Mitochondrion 18 (2014) 18–26

Contents lists available at ScienceDirect

Mitochondrion journal homepage: www.elsevier.com/locate/mito

Leber's hereditary optic neuropathy caused by the homoplasmic ND1 m.3635GNA mutation in nine Han Chinese families Juanjuan Zhang a,b,1, Pingping Jiang a,1, Xiaofen Jin a, Xiaoling Liu b,c, Minglian Zhang d, Shipeng Xie d, Min Gao b,c, Sai Zhang b,c, Yan-Hong Sun e, Jinping Zhu b,c, Yanchun Ji a, Qi-Ping Wei e, Yi Tong b, Min-Xin Guan a,c,⁎ a

Institute of Genetics, Zhejiang University, Hangzhou, Zhejiang, China School of Ophthalmology and Optometry, Wenzhou Medical University, Wenzhou, Zhejiang, China Attardi Institute of Mitochondrial Biomedicine, Wenzhou Medical University, Wenzhou, Zhejiang, China d Department of Ophthalmology, Hebei Provincial Eye Hospital, Xingtai, Hebei, China e Department of Ophthalmology, Beijing University of Chinese Medicine and Pharmacology, Beijing, China b c

a r t i c l e

i n f o

Article history: Received 30 May 2014 Received in revised form 28 August 2014 Accepted 29 August 2014 Available online 4 September 2014 Keywords: Leber's hereditary optic neuropathy Mitochondria Mutation NADH:ubiquinone oxidoreductase Maternal inheritance

a b s t r a c t In this report, we investigated the molecular mechanism underlying Leber's hereditary optic neuropathy (LHON)-associated mitochondrial m.3635GNA (p.S110N, ND1) mutation. A mutational screening of ND1 gene in a cohort of 1070 Han Chinese subjects LHON identified the m.3635G>A mutation in nine Chinese families with suggestively maternally transmitted LHON. Thirty-eight (22 males/16 females) of 162 matrilineal relatives in these families exhibited the variable severity and age-at-onset of optic neuropathy. Molecular analysis of their mitochondrial genomes identified the homoplasmic m.3635GNA mutation and distinct sets of polymorphisms belonging to the Asian haplogroups G2a1, R11a, D4, R11a, M7b2, G1a, F1a1, B4, and N9a3, respectively. Using cybrids constructed by transferring mitochondria from lymphoblastoid cell lines derived from one Chinese family into mtDNA-less (ρ0) cells, we showed ~ 27% decrease in the activity of NADH:ubiquinone oxidoreductase (complex I) in mutant cybrids carrying the m.3635GNA mutation, compared with control cybrids. The respiratory deficiency caused by the m.3635GNA mutation results in decreased efficiency of mitochondrial ATP synthesis. These mitochondrial dysfunctions caused an increase in the production of reactive oxygen species in the mutant cybrids. The data provide the direct evidence for the m.3635GNA mutation leading to LHON. Our findings may provide new insights into the understanding of pathophysiology of LHON. © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

1. Introduction Leber's hereditary optic neuropathy (LHON) is a maternally inherited eye disease that generally affects children to young adults with the rapid, painless, bilateral loss of central vision (Brown and Wallace, 1994; Carelli et al., 2009; Newman and Wallace, 1990; Yu-Wai-Man et al., 2009). Maternal transmission of LHON suggested that mutations in mitochondrial DNA (mtDNA) are responsible for this disorder (Howell, 2003; Servidei, 2004; Wallace et al., 1988). The mtDNA is a 16,569-nucleotide pair, double-stranded, circular molecule that codes for 2 ribosomal RNAs (rRNA), 22 transfer RNAs (tRNA), and 13 polypeptides of the mitochondrial energy generating process, oxidative phosphorylation (OXPHOS) (Andrews et al., 1999). OXPHOS enzyme complexes consist of complex I (NADH:ubiquinone oxidoreductase), complex II (succinate:ubiquinone oxidoreductase), complex III (ubiquinol:ferrocytochrome c oxidoreductase), complex IV (ferrocytochrome c:oxygen oxidoreductase or ⁎ Corresponding authors at: Institute of Genetics, Zhejiang University, 866 Yuhangtang Road, Hangzhou, Zhejiang 310058, China. Tel.: +86 571 88206916; fax: +86 571 88206916. E-mail address: [email protected] (M.-X. Guan). 1 The first two authors have equally contributed to this work.

http://dx.doi.org/10.1016/j.mito.2014.08.008 1567-7249/© 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

cytochrome c oxidase), and complex V (ATP synthase). Three primary LHON-associated mtDNA mutations, m.3460GNA (p.A52T, ND1), m.11778GNA (p.R340H, ND4), and m.14484TNC (p.M64V, ND6), which can each cause LHON, alter genes encoding the subunits of complex I. These mutations account for approximately 90% of LHON pedigrees in some countries (Brown et al., 1995; Mackey et al., 1996; Mashima et al., 1998). However, these three primary mtDNA mutations are only responsible for 38.3% cases in a cohort of 903 Chinese Han subjects with LHON (Jia et al., 2006). Thus, it is anticipated that additional mutations causing LHON can be found in the mitochondrial genomes in the Chinese population. To further elucidate the pathophysiology of LHON in the Chinese population, we have initiated a systematic and extended mutational screening of mtDNA in a large cohort of subjects with LHON (Ji et al., 2014; Liang et al., 2014; Liu et al., 2011; Qu et al., 2006; Qu et al., 2009; Zhang et al., 2013; Zhou et al., 2012). In the previous investigations, we identified the LHON-associated m.11778GNA, m.14484TNC, m.3460GNA and m.3866TNC as well as m.12238TNC mutations (Ji et al., 2014; Liu et al., 2011; Qu et al., 2006; Qu et al., 2009; Zhang et al., 2013; Zhou et al., 2012). In the present study, a mutational screening of ND1 gene in a cohort of 1070 Han Chinese subjects with LHON

