The FASEB Journal article fj.14-256453. Published online July 30, 2014.

The FASEB Journal • Research Communication

LETM1-dependent mitochondrial Ca2ⴙ flux modulates cellular bioenergetics and proliferation Patrick J. Doonan,*,† Harish C. Chandramoorthy,*,† Nicholas E. Hoffman,*,† Xueqian Zhang,† César Cárdenas,储 Santhanam Shanmughapriya,*,† Sudarsan Rajan,*,† Sandhya Vallem,*,† Xiongwen Chen,‡,§ J. Kevin Foskett,¶ Joseph Y. Cheung,† Steven R. Houser,‡,§ and Muniswamy Madesh*,†,1 *Department of Biochemistry, †Center for Translational Medicine, ‡Cardiovascular Research Center, and §Department of Physiology, Temple University School of Medicine, Philadelphia, Pennsylvania, USA; 储Anatomy and Developmental Biology Program, Institute of Biomedical Sciences, University of Chile, Santiago, Chile; and ¶Department of Physiology, University of Pennsylvania, Philadelphia, Pennsylvania, USA ABSTRACT Dysregulation of mitochondrial Ca2ⴙ-dependent bioenergetics has been implicated in various pathophysiological settings, including neurodegeneration and myocardial infarction. Although mitochondrial Ca2ⴙ transport has been characterized, and several molecules, including LETM1, have been identified, the functional role of LETM1-mediated Ca2ⴙ transport remains unresolved. This study examines LETM1-mediated mitochondrial Ca2ⴙ transport and bioenergetics in multiple cell types, including fibroblasts derived from patients with Wolf-Hirschhorn syndrome (WHS). The results show that both mitochondrial Ca2ⴙ influx and efflux rates are impaired in LETM1 knockdown, and similar phenotypes were observed in ⌬EF hand, D676A D688K LETM1 mutant-overexpressed cells, and in cells derived from patients with WHS. Although LETM1 levels were lower in WHS-derived fibroblasts, the mitochondrial Ca2ⴙ uniporter components MCU, MCUR1, and MICU1 remain unaltered. In addition, the MCU mitoplast patch-clamp current (IMCU) was largely unaffected in LETM1-knockdown cells. Silencing of LETM1

Abbreviations: AMPK, 5=-adenosine monophosphate-activated protein kinase; CCCP, carbonyl cyanide m-chlorophenyl hydrazine; CFSE, 5-(and-6)-carboxyfluorescein diacetate, succinimidyl ester; DMEM, Dulbecco’s modified Eagle’s medium; ETC, electron transport chain; HPC, hematopoietic cell; IMCU, MCU current; IMM, inner mitochondrial membrane; KD, knockdown; LC3, light chain 3; LETM1, leucine zipper EF-hand containing transmembrane protein 1; MCU, mitochondrial Ca2⫹ uniporter; MCUR1, mitochondrial calcium uniporter regulator 1; MICU1, mitochondrial calcium uptake 1; MnSOD/GPX, manganese superoxide dismutase/ glutathione peroxidase; mROS, mitochondrial reactive oxygen species; NCLX, Na⫹/Ca2⫹ exchanger; NRVM, neonatal rat ventricular myocyte; OCR, oxygen consumption rate; qPCR, quantitative polymerase chain reaction; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction; ROS, reactive oxygen species; shRNA, short hairpin RNA; TMPD, N1,N1,N1,N1-tetramethyl-1,4-phenylene diamine; TMRE, tetramethyl rhodamine ethyl ester; WHS, Wolf-Hirschhorn syndrome; ⌬⌿m, mitochondrial membrane potential; WT, wild type 0892-6638/14/0028-0001 © FASEB

