inefficient to prevent prolongation of QT interval in experimental diabetic cardiomyopathy. Pathol Res Pract 2012;208:452–7. 28 Massion PB. Cardiomyocyte-restricted overexpression of endothelial nitric oxide synthase (NOS3) attenuates -adrenergic stimulation and reinforces vagal inhibition of cardiac contraction. Circulation 2004;110:2666–72. 29 Ma X, Song Y, Chen C, Fu Y, Shen Q, Li Z et al. Distinct actions of intermittent and sustained b-adrenoceptor stimulation on cardiac remodeling. Sci China Life Sci 2011;54:493–501. 30 Harpster MH, Bandyopadhyay S, Thomas DP, Ivanov PS, Keele JA, Pineguina N et al. Earliest changes in the left ventricular transcriptome post-myocardial infarction. Mamm Genome 2006; 17:701–15. 31 Nicholson TB, Chen T, Richard S. The physiological and pathophysiological role of PRMT1-mediated protein arginine methylation. Pharmacol Res 2009;60:466–74. 32 Garcia MM, Gueant-Rodriguez R-M, Pooya S, Brachet P, Alberto J-M, Jeannesson E et al. Methyl donor deficiency induces cardiomyopathy through altered methylation/acetylation of PGC-1a by PRMT1 and SIRT1. J Pathol 2011;225:324–35. 33 Hou J, Kato H, Cohen RA, Chobanian AV, Brecher P. Angiotensin II-induced cardiac fibrosis in the rat is increased by chronic inhibition of nitric oxide synthase. J Clin Invest 1995;96:2469. 34 Li P, Wang D, Lucas J, Oparil S, Xing D, Cao X et al. Atrial natriuretic peptide inhibits transforming growth factor -induced smad signaling and myofibroblast transformation in mouse cardiac fibroblasts. Circ Res 2008;102:185–92. 35 Brooks WW, Conrad CH, Robinson KG, Colucci WS, Bing OHL. L-arginine fails to prevent ventricular remodeling and heart failure in the spontaneously hypertensive rat. Am J Hypertens 2009; 22:228–34.
36 Kristek F. Long-term administration of L-arginine did not influence blood pressure, heart rate, cardiac hypertrophy or arterial wall thickness of spontaneously hypertensive rats. Exp Physiol 1998;83:595–603. 37 Chang H, Wu CY, Hsu Y, Chen HI. Reduction of ventricular hypertrophy and fibrosis in spontaneously hypertensive rats by Larginine. Chin J Physiol 2005;48:15. 38 Xu X, Zhao W, Lao S, Wilson BS, Erikson JM, Zhang JQ. Effects of exercise and L-arginine on ventricular remodeling and oxidative stress. Med Sci Sports Exerc 2010;42:346–54. 39 Muller JE, Maroko PR, Braunwald E. Evaluation of precordial electrocardiographic mapping as a means of assessing changes in myocardial ischemic injury. Circulation 1975;52:16–27. 40 Zhang G-X, Ohmori K, Nagai Y, Fujisawa Y, Nishiyama A, Abe Y et al. Role of AT1 receptor in isoproterenol-induced cardiac hypertrophy and oxidative stress in mice. J Mol Cell Cardiol 2007;42:804–11. 41 Zweier J. Measurement of nitric oxide and peroxynitrite generation in the postischemic heart. Evidence for peroxynitrite-mediated reperfusion injury. J Biol Chem 1996;271:29223–30. 42 Mori E, Haramaki N, Ikeda H, Imaizumi T. Intra-coronary administration of L-arginine aggravates myocardial stunning through production of peroxynitrite in dogs. Cardiovasc Res 1998;40:113–23. 43 Ferdinandy P, Danial H, Ambrus I, Rothery RA, Schulz R. Peroxynitrite is a major contributor to cytokine-induced myocardial contractile failure. Circ Res 2000;87:241–7. 44 Hu A. Chronic beta-adrenergic receptor stimulation induces cardiac apoptosis and aggravates myocardial ischemia/reperfusion injury by provoking inducible nitric-oxide synthase-mediated nitrative stress. J Pharmacol Exp Ther 2006;318:469–75. 45 Levrand S, Vannay-Bouchiche C, Pesse B, Pacher P, Feihl F, Waeber B et al. Peroxynitrite is a major trigger of cardiomyocyte apoptosis in vitro and in vivo. Free Radic Biol Med 2006;41:886– 95. 46 Holubarsch C, Goulette RP, Litten RZ, Martin BJ, Mulieri LA, Alpert NR. The economy of isometric force development, myosin isoenzyme pattern and myofibrillar ATPase activity in normal and hypothyroid rat myocardium. Circ Res 1985;56:78–86. 47 Sugiura S, Kobayakawa N, Fujita H, Yamashita H, Momomura SI, Chaen S et al. Comparison of unitary displacements and forces between 2 cardiac myosin isoforms by the optical trap technique : molecular basis for cardiac adaptation. Circ Res 1998;82:1029–34. 48 Izumo S, Lompre AM, Matsuoka R, Koren G, Schwartz K, NadalGinard B et al. Myosin heavy chain messenger RNA and protein isoform transitions during cardiac hypertrophy. Interaction between hemodynamic and thyroid hormone-induced signals. J Clin Invest 1987;79:970. 49 Matsuoka H, Nakata M, Kohno K, Koga Y, Nomura G, Toshima H et al. Chronic L-arginine administration attenuates cardiac hypertrophy in spontaneously hypertensive rats. Hypertension 1996;27: 14–8.
© 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