J. Zhang et al. / Mitochondrion 18 (2014) 18–26

identified the known m.3635GNA mutation in nine Chinese families with suggestively maternally transmitted LHON. Thirty-eight (22 males/16 females) of 162 matrilineal relatives in these families exhibited the variable severity and age-at-onset in optic neuropathy. Molecular analysis of their mitochondrial genomes showed the presence of homoplasmic m.3635GNA mutation in all matrilineal relatives of these families and distinct sets of polymorphisms belonging to 8 Eastern Asian haplogroups (Kong et al., 2006; Tanaka et al., 2004). To further investigate the pathogenic mechanism of the m.3635GNA mutation, cybrid cell lines were constructed by transferring mitochondria from lymphoblastoid cell lines derived from an affected matrilineal relative carrying the mtDNA mutation and from a control individual belonging to the same mtDNA haplogroup but lacking the mtDNA mutation, into human mtDNA-less (ρ0) cells (King and Attadi, 1996; King and Attardi, 1989). These cybrid cell lines were first examined for the presence and degree of the mtDNA mutation. These cell lines were then assessed for the effects of the mtDNA mutation on enzymatic activities of electron transport chain complexes, the rate of ATP production and the generation of reactive oxygen species (ROS). 2. Materials and methods 2.1. Patients and subjects We ascertained 9 Han Chinese families (Fig. 1) through the eye clinics of Wenzhou Medical University, Beijing University of Chinese Medicine and Pharmacology, and Hebei Provincial Eye Hospital, China. Informed consent, blood samples, and clinical evaluations were obtained from all participating family members, under protocols approved by the Zhejiang University Institute Review Board and the Wenzhou Medical University Ethics Committee. Members of these pedigrees were interviewed at length to identify both personal or family medical histories of visual impairments, and other clinical abnormalities. The 376 control DNA samples were obtained from a panel of unaffected Han Chinese individuals from the same area.

19

2.2. Ophthalmological examinations The ophthalmologic examinations of proband and other members of this family were conducted, including visual acuity, visual field examination (Humphrey Visual Field Analyzer IIi, SITA Standard), visual evoked potentials (VEP) (Roland Consult RETI port gamma, flash VEP), and fundus photography (Canon CR6-45NM fundus camera). The degree of visual impairment was defined according to the visual acuity as follows: normal N 0.3, mild = 0.3–0.1, moderate b 0.1–0.05, severe b0.05–0.02, and profound b 0.02. 2.3. Mutational analysis of the mitochondrial genome Genomic DNA was isolated from whole blood and cell lines of participants using the QIAamp DNA Mini Kit (Qiagen). For the detection of the m.3635GNA mutation, affected individuals' DNA fragments (302 bp) spanning these mtDNA mutation were PCR-amplified using genomic DNA as the template and mismatched oligodeoxynucleotides [forward: 5′-TTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAA CCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCGC-3′ (nt 3535–3632); reverse: 5′-GGCAGGAGTAATCAGAGGTGTT-3′ (nt 3813– 3836)] and subsequently digested with a restriction enzyme BmtI. The m.3635GNA mutation together with the mismatched PCR primers created the site for this restriction enzyme. Equal amounts of various digested samples were then analyzed by electrophoresis through 7% polyacrylamide gel. The proportions of digested and undigested PCR product were determined by the Image-Quant program after ethidium bromide staining to determine if the m.3635GNA mutation is present in the homoplasmy in these subjects. The entire mitochondrial genome of 9 probands was PCR amplified in 24 overlapping fragments using sets of the light (L) strand and the heavy (H) strand oligonucleotide primers as described previously (Rieder et al., 1998). Each fragment was purified and subsequently analyzed by direct sequencing in an ABI 3730XL automated DNA sequencer using the Big Dye Terminator Cycle sequencing reaction kit.

Fig. 1. Nine Chinese pedigrees with Leber's hereditary optic neuropathy. Vision impaired individuals are indicated by filled symbols. Arrow denotes the probands.

20

J. Zhang et al. / Mitochondrion 18 (2014) 18–26

These sequence results were compared with the updated consensus Cambridge sequence (GenBank accession number: NC_012920) (Andrews et al., 1999). 2.4. Phylogenetic analysis A total of 17 vertebrates of mitochondrial DNA sequences were used in the interspecific analysis. These include: Bos taurus, Cebus albifrons, Gorilla gorilla, Homo sapiens, Hylobates lar, Lemur catta, Macaca mulatta, Macaca sylvanus, Mus musculus, Nycticebus coucang, Pan paniscus, Pan troglodytes, Papio hamadryas, Pongo pygmaeus abelii, Pongo pygmaeus, Tarsius bancanus, and Xenopus laevis (GenBank) (Zhou et al., 2012). The conservation index (CI) was calculated by comparing the human mtDNA variants with the other 16 vertebrates. 2.5. Haplogroup analyses The entire mtDNA sequences of 9 Chinese probands carrying the m.3635GNA mutation were assigned to the Asian mitochondrial haplogroups by using the nomenclature of mitochondrial haplogroups (Kong et al., 2006; Tanaka et al., 2004). 2.6. Cell cultures Lymphoblastoid cell lines were immortalized by transformation with the Epstein–Barr virus, as described elsewhere (Miller and Lipman, 1973). Cell lines derived from one affected matrilineal relative of one Chinese family WZ513 (II-3) and from one genetically unrelated control individual belonging to the same mtDNA haplogroup (A40) were grown in DMEM, supplemented with 10% fetal bovine serum (FBS). The bromodeoxyuridine (BrdU)-resistant 143B.TK− cell line was grown in DMEM supplemented with 5% FBS. The mtDNA-less ρ0206 cell line, derived from 143B.TK− was grown under the same conditions as the parental line, except for the addition of 50 μg uridine/ml. All cybrid cell lines constructed with enucleated lymphoblastoid cell lines were maintained in the same medium as the 143B.TK − cell line. 2.7. Mitochondria mediated ρ0206 cell transformation Immortalized lymphoblastoid cell lines derived from one affected member of the Chinese family (WZ513-II-3) and one Chinese control individual (A40) belonging to the same mtDNA haplogroup were used for the generation of cybrid cell lines. Transformation by cytoplasts of mtDNA less ρ0 cells was performed as described elsewhere (King and Attadi, 1996; King and Attardi, 1989). The quantification of mtDNA copy numbers from different cybrids was performed by slot blot hybridization as detailed elsewhere (Guan et al., 1996). 2.8. Enzymatic assays The enzymatic activities were assayed following the modified protocol by Birch-Machin and Turnbull (Birch-Machin and Turnbull, 2001; Trounce et al., 1996). Citrate synthase activity was analyzed by the reduction of 5,5′-dithiobis-2-nitrobenzoic acid at 412 nm in the assay buffer containing 0.1 mM DTNB, 50 μM acetyl coenzyme A, and 250 μM oxaloacetate. Complex I activity was determined with 2 μg/ml by following the decrease in the absorbance due to the NADH oxidation at 340 nm in assay buffer. The activity of complex II was analyzed by tracking the secondary reduction of 2,6-dichlorophenolindophenol (DCPIP) by DB at 600 nm in the assay buffer. Complex III activity was determined in the presence of 2 μg/ml antimycin A by measuring the reduction of cytochrome c at 550 nm with reduced decylubiquinone in the assay buffer. Complex IV activity was measured in the addition of 2 mM of KCN by monitoring the oxidation of reduced cytochrome c as a decrease of absorbance at 550 nm. All assays were performed by