also impaired basal mitochondrial oxygen consumption, possibly via complex IV inactivation and ATP production. Remarkably, LETM1 knockdown also resulted in increased reactive oxygen species production. Further, LETM1 silencing promoted AMPK activation, autophagy, and cell cycle arrest. Reconstitution of LETM1 or antioxidant overexpression rescued mitochondrial Ca2ⴙ transport and bioenergetics. These findings reveal the role of LETM1-dependent mitochondrial Ca2ⴙ flux in shaping cellular bioenergetics.— Doonan, P J., Chandramoorthy, H. C., Hoffman, N. E., Zhang, X., Cárdenas, C., Shanmughapriya, S., Rajan, S., Vallem, S., Chen, X., Foskett, J. K., Cheung, J. Y., Houser, S. R., Madesh, M. LETM1-dependent mitochondrial Ca2ⴙ flux modulates cellular bioenergetics and proliferation. FASEB J. 28, 000 – 000 (2014). www.fasebj.org Key Words: Wolf-Hirschhorn syndrome 䡠 cell cycle 䡠 metabolism 䡠 reactive oxygen species Leucine zipper EF-hand containing transmembrane protein 1 (LETM1) was originally identified as deleted in patients with the human disease Wolf-Hirschhorn syndrome (WHS) (1, 2). WHS is a rare gene disorder caused by variable gene deletions on chromosome 4p, 1.81-1.86 Mb. Greater than 70% of patients have a heterozygous deletion of letm1 and develop seizures (3). While mitochondrial Ca2⫹ signaling is crucial for both physiological and pathological cell functions, molecules that facilitate mitochondrial Ca2⫹ uptake ([Ca2⫹]m) remain unclear. Mitochondrial matrix Ca2⫹ levels are intricately regulated by several inner mitochondrial membrane (IMM) molecules, such as the 1 Correspondence: Department of Biochemistry, 3500 N. Broad St., 950 MERB, Temple University, Philadelphia, PA 19140, USA. E-mail: [email protected] doi: 10.1096/fj.14-256453 This article includes supplemental data. Please visit http:// www.fasebj.org to obtain this information.

1

mitochondrial Ca2⫹ uniporter (MCU; refs. 4, 5), mitochondrial calcium uptake 1 (MICU1; refs. 5–7), MCU regulator 1 (MCUR1; ref. 8), MICU2 (9), MCUb (10), EMRE (11), Na⫹/Ca2⫹ exchanger (NCLX; ref. 12), SLC25A23 (13), and permeability transition pore (PTP; refs 14 –19). However, functional data suggest many molecules and their relationships are yet to be found, such as the relationship between the well-known components listed above and separate but redundant systems, such as uncharacterized channels and carriers, which contribute to the net ionic reaction and voltage in the form of mitochondrial membrane potential (⌬⌿m), based in part on [Ca2⫹]m. One such molecule is LETM1, functionally identified as an IMM Ca2⫹/H⫹ exchanger involved in mitochondrial transport (20, 21). To build a hypothesis as to how IMM proteins may contribute to [Ca2⫹]m uptake, we examined evolutionarily conserved mitochondrial proteins containing Ca2⫹-sensing EF-hand motifs. This search identified LETM1 homologs with 40% sequence identity in Saccharomyces cerevisiae (22). These LETM1-like genes, Yol027 and YPR125, encode for proteins that are 573 and 454 aa in length, respectively, and are intriguingly missing the putative Ca2⫹ binding EF hand of human LETM1, while maintaining nearly identical transmembrane domain sequences (22). It was suggested that Yol027 is responsible for K⫹ homeostasis because the small electroneutral K⫹/H⫹ exchanger molecule, nigericin, restored growth defects (22). In a related study, knockdown (KD) of fruit fly LETM1 homologue, DmLETM1 in S2 cells showed localization to the mitochondria and lysosomes (23), which could indicate increased mitophagy. Homozygous deletion of LETM1 using RNAi resulted in pre-larva-stage lethality (23). It was convincingly shown that H⫹ rather than K⫹ or Na⫹ drives LETM1-dependent Ca2⫹ transport, and because of equilibrium, LETM1 Ca2⫹ expulsion may be a common, if not a constant, phenomenon (21). A recent genetic study demonstrated that global deletion of letm1 in mice leads to embryonic lethality, and additionally, half of the heterozygous animals died prenatally, suggesting a crucial role for LETM1 in mitochondrial ion homeostasis (24). In addition, because of WHS severity, in which many Ca2⫹-regulated pathways, such as growth and immunity (25), are impaired, a more detailed understanding of how LETM1 regulates mitochondrial Ca2⫹ uptake in both physiological and pathophysiological conditions is warranted. In this study, we examined the role of LETM1 in mitochondrial bioenergetics and cellular metabolism. We found that silencing of LETM1 alters mitochondrial Ca2⫹ influx and efflux, mitochondrial bioenergetics, and metabolic signaling. Furthermore, loss of LETM1 elicits mitochondrial reactive oxygen species (mROS) production, 5=-adenosine monophosphate-activated protein kinase (AMPK) activation, cell cycle arrest, and defective cell proliferation. 2