using Synergy H1 (Biotek, Winooski, VT, United States). Complex I–IV activities were normalized by citrate synthase activity. 2.9. ATP measurements The levels of ATP in cells were measured using the ATP Bioluminescence Assay kit HS II (Roche Applied Science) according to the manufacturer's instructions and other studies (Gong et al., 2014; Qian et al., 2011). In brief, samples of 2 × 106 cells were incubated for 2 h in the record solution (156 mM NaCl, 3 mM KCl, 2 mM MgSO4, 1.25 mM KH2PO4, 2 mM CaCl2, 20 mM HEPES, pH 7.35) with either 10 mM glucose, 10 mM glucose plus 2.5 μg/ml oligomycin (glycolytic ATP generation), or 5 mM 2-deoxy-D-glucose plus 5 mM pyruvate (oxidative ATP production). Cells were lysed and then incubated with the luciferin/ luciferase reagents. Samples were measured using a SpectraMAX GEMINI XS microplate luminometer (MDS, Inc., Brandon, FL). 2.10. ROS measurements ROS measurements were performed as detailed elsewhere (Mahfouz et al., 2009; Qian et al., 2011). Briefly, approximately 2 × 106 cells of each cell line were harvested, resuspended in PBS, supplemented with 100 μM of 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) and 2% FBS. After incubation at 37 °C for 20 min, cells were washed, resuspended in PBS in the presence of freshly prepared 2 mM H 2 O 2 and 2% FBS and then incubated at room temperature for another 5 min. Finally, cells were resuspended with 1 ml of PBS with 0.5% paraformaldehyde. Samples with or without H 2 O 2 stimulation were analyzed by the BD-LSR II flow cytometer system (Beckton Dickson, Inc.), with an excitation at 488 nm and emission at 529 nm. 10,000 events were analyzed in each sample. 2.11. Statistical analysis Statistical analysis was performed by the unpaired, two-tailed Student's t-test contained in Microsoft Office Excel (Version 2007). Correlation analysis was performed using the curve fitting routine in the GraphPad Prism package (GraphPad Software, Inc.). Differences were considered significant at a P b 0.05. 3. Results 3.1. Clinical and genetic evaluation of 9 Chinese pedigrees with LHON To further elucidate the molecular basis of LHON, we performed a mutational screening of the mitochondrial ND1 gene in a cohort of 1070 Han Chinese subjects, who were diagnosed as LHON by several eye clinics across China (Liang et al., 2014). As a result, the homoplasmic m.3635GNA mutation was identified in 9 subjects, translated into 0.84% cases of this cohort. As shown in Fig. 2 and Table 1, these probands exhibited a variable severity and age-at-onset of optic neuropathy. A comprehensive history and physical examination as well as ophthalmological examination were performed to identify both personal and family medical histories of visual impairments, and other clinical abnormalities in all available members of nine Han Chinese pedigrees. In fact, probands and other available members of these Chinese families showed no other clinical abnormalities, including diabetes, muscular diseases, hearing loss, and neurological disorders. As shown in Fig. 1 and Table 2, 38 (22 males/16 females) of 162 matrilineal relatives in these families exhibited the variable severity and age-at-onset in optic neuropathy. The average age-at-onset of optic neuropathy in these families ranged from 14 to 30 years, with an average of 20.2 years. The penetrance of optic neuropathy in these families varied from 7.7% to 42.9%, with an average of 21.4%. The ratios between affected male and female matrilineal relatives ranged from 1:0 to 2:0, with an average of 1.4:1.

J. Zhang et al. / Mitochondrion 18 (2014) 18–26

21

Fig. 2. Fundus photograph of nine affected subjects and two marry-in-control subjects. The figures were taken by the fundus photography (Cannon CR6-45NM fundus camera).

3.2. Mitochondrial DNA analysis To evaluate the role of mitochondrial haplotypes in the phenotypic manifestation of m.3635GNA mutation, we performed entire mtDNA sequence analysis in 9 probands. As shown in Fig. 3, the m.3635GNA mutation was found in all probands. The m.3635GNA mutation resulted in the replacement of the serine at position 110 with asparagine in the ND1. The serine at this position 110 in ND1 is localized at the highly conserved residue on the third trans-membrane domain of this polypeptide (Zhou et al., 2012). This mutation may alter the tertiary structure of this polypeptide, thereby affecting the function. Further analysis confirmed the presence of the homoplasmic m.3635GNA mutation in all

matrilineal relatives of but not other members of these families (data not shown). The allele frequency analysis showed that the m.3635GNA mutation was absent in 376 vision normal Chinese controls. As shown in Supplemental Table, these subjects exhibited distinct sets of mtDNA polymorphisms belonging to the Eastern Asian haplogroups G2a1, R11a, D4, R11a, M7b2, G1a, F1a1, B4, and N9a3, respectively (Kong et al., 2006; Tanaka et al., 2004). mtDNA variants among these probands ranged from 29 to 46, and their mtDNA shared 13 identical variants. These variants were 39 variants in the D-loop, four 12S rRNA variants, three 16S rRNA variants, the m.4343ANG (TQ) and m.4386TNC (TQ), m.5601CNT (TA) and m.15924ANG (TT) variants, 57 silent variants and 32 missense mutations in the protein encoding