Vol. 28

0 2014

MATERIALS AND METHODS Cells and animals HeLa cells (CCL2; American Type Culture Collection, Gaithersburg, MD, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Carlsbad, CA, USA) supplemented with 10% (vol/vol) FBS and 100 U/ml penicillin and streptomycin 100 U/ml at 37°C and 5% CO2. Human control fibroblasts (CF9) and primary fibroblasts of patients with WHS were obtained from the Coriell Institute for Medical Research (Camden, NJ, USA) and cultured in DMEM supplemented with 15% FBS and antibiotics. C57BL/6 (B6) wildtype (WT) mice and pregnant Sprague-Dawley rats were purchased from Jackson Laboratory (Bar Harbor, ME, USA). Animal protocols were approved by the Institutional Animal Care and Use Committee of Temple University. B-lymphocyte isolation and purification C57BL/6 mice were euthanized, and spleens were removed aseptically and perfused with collagenase D (1 mg/ml). The minced spleen was incubated for 30 min at 37°C, followed by straining through a 100-␮m cell strainer. The filtrate was centrifuged at 1000 rpm for 10 min at 4°C. The crude cell pellet was resuspended in 0.5 ml of ACS buffer to lyse red blood cells (RBCs). After RBC lysis, B lymphocytes were isolated, and purity was assessed by B220 staining. Purified cells were counted and resuspended in complete RPMI1640 medium. Isolation of neonatal rat cardiomyocyte Neonatal rat cardiomyocytes were isolated, as described previously (26). The heart was excised from neonatal rats (1–2 d), and cardiomyocytes were isolated with the Neonatal Cardiomyocyte Isolation kit (cat. no. nc-6301) from Cellutron Life Tech (Highland Park, NJ, USA), according to the manufacturer’s instructions. Isolated cardiomyocytes were washed 3 times with DMEM containing 10% FBS and seeded on laminin-coated 22-mm-diameter coverslips in 6-well cell culture plates (2⫻106 cells/well) overnight. On the second day, cardiomyocytes were washed with serum-free medium and cultured in complete DMEM. Cardiomyocytes were then transfected with siRNA against LETM1. RNA interference HeLa cells were transfected with pools of 3 distinct siRNAs (25 nM; Ambion, Austin, TX, USA) targeting LETM1. As a control, nontargeting siRNA duplexes were employed. Cells were used for experiments 48 h post-transfection. Sense sequences for human LETM1 siRNA: GAAGGAUUUUGAGCCCGAAtt, AAUACGUGGAAGAAUCUAAtt, and AGCAAGAGAUUGACAAAAAtt. Purified murine B cells and rat neonatal cardiomyocytes were transfected with species-specific OnTarget SmartPool siRNAs targeting LETM1 (Dharmacon, Lafayette, CO, USA). Mouse LETM1 siRNA sense sequences were CUGCCUAAUUCAUGAGUAAtt, CUAAAUAGUGGGUGACAUAtt, CCAACAACUUCCUGCGUUUtt, and AGGUAGACAACAAGGCGAAtt. Rat LETM1 siRNA sense sequences were AGGUAGACAACAAGGCGAAtt, GAAAAUAAGGAUGGCAAUAtt, CUGAAUGGCCAUACGCUGAtt, and CCAACAACUUCUUGCGUUUtt. Stable LETM1-KD cell lines Stable LETM1-KD HeLa cells were generated by lentiviral transduction. Briefly, two different lentiviruses carrying