22

J. Zhang et al. / Mitochondrion 18 (2014) 18–26

Table 1 Summary of clinical data for 9 probands carrying the m.3635GNA mutation. Proband

Gender

WZ513-III-14 WZ514-IV-8 WZ515-III-12 WZ516-III-13 WZ517-III-3 WZ518-IV-1 WZ519-III-10 WZ520-III-3 WZ521-III-6

M F M M M M M M M

Age of test (year)

16 15 38 44 14 20 42 15 20

Age of onset (year)

16 15 18 24 14 20 32 15 20

Vision acuity (worst) Right

Left

0.01 CF/20 cm 0.08 0.04 0.05 CF/20 cm 0.02 CF/20 cm 0.02

0.02 CF/10 cm 0.06 0.02 0.06 0.04 0.03 0.04 0.02

genes (Ruiz-Pesini et al., 2007). These variants in RNAs and polypeptides were further evaluated by phylogenetic analysis of these variants and sequences from the other 16 vertebrates and the presence of 376 Chinese controls. The variants ND4 p.P110L of WZ519 pedigree and ND4 p.P149L of WZ520 pedigree exhibited 100% of conservation index CIS of and the absence of 376 controls. However, the other 4 variants revealed N75% of CIs but the presence of controls, while CIs of the other variants were b70%, which was below the threshold level to be functional significantly in terms of mitochondrial physiology, as proposed previously (Ruiz-Pesini and Wallace, 2006). These suggest that the ND4 p.P110L and p.P149L variants but not the other variants may be functional significantly.

Level of vision impairment

Profound Profound Moderate Severe Moderate Profound Severe Profound Severe

Vision acuity (recovery)

Level of vision impairment

Right

Left

0.15 0.1 0.15 0.04 0.15 CF/20 cm 0.2 CF/20 cm 0.02

0.1 0.1 0.2 0.01 0.15 0.04 0.2 0.04 0.02

Mild Mild Mild Profound Mild Profound Mild Profound Severe

cybrids. Complex I (NADH ubiquinone oxidoreductase) activity was determined by following the oxidation of NADH with ubiquinone as the electron acceptor (Brown et al., 2001). Complex III (ubiquinone cytochrome c oxidoreductase) activity was measured as the reduction of cytochrome c (III) using D-ubiquinol-2 as the electron donor. The activity of complex IV (cytochrome c oxidase) was monitored by following the oxidation of cytochrome c (II). As shown in Fig. 4, the activity of complex I in three mutant cell lines was 72.9%, relative to the mean value measured in the control cell lines (P = 0.0003). However, the activities of complex II, III and IV in three mutant cell lines were comparable with those of three control cell lines. 3.5. Marked decreases in ATP generation

3.3. The construction of cybrid cell lines The lymphoblastoid cells derived from one affected subject (WZ513II-3) and one Chinese control individual (A40) were enucleated, and subsequently fused to a large excess of mtDNA-less human ρ0206 cells, derived from the 143B.TK− cell line (King and Attadi, 1996; King and Attardi, 1989). The cybrid clones were isolated by growing the fusion mixtures in selective DMEM medium, containing BrdU and lacking uridine. Between 25 and 45 days after fusion, 10–15 presumptive mitochondrial cybrids derived from each donor cell lines were isolated, and subsequently analyzed for the presence and level of the m.3635GNA mutation. The results confirmed the absence of the mtDNA mutation in the control clones and their presence in homoplasmy in all cybrids derived from the mutant cell line (data not shown). Three cybrids derived from each donor cell line with similar mtDNA copy numbers were used for the biochemical characterization described below. 3.4. Reduced activity of complex I To investigate the effect of the m.3635GNA mutation on the oxidative phosphorylation, we measured the activities of respiratory complexes by isolating mitochondria from three mutant cybrids and three control Table 2 Summary of clinical and molecular data for 9 Chinese families carrying the m.3635GNA mutation.

a

Pedigree

Number of matrilineal relatives

Penetrancea (%)

Average age-at-onset

Ratio of affected (males/females)

mtDNA haplogroup

WZ513 WZ514 WZ515 WZ516 WZ517 WZ518 WZ519 WZ520 WZ521

18 27 18 28 8 20 17 13 13

35.3 42.9 33.3 17.9 12.5 10.0 17.7 15.4 7.7

20 25 16 18 14 22 30 17 20

1:1 5:7 2:1 3:2 1:0 2:0 1:2 2:0 1:0

G2a1 R11a D4 R11a M7b2 F1a1 G1a B4 N9a3

Penetrance = affected matrilineal relatives/total matrilineal relatives.

The capacity of oxidative phosphorylation in mutant and wild type cells was examined by measuring the levels of cellular ATP using a luciferin/luciferase assay. Populations of cells were incubated in the media in the presence of glucose, glucose with oligomycin, and 2-deoxy-D-glucose with pyruvate (Gong et al., 2014; Qian et al., 2011). As shown in Fig. 5, the levels of ATP production in mutant cells in the presence of glucose (total cellular levels of ATP) or glucose with oligomycin to inhibit the ATP synthase (glycolysis) were comparable with those measured in the control cell lines. By contrast, the levels of ATP production in mutant cell lines, in the presence of pyruvate and 2-deoxy-D-glucose to inhibit the glycolysis (oxidative phosphorylation), ranged from 62.4% to 67.3%, with an average of 65.1%, relative to the mean value measured in the control cell lines (P = 0.0001). 3.6. ROS production increases The levels of the ROS generation in the vital cells derived from three mutant cybrids carrying the m.3635GNA mutation and three control cybrids were measured with flow cytometry under normal and H2O2 stimulation (Mahfouz et al., 2009; Qian et al., 2011). Geometric mean intensity was recorded to measure the rate of ROS of each sample. The ratio of geometric mean intensity between unstimulated and stimulated with H2O2 in each cell line was calculated to delineate the reaction upon an increase in the level of ROS under oxidative stress. As shown in Fig. 6, the levels of ROS generation in three mutant cybrids carrying the m.3635GNA mutation ranged from 107.4% to 120.4%, with an average of 115.8% (P = 0.0225) of the mean value measured in the control cell lines. 4. Discussion In the present study, we investigated the molecular pathogenesis of the LHON-associated m.3635GNA mutation. The prevalence of m.3635GNA mutation was 0.84% in a cohort of 1070 Chinese subjects with LHON. This mutation was only present at homoplasmy in the matrilineal relatives of these nine Chinese families but not in 376 Chinese controls. This mutation also occurred in some genetically unrelated

J. Zhang et al. / Mitochondrion 18 (2014) 18–26

23

Fig. 3. Identification of the m.3635GNA mutation. (A) Partial sequence chromatograms of ND1 gene from two probands (WZ513-III-14, WZ514-IV-8) and a control subject. An arrow indicates the location of the base changes at position 3635. (B). Quantification of the m.3635GNA mutation 9 probands and 4 control subjects. PCR products around the m.3635GNA mutation were digested with BmtI and analyzed by electrophoresis in a 7% polyacrylamide gel stained with ethidium bromide. The m.3635GNA mutation creates the site for restriction enzyme BmtI. Affected and control subjects are indicated.

families from Asian and Caucasian origins (Bi et al., 2012; Jia et al., 2010; Kodrol et al., 2014; Li et al., 2007; Yang et al., 2009). The occurrence of the m.3635GNA mutation in these genetically unrelated families affected by visual impairment further supports that this mutation is involved in the pathogenesis of optic neuropathy. As shown in Table 2, 38 (22 males/16 females) of 162 matrilineal relatives in these Chinese families exhibited visual impairment, while the average penetrances of LHON in other Chinese families carrying the m.3635GNA mutation were 30% (Jia et al., 2010; Yang et al., 2009). By contrast, the penetrances of

LHON in 13 Chinese pedigrees carrying the m.11778GNA mutation and 41 Chinese families carrying the m.14484TNC mutation were 23%, and 23.8%, respectively (Qian et al., 2005; Qu et al., 2010; Qu et al., 2009; Zhang et al., 2013). Furthermore, the average age at onset for visual impairment in these Chinese families carrying the m.3635GNA mutation ranged from 14 to 30 years, with an average of 20.2 years. Conversely, the average age at onset of visual impairment in the other 13 Chinese pedigrees, 66 and 49 Caucasian pedigrees carrying the m.11778GNA mutation was 17, 24, and 28 years, respectively (Harding et al., 1995;

Fig. 4. Enzymatic activities of respiratory chain complexes. The activities of respiratory complexes were investigated by enzymatic assay on complexes I, II, III, and IV in isolated mitochondrial membranes. The calculations were based on three independent determinations. The error bars indicate two standard errors of the mean (SEM). P indicates the significance, according to the Student's t-test, of the differences between the mean of three mutant cybrids and the mean of three control cybrids.

24

J. Zhang et al. / Mitochondrion 18 (2014) 18–26

Fig. 6. Ratio of geometric mean intensity between levels of the ROS generation in the vital cells with or without H2O2 stimulation. The rates of production in ROS from three mutant cell lines and three control cybrids were analyzed by BD-LSR II flow cytometer system with or without H2O2 stimulation. The relative ratio of intensity (stimulated versus unstimulated with H2O2) was calculated. The average of three determinations for each cell line is shown. Graph details and symbols are explained in the legend of Fig. 4.

Fig. 5. Measurement of cellular and mitochondrial ATP levels using bioluminescence assay. Cells were incubated with 10 mM glucose or 5 mM 2-deoxy-D-glucose plus 5 mM pyruvate to determine ATP generation under mitochondrial ATP synthesis. Average rates of ATP level per cell line are shown: (A) ATP level in total cells and (B) ATP level in mitochondria. Six to seven determinations were made for each cell line. Graph details and symbols are explained in the legend of Fig. 4.

Newman et al., 1991; Qian et al., 2005; Qu et al., 2010; Qu et al., 2009). In addition, the ratios between affected male and female matrilineal relatives were 1.4:1 in these Chinese families, whereas these ratios were in 3:1 in 11 Chinese families carrying the m.11778GNA mutation (Qu et al., 2010; Qu et al., 2009) and 2:1 in 41 Chinese families carrying the m.14484TNC mutation (Zhang et al., 2013) and were 4.5:1 and 3.7:1 in two large cohorts of Caucasian pedigrees carrying the m.11778GNA mutation, respectively (Harding et al., 1995; Newman et al., 1991). The phenotypic variability in these families carrying the identical m.3635GNA mutation strongly indicated the role of modifier factors including nuclear modifier genes in the phenotypic manifestation of the m.3635GNA mutation. In the present investigation, mtDNAs among these Chinese families belonged to the Eastern Asian haplogroups G2a1, R11a, D4, R11a, M7b2, G1a, F1a1, B4, and N9a3, respectively, while mtDNAs from other families carrying the m.3635GNA mutation resided on the haplogroups H2a, J2b1, F1a, R11a, B5b, G4g2, and M7b, respectively (Brown et al., 2001; Jia et al., 2010; Kodrol et al., 2014; Li et al., 2007; Yang et al., 2009). These data strongly suggested that the m.3635GNA mutation occurred sporadically and multiplied through the evolution