The FASEB Journal 䡠 www.fasebj.org

DOONAN ET AL.

LETM1 short hairpin RNAs (shRNAs) targeting different regions of letm1 were produced by cotransfection in 293T cells with letm1-specific lentiviral shRNA constructs (Open Biosystems; Fisher Scientific, Pittsburgh, PA, USA), psPAX2, and pMD2.G (Addgene, Cambridge, MA, USA), as described previously (27). Supernatants containing lentiviral particles were collected 48 –72 h post-transfection, centrifuged (800 rpm for 5 min) to remove cellular debris, filtered, and stored at ⫺80°C until use. For transduction, HeLa cells were treated with lentiviral supernatants for 2– 4 h and replenished with fresh medium. At 2 d post-transduction, the transduced cells were selected with puromycin (2 ␮g/ml) for 6 –10 d, and the stable clones were expanded. LETM1 expression levels in the stable cells were assessed by quantitative polymerase chain reaction (qPCR) and Western blotting. The lentiviral shRNA sequences to LETM1 that were used in the study were TRCN0000056543 (sh1): CCGGCCAGAGATTGTGGCAAAGGAACTCGAGTTCCTTTGCCACAATCTCTGGTTTTTG, and TRCN0000056543 (sh2): CCGGCAACGCCATGAAGCAAGTCAACTCGAGTTGACTTGCTTCATGGCGTTGTTTTTG. LETM1 shRNA rescue and mutant expression experiments For LETM1 rescue studies, a full-length LETM1 cDNA construct, harboring 4 silent mutations in the shRNA target region, was generated (Origene Technologies, Rockville, MD, USA). LETM1-KD cells (sh2) were transfected with LETM1 rescue construct, and the cells carrying the LETM1 rescue DNA were stably selected by neomycin selection (500 ␮g/ml G418 sulfate; Invitrogen). The LETM1 expression levels in the rescue clones were assessed by qPCR and Western blot analysis. HeLa cells were transfected with C-terminal GFPtagged wild-type, ⌬EFLETM1 and D676A D688KLETM1 cDNAs and subjected for Ca2⫹ imaging 48 h post-transfection. Quantative reverse transcriptase PCR (qRT-PCR) and Western blot analysis Total RNA was isolated from cells and converted to cDNA using Verso cDNA synthesis kit. Predesigned, fluorescently labeled gene-specific primer probes were used to amplify cDNA to determine gene expression levels. Solaris qRT-PCR (Thermo Fisher Scientific, Waltham, MA, USA) was used for quantifying gene expression levels. For protein levels, whole cell lysates were extracted using RIPA buffer supplemented with protease and phosphatase inhibitors. Equal amounts of protein were separated by PAGE (4 –12% BisTris), transferred to a PVDF membrane, and probed with anti-LETM1 (Abnova, Taipei, Taiwan), anti-MCU, anti-MCUR1, anti-MICU1, anticyclophilin D (Abcam, Cambridge, MA, USA) and anti-actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA) (28). Measurement of cytosolic and mitochondrial Ca2ⴙ changes Cytosolic and mitochondrial Ca2⫹ changes were assessed simultaneously, as described previously (7, 29 –31). Briefly, cells were loaded with Fluo4-AM (5 ␮M; Invitrogen) and rhod2-AM (2 ␮M; Invitrogen) for 50 min at 37°C. Time-lapse images were recorded (3-s interval) using a Zeiss 510 inverted confocal microscope (Carl Zeiss, Oberkochen, Germany) with the same illumination and gain settings for all experiments. Cells were challenged with G-protein-coupled receptor agonist, histamine (100 ␮M) to mobilize Ca2⫹ at the 20th frame of recording. For human primary fibroblasts, thrombin (250 mU/ml) and for B-cells, IgM (5 ␮g/ml) were used as agonists. Data were analyzed using ImageJ software (U.S. National Institutes of Health) and presented as traces of LETM1-MEDIATED CA2⫹ FLUX AND CELLULAR BIOENERGETICS