of mDNA, as in the case of the m.14484TNC mutation (Zhang et al., 2013). The m.3635GNA mutation is localized at the highly conserved isoleucine at position 110 on the third transmembrane domain of the ND1 polypeptide, which is the essential subunit of complex I. This mutation may alter the tertiary structure of this polypeptide, thereby affecting the function. In the present investigation, three cybrid cell lines carrying the m.3635GNA mutation revealed a significant mitochondrial dysfunction. In particular, these mutant cells showed ~27% decrease in the activity of complex I. These data are in good agreement with the observations that there were 30% to 40% reductions in NADH dehydrogenasedependent respiration in cell lines derived from families carrying the m.11778GNA and m.3866TNC mutations (Brown et al., 2000; Hofhaus et al., 1996; Zhou et al., 2012). These observations strongly indicate that the primary defect in the m.3635GNA mutation was a failure in the activity of NADH dehydrogenase, as in the case of m.11778GNA and m.3866TNC mutations (Brown et al., 2000; Hofhaus et al., 1996; Zhou et al., 2012). The respiratory deficiency caused by the m.3635GNA mutation results in the decreased efficiency of the mitochondrial ATP synthesis. In this study, the 35% drop in mitochondrial ATP production in cybrid carrying the m.3635GNA mutation was lower than those in cybrid cell lines carrying the m.3460GNA, m.3866TNC, m.11778GNA, and m.14484TNC mutations (Baracca et al., 2005; Beretta et al., 2004; Zhou et al., 2012). Moreover, reduced activity of complexes I can lead to more electron leakage from the electron transport chain, and in turn, increase the generation of ROS (Lenaz et al., 2004; Yen et al., 2006). Here, an increase of ROS production was detected in cell lines derived from affected matrilineal relatives carrying the m.3635GNA mutation. The production level of ROS in cells carrying the m.3635GNA mutation appeared to be much lower than those cell lines carrying the m.11778GNA mutation (Beretta et al., 2004; Porcelli et al., 2009). Remarkably, 2.5-fold more cellular hydroperoxide was detected in neuronal NT2 cells carrying the m.11778GNA mutation (Wong et al., 2002). This discrepancy is likely attributed to differentiation-specific effects (Wong et al., 2002). The overproduction of ROS can establish a vicious cycle of oxidative stress in the mitochondria, thereby damaging

J. Zhang et al. / Mitochondrion 18 (2014) 18–26

mitochondrial and cellular proteins, lipids and nuclear acids. Subsequently, the energy failure and increasing oxidative stress may cause the degeneration of the retinal ganglion cells, thereby causing a clinical phenotype (Guy et al., 2014; Wallace, 2007). In summary, our study provides the direct evidences for the m.3635GNA mutation leading to LHON. The prevalence of m.3635GNA mutation was 0.84% in a cohort of 1070 Chinese subjects with LHON. The m.3635GNA mutation should be added to the list of inherited factors for future molecular diagnosis of LHON. Thus, our findings may provide new insights into the understanding of pathophysiology and valuable information on the management and treatment of LHON. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.mito.2014.08.008. Acknowledgments This work was supported by the National Key Technologies R&D Program grant 2012BAI09B03 from the Ministry of Science and Technology of the People's Republic of China to MXG and PJ, grants 31471191, 81200724 and 81400434 from the Natural Science Foundation of China to MXG, JZ and YJ, respectively, and a grant (2013R10042) from the Ministry of Science and Technology of Zhejiang Province to PJ. References Andrews, R.M., Kubacka, I., Chinnery, P.F., Lightowlers, R.N., Turnbull, D.M., Howell, N., 1999. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat. Genet. 23, 147. Baracca, A., Solaini, G., Sgarbi, G., Lenaz, G., Baruzzi, A., Schapira, A.H., Martinuzzi, A., Carelli, V., 2005. Severe impairment of complex I-driven adenosine triphosphate synthesis in Leber hereditary optic neuropathy cybrids. Arch. Neurol. 62, 730–736. Beretta, S., Mattavelli, L., Sala, G., Tremolizzo, L., Schapira, A.H., Martinuzzi, A., Carelli, V., Ferrarese, C., 2004. Leber hereditary optic neuropathy mtDNA mutations disrupt glutamate transport in cybrid cell lines. Brain 127, 2183–2192. Bi, R., Zhang, A.M., Jia, X., Zhang, Q., Yao, Y.G., 2012. Complete mitochondrial DNA genome sequence variation of Chinese families with mutation m.3635GNA and Leber hereditary optic neuropathy. Mol. Vis. 18, 3087–3094. Birch-Machin, M.A., Turnbull, D.M., 2001. Assaying mitochondrial respiratory complex activity in mitochondria isolated from human cells and tissues. Methods Cell Biol. 65, 97–117. Brown, M.D., Wallace, D.C., 1994. Spectrum of mitochondrial DNA mutations in Leber's hereditary optic neuropathy. Clin. Neurosci. 2, 138–145. Brown, M.D., Torroni, A., Reckord, C.L., Wallace, D.C., 1995. Phylogenetic analysis of Leber's hereditary optic neuropathy mitochondrial DNA's indicates multiple independent occurrences of the common mutations. Hum. Mutat. 6, 311–325. Brown, M.D., Trounce, I.A., Jun, A.S., Allen, J.C., Wallace, D.C., 2000. Functional analysis of lymphoblast and cybrid mitochondria containing the 3460, 11778, or 14484 Leber's hereditary optic neuropathy mitochondrial DNA mutation. J. Biol. Chem. 275, 39831–39836. Brown, M.D., Zhadanov, S., Allen, J.C., Hosseini, S., Newman, N.J., Atamonov, V.V., Mikhailovskaya, I.E., Sukernik, R.I., Wallace, D.C., 2001. Novel mtDNA mutations and oxidative phosphorylation dysfunction in Russian LHON families. Hum. Genet. 109, 33–39. Carelli, V., La Morgia, C., Valentino, M.L., Barboni, P., Ross-Cisneros, F.N., Sadun, A.A., 2009. Retinal ganglion cell neurodegeneration in mitochondrial inherited disorders. Biochim. Biophys. Acta 1787, 518–528. Gong, S., Peng, Y., Wang, Z., Wang, M., Fan, M., Wang, X., Jiang, P., Li, H., Yan, Q., Huang, T., Guan, M.X., 2014. A deafness-associated tRNAHis mutation alters the mitochondrial function, ROS production and membrane potential. Nucleic Acids Res. 42, 8039–8048. Guan, M.X., Fischel-Ghodsian, N., Attardi, G., 1996. Biochemical evidence for nuclear gene involvement in phenotype of non-syndromic deafness associated with mitochondrial 12S rRNA mutation. Hum. Mol. Genet. 5, 963–971. Guy, J., Feuer, W.J., Porciatti, V., Schiffman, J., Abukhalil, F., Vandenbroucke, R., Rosa, P.R., Lam, B.L., 2014. Retinal ganglion cell dysfunction in asymptomatic G11778A: Leber hereditary optic neuropathy. Invest. Ophthalmol. Vis. Sci. 55, 841–848. Harding, A.E., Sweeney, M.G., Govan, G.G., Riordaneva, P., 1995. Pedigree analysis in Leber hereditary optic neuropathy families with a pathogenic mtDNA mutation. Am. J. Hum. Genet. 57, 77–86. Hofhaus, G., Johns, D.R., Hurko, O., Attardi, G., Chomyn, A., 1996. Respiration and growth defects in transmitochondrial cell lines carrying the 11778 mutation associated with Leber's hereditary optic neuropathy. J. Biol. Chem. 271, 13155–13161. Howell, N., 2003. LHON and other optic nerve atrophies: the mitochondrial connection. Dev. Ophthalmol. 37, 94–108. Ji, Y., Liang, M., Zhang, J., Zhang, M., Zhu, J., Meng, X., Zhang, S., Gao, M., Zhao, F., Wei, Q.P., Jiang, P., Tong, Y., Liu, X., Mo, J.Q., Guan, M.X., 2014. Mitochondrial haplotypes may modulate the phenotypic manifestation of the LHON-associated ND1 G3460A mutation in Chinese families. J. Hum. Genet. 59, 134–140.

25

Jia, X.Y., Li, S.Q., Xiao, X.S., Guo, X.M., Zhang, Q.J., 2006. Molecular epidemiology of mtDNA mutations in 903 Chinese families suspected with Leber hereditary optic neuropathy. J. Hum. Genet. 51, 851–856. Jia, X.Y., Li, S.Q., Wang, P.F., Guo, X.M., Zhang, Q.J., 2010. mtDNA m.3635GNA may be classified as a common primary mutation for Leber hereditary optic neuropathy in the Chinese population. Biochem. Biophys. Res. Commun. 403, 237–241. King, M.P., Attadi, G., 1996. Mitochondria-mediated transformation of human rho(0) cells. Methods Enzymol. 264, 313–334. King, M.P., Attardi, G., 1989. Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation. Science 246, 500–503. Kodrol, A., Krawczylski, M.R., Tolska, K., Bartnik, E., 2014. m.3635GNA mutation as a cause of Leber hereditary optic neuropathy. J. Clin. Pathol. 67, 639–641. Kong, Q.P., Bandelt, H.J., Sun, C., Yao, Y.G., Salas, A., Achilli, A., Wang, C.Y., Zhong, L., Zhu, C.L., Wu, S.F., Torroni, A., Zhang, Y.P., 2006. Updating the East Asian mtDNA phylogeny: a prerequisite for the identification of pathogenic mutations. Hum. Mol. Genet. 15, 2076–2086. Lenaz, G., Baracca, A., Carelli, V., D'Aurelio, M., Sgarbi, G., Solaini, G., 2004. Bioenergetics of mitochondrial diseases associated with mtDNA mutations. Biochim. Biophys. Acta 1658, 89–94. Li, Y., D'Aurelio, M., Deng, J.H., Park, J.S., Manfredi, G., Hu, P., Lu, J., Bai, Y., 2007. An assembled complex IV maintains the stability and activity of complex I in mammalian mitochondria. J. Biol. Chem. 282, 17557–17562. Liang, M., Jiang, P., Li, F., Zhang, J., Ji, Y., He, Y., Xu, M., Zhu, J., Meng, X., Zhao, F., Tong, Y., Liu, X., Sun, Y., Zhou, X., Mo, J.Q., Qu, J., Guan, M.X., 2014. Frequency and spectrum of mitochondrial ND6 mutations in 1218 Han Chinese subjects with Leber hereditary optic neuropathy. Invest. Ophthalmol. Vis. Sci. 55, 1321–1331. Liu, X.L., Zhou, X., Zhou, J., Zhao, F., Zhang, J., Li, C., Ji, Y., Zhang, Y., Wei, Q.P., Sun, Y.H., Yang, L., Lin, B., Yuan, Y., Li, Y., Qu, J., Guan, M.X., 2011. Leber's hereditary optic neuropathy is associated with the T12338C mutation in mitochondrial ND5 gene in six Han Chinese families. Ophthalmology 118, 978–985. Mackey, D.A., Oostra, R.J., Rosenberg, T., Nikoskelainen, E., Bronte-Stewart, J., Poulton, J., Harding, A.E., Govan, G., Bolhuis, P.A., Norby, S., 1996. Primary pathogenic mtDNA mutations in multigeneration pedigrees with Leber hereditary optic neuropathy. Am. J. Hum. Genet. 59, 481–485. Mahfouz, R., Sharma, R., Lackner, J., Aziz, N., Agarwal, A., 2009. Evaluation of chemiluminescence and flow cytometry as tools in assessing production of hydrogen peroxide and superoxide anion in human spermatozoa. Fertil. Steril. 92, 819–827. Mashima, Y., Yamada, K., Wakakura, M., Kigasawa, K., Kudoh, J., Shimizu, N., Oguchi, Y., 1998. Spectrum of pathogenic mitochondrial DNA mutations and clinical features in Japanese families with Leber's hereditary optic neuropathy. Curr. Eye Res. 17, 403–408. Miller, G., Lipman, M., 1973. Release of infectious Epstein–Barr virus by transformed marmoset leukocytes. Proc. Natl. Acad. Sci. U. S. A. 70, 190–194. Newman, N.J., Wallace, D.C., 1990. Mitochondria and Leber's hereditary optic neuropathy. Am J. Ophthalmol. 109, 726–730. Newman, N.J., Lott, M.T., Wallace, D.C., 1991. The clinical characteristics of pedigrees of Leber's hereditary optic neuropathy with the 11778 mutation. Am J. Ophthalmol. 111, 750–762. Porcelli, A.M., Angelin, A., Ghelli, A., Mariani, E., Martinuzzi, A., Carelli, V., Petronilli, V., Bernardi, P., Rugolo, M., 2009. Respiratory complex I dysfunction due to mitochondrial DNA mutations shifts the voltage threshold for opening of the permeability transition pore toward resting levels. J. Biol. Chem. 284, 2045–2052. Qian, Y., Zhou, X., Hu, Y., Tong, Y., Li, R., Lu, F., Yang, H., Mo, J.Q., Qu, J., Guan, M.X., 2005. Clinical evaluation and mitochondrial DNA sequence analysis in three Chinese families with Leber's hereditary optic neuropathy. Biochem. Biophys. Res. Commun. 332, 614–621. Qian, Y., Zhou, X., Liang, M., Qu, J., Guan, M.X., 2011. The altered activity of complex III may contribute to the high penetrance of Leber's optic neuropathy in a Chinese family carrying the ND4 G11778A mutation. Mitochondrion 11, 871–877. Qu, J., Li, R., Zhou, X., Tong, Y., Lu, F., Qian, Y., Hu, Y., Mo, J.Q., West, C.E., Guan, M.X., 2006. The novel A4435G mutation in the mitochondrial tRNAMet may modulate the phenotypic expression of the LHON-associated ND4 G11778A mutation. Invest. Ophthalmol. Vis. Sci. 47, 475–483. Qu, J., Zhou, X., Zhang, J., Zhao, F., Sun, Y.H., Tong, Y., Wei, Q.P., Cai, W., Yang, L., West, C.E., Guan, M.X., 2009. Extremely low penetrance of Leber's hereditary optic neuropathy in 8 Han Chinese families carrying the ND4 G11778A mutation. Ophthalmology 116, 558–564. Qu, J., Wang, Y., Tong, Y., Zhou, X., Zhao, F., Yang, L., Zhang, S., Zhang, J., West, C.E., Guan, M.X., 2010. Leber's hereditary optic neuropathy affects only female matrilineal relatives in two Chinese families. Invest. Ophthalmol. Vis. Sci. 51, 4906–4912. Rieder, M.J., Taylor, S.L., Tobe, V.O., Nickerson, D.A., 1998. Automating the identification of DNA variations using quality-based fluorescence re-sequencing: analysis of the human mitochondrial genome. Nucleic Acids Res. 26, 967–973. Ruiz-Pesini, E., Wallace, D.C., 2006. Evidence for adaptive selection acting on the tRNA and rRNA genes of human mitochondrial DNA. Hum. Mutat. 27, 1072–1081. Ruiz-Pesini, E., Lott, M.T., Procaccio, V., Poole, J.C., Brandon, M.C., Mishmar, D., Yi, C., Kreuziger, J., Baldi, P., Wallace, D.C., 2007. An enhanced MITOMAP with a global mtDNA mutational phylogeny. Nucleic Acids Res. 35, D823–D828. Servidei, S., 2004. Mitochondrial encephalomyopathies: gene mutation. Neuromuscul. Disord. 14, 107–116. Tanaka, M., Cabrera, V.M., Gonzalez, A.M., Larruga, J.M., Takeyasu, T., Fuku, N., Guo, L.J., Hirose, R., Fujita, Y., Kurata, M., Shinoda, K., Umetsu, K., Yamada, Y., Oshida, Y., Sato, Y., Hattori, N., Mizuno, Y., Arai, Y., Hirose, N., Ohta, S., Ogawa, O., Tanaka, Y., Kawamori, R., Shamoto-Nagai, M., Maruyama, W., Shimokata, H., Suzuki, R., Shimodaira, H., 2004. Mitochondrial genome variation in eastern Asia and the peopling of Japan. Genome Res. 14, 1832–1850.