mean (bold line) and sem (lighter bars) for all data points (time vs. intensity). To assess the mitochondrial Ca2⫹ dynamics, cells were transiently transfected with fluorescent protein-based mitochondrial Ca2⫹ indicator, GCaMP2-mt (32). At 48 h posttransfection, cells were challenged with histamine, and GCaMP2 fluorescence was monitored (488 nm; excitation and 515 nm; emission) using a Zeiss 510 META confocal microscope with a ⫻40 oil objective. GCaMP2 fluorescence was quantified using ZEN 2010 software (Zeiss). IMCU recording Mitoplast patch-clamp recordings were conducted as described previously (13, 29, 33–35). Mitoplasts were bathed in CaCl2 (5 mM), sodium gluconate (150 mM), KCl (5.4 mM), and HEPES (10 mM), pH 7.2. The pipette solution contained sodium gluconate (150 mM), NaCl (5 mM), sucrose (135 mM), HEPES (10 mM), and EGTA (1.5 mM), pH 7.2. IMCU was recorded with a computer-controlled Axon200B patchclamp amplifier with a Digidata 1320A acquisition board (pClamp 10.0 software; Axon Instruments, Foster City, CA, USA). Following gigaohm seal (resistance 12–20 M⍀), mitoplasts were ruptured with a 200- to 400-mV pulse varying from 2- to 6-ms duration. Mitoplast capacitance was measured (2.5–2.9 pF). After capacitance compensation, mitoplasts were held at 0 mV, and IMCU was elicited with a voltage ramp (from ⫺160 to 80 mV, 120 mV/s). ⌬⌿m measurement Cells were loaded with ⌬⌿m indicator tetramethyl rhodamine ethyl ester (TMRE; 50 nM) for 30 min, and images were acquired by confocal microscopy using the same illumination and gain settings for all experiments. TMRE fluorescence was quantified using ImageJ software (31). Mitochondrial oxygen consumption rate (OCR) Intact HeLa and 293T cells were subjected to OCR measurement at 37°C in an XF96 extracellular flux analyzer (Seahorse Bioscience, North Billerica, MA, USA). Cells were sequentially exposed to oligomycin, FCCP, and rotenone plus antimycin A using the XF Cell Mito stress kit (Seahorse Bioscience), according to the manufacturer’s instructions (7, 32, 36). Preliminary cell density and dose-response experiments were performed to select optimal seeding density (HeLa, 2⫻104 cells/well; 293T, 1.5⫻104 cells/well) and compound concentrations, per manufacturer’s instructions. Digitonin (20 ␮M) permeabilized HeLa cells (1⫻106 cells) were placed in a MT200A Mitocell closed chamber (StrathKelvin Instruments, Motherwell UK) and mitochondrial substrates [malate (5 mM) ⫹ pyruvate (5 mM), succinate (5 mM), N1,N1,N1,N1-tetramethyl-1,4-phenylene diamine (TMPD; 0.4 mM) ⫹ ascorbate (2.5 mM)] and the complex IV inhibitor sodium azide were added sequentially (37). OCR was calculated using StrathKelvin oxygen system data analysis module and expressed in units of micromoles of oxygen per minute. Cellular ATP measurement Total cellular ATP levels were assessed using CellTiter-Glo luminescent assay kit (Promega, Madison, WI, USA) as per the manufacturer’s instruction. Luminescence was measured using a Victor X5 2030 multilabel reader (Perkin Elmer, Wellesley, MA, USA; ref. 38). 3