26

J. Zhang et al. / Mitochondrion 18 (2014) 18–26

Trounce, I.A., Kim, Y.L., Jun, A.S., Wallace, D.C., 1996. Assessment of mitochondrial oxidative phosphorylation in patient muscle biopsies, lymphoblasts, and transmitochondrial cell lines. Methods Enzymol. 264, 484–509. Wallace, D.C., 2007. Why do we still have a maternally inherited mitochondrial DNA? Insights from evolutionary medicine. Annu. Rev. Biochem. 76, 781–821. Wallace, D.C., Singh, G., Lott, M.T., Hodge, J.A., Schurr, T.G., Lezza, A.M., Elsas 2nd, L.J., Nikoskelainen, E.K., 1988. Mitochondrial DNA mutation associated with Leber's hereditary optic neuropathy. Science 242, 1427–1430. Wong, A., Cavelier, L., Collins-Schramm, H.E., Seldin, M.F., McGrogan, M., Savontaus, M.L., Cortopassi, G.A., 2002. Differentiation-specific effects of LHON mutations introduced into neuronal NT2 cells. Hum. Mol. Genet. 11, 431–438. Yang, J.H., Zhu, Y.H., Tong, Y., Chen, L., Liu, L.J., Zhang, Z.Q., Wang, X.Y., Huang, D.G., Qiu, W.T., Zhuang, S.L., Ma, X., 2009. Confirmation of the mitochondrial ND1 gene mutation G3635A as a primary LHON mutation. Biochem. Biophys. Res. Commun. 386, 50–54.

Yen, M.Y., Wang, A.G., Wei, Y.H., 2006. Leber's hereditary optic neuropathy: a multifactorial disease. Prog. Retin. Eye Res. 25, 381–396. Yu-Wai-Man, P., Griffiths, P.G., Hudson, G., Chinnery, P.F., 2009. Inherited mitochondrial optic neuropathies. J. Med. Genet. 46, 145–158. Zhang, J., Zhao, F., Fu, Q., Liang, M., Tong, Y., Liu, X., Lin, B., Mi, H., Zhang, M., Wei, Q.P., Xue, L., Jiang, P., Zhou, X., Mo, J.Q., Huang, T., Qu, J., Guan, M.X., 2013. Mitochondrial haplotypes may modulate the phenotypic manifestation of the LHON-associated m.14484TNC (MTND6) mutation in Chinese families. Mitochondrion 13, 772–781. Zhou, X., Qian, Y., Zhang, J., Tong, Y., Jiang, P., Liang, M., Dai, X., Zhou, H., Zhao, F., Ji, Y., Mo, J.Q., Qu, J., Guan, M.X., 2012. Leber's hereditary optic neuropathy is associated with the T3866C mutation in mitochondrial ND1 gene in three Han Chinese Families. Invest. Ophthalmol. Vis. Sci. 53, 4586–4594.