Determination of mROS HeLa cells were cultured on glass coverslips and loaded with the mitochondrial superoxide indicator MitoSOX Red (Invitrogen; 10 ␮M) for 30 min in extracellular matrix at 37°C and 5% CO2. Hoechst 33342 was used as nuclear counterstain. Images were acquired using a Zeiss 510 inverted confocal microscope with ⫻40 oil-immersion objective with excitation at 561 nm and emission at 610 nm. MitoSox Red fluorescence was quantitated using ImageJ software (39). NAD(P)H measurements HeLa cells (10⫻106 cells/ml) were suspended in Hanks’ balanced salt solution (Sigma, St. Louis, MO, USA). NAD(P)H autofluorescence was monitored at 350/460 nm (excitation/emission) using a multiwavelength excitation, dualwavelength emission fluorimeter (Delta RAM; Photon Technology International, Birmingham, NJ, USA; ref. 40, 41). Cell proliferation and cell cycle assay B-lymphocyte purity was assessed using CD3-PE and CD19APC antibodies (eBioscience, San Diego, CA, USA), and samples were analyzed using FlowJo software (LSRII; Becton Dickinson, San Jose, CA, USA). Cell proliferation was assessed by 5-(and-6)-carboxyfluorescein diacetate, succinimidyl ester (CFSE) staining using Cell Trace CFSE cell proliferation kit (C34554; Invitrogen). Briefly, CFSE-labeled (5 ␮M for 15 min) cells were plated at 37°C, 5% CO2 for 72 h. Labeled cells were isolated and fixed with 3.7% paraformaldehye and stored at 4°C until flow acquisition. B-lymphocytes were similarly labeled with CFSE and then stimulated with goat anti-mouse IgM (Sigma; 30 ␮g/ml for 72 h). For cell cycle analysis, cells were stained with propidium iodide and analyzed by flow cytometry. Ca2ⴙ uptake in permeabilized HeLa cells HeLa cells (7⫻106 cells) were permeabilized using digitonin (40 ␮M) containing intracellular-like medium [ICM; permeabilization buffer: 120 mM KCl; 10 mM NaCl; 1 mM KH2PO4; 20 mM HEPES-Tris, pH 7.2; protease inhibitors (EDTA-free cOmplete tablets; Roche Applied Science, Minneapolis, MN, USA); and 2 ␮M thapsigargin] supplemented with 5 mM succinate. Fura-2FF was to monitor bath Ca2⫹ using a fluorimeter (Photon Technology International). Following baseline recording, cells were pulsed with 10 ␮M Ca2⫹ at 350 s to measure mitochondrial Ca2⫹ uptake, followed by the addition of the 1 ␮M Ru360 at 550 s, 10 ␮M CGP37157 at 610 s, and 2 ␮M CCCP at 750 s (7, 31, 42, 43). Statistical analysis GraphPad Prism 6.0 (GraphPad, San Diego, CA, USA) was used to perform 2-tailed Student t tests or 1-way ANOVA with Tukey post hoc test to determine significance. All values represent 3 or 4 independent experiments run in triplicate and plotted as means ⫾ sem.

RESULTS LETM1 regulates mitochondrial Ca2ⴙ transport LETM1 was implicated in mitochondrial Ca2⫹/H⫹ antiporter activity (20, 44). To determine the role of 4

Vol. 28

0 2014

LETM1 in mitochondrial Ca2⫹ uptake, HeLa cell lines with stable expression of LETM1 shRNA (sh2) were created with LETM1 expression decreased by 70% at the mRNA level and protein level (Fig. 1A, B). We also assessed whether the stable KD of LETM1 affected MCU complex protein expression. In LETM1-KD cells, MCU, MCUR1, and MICU1 protein levels were found to be unaltered (Supplemental Fig. S1). To validate that, indeed, LETM1 KD was responsible for the decreased [Ca2⫹]m, sh2 shRNA-insensitive LETM1 was overexpressed in sh2 shRNA stable cells (Fig. 1C, D). After transient transfection with mitochondrial marker Mito-eGFP, cells were loaded with mitochondrial Ca2⫹ indicator rhod-2 and stimulated with histamine (100 ␮M) to assess the mitochondrial Ca2⫹ dynamics (Fig. 1E). The reexpression of LETM1 restored [Ca2⫹]m to negative shRNA (neg shRNA) levels (Fig. 1F, G). To complement the rhod-2 AM data, cells were transfected with the fluorescent protein-based mitochondrial Ca2⫹ indicator GCaMP2-mt and monitored after histamine challenge (Fig. 1H, I). Silencing of LETM1 reduced mitochondrial Ca2⫹ transport and was rescued by ectopic overexpression of human LETM1 in LETM1-KD cells (Fig. 1I). To support our cell line findings, we characterized the mitochondrial Ca2⫹ uptake in LETM1-silenced murine primary B lymphocytes, hematopoietic cells (HPCs), and neonatal rat ventricular myocytes (NRVMs) (see Materials and Methods). Freshly purified B-lymphocytes and HPCs treated with LETM1-specific siRNA resulted in ⬃50% reduction of LETM1 mRNA (data not shown). Although only partial silencing of LETM1, mitochondrial Ca2⫹ uptake was dramatically reduced (Fig. 1J, K). Similarly, decreased mitochondrial Ca2⫹ uptake was observed in LETM1silenced NRVMs (Fig. 1L, M). Taken together, these multicell type experiments indicate that LETM1 is ubiquitously expressed, enhances mitochondrial Ca2⫹ transport, and is necessary for cell proliferation. Type-I transmembrane protein, LETM1, contains a highly conserved canonical Ca2⫹ binding EF hand domain (45), which may be a determinant-sensing mechanism for LETM1 function. To investigate, we designed two unique mutant constructs that lack either the entire 12 aa of the LETM1 EF hand (⌬EFLETM1) or point mutations of two critical residues (D676A D688KLETM1) (Fig. 1N). We then verified the mitochondrial localization of the LETM1 mutants by heterologous expression of ⌬EF LETM1-GFP and D676AD688KLETM1-GFP in HeLa cells using either mito-GFP or full-length LETM1-GFP as controls. Neither mutation nor deletion of the EF hand had any effect on mitochondrial localization of LETM1 (Fig. 1O and Supplemental Fig. S2). However, heterologous expression of ⌬EF LETM1 or D676AD688KLETM1 significantly impaired mitochondrial Ca2⫹ transport (Fig. 1P, Q). Our findings demonstrate the importance of the EF-hand domain for LETM1 Ca2⫹ transport function. To discern between LETM1 function in influx, efflux, and total [Ca2⫹]m, we measured extramitochondrial Ca2⫹ during cytosolic clearance, mitochondrial

The FASEB Journal 䡠 www.fasebj.org

DOONAN ET AL.

Figure 1. Conserved EF-hand domain of LETM1 is necessary for mitochondrial Ca2⫹ transport. A, B) LETM1 expression in HeLa cells stably expressing either negative shRNA or lentiviral shRNAs targeting different regions of letm1 was assessed by qRT-PCR (A) and Western blot analysis (B). C) Ectopic expression of LETM1 carrying nonsense point mutations at sh2 shRNA targeting regions rescued the LETM1 qRT-PCR mRNA levels. D) Western blot analysis of LETM1 protein levels in LETM1-KD cells. E) Representative confocal images depicting rhod-2 colocalization with transiently transfected mitochondrial marker Mito-eGFP. F) Representative traces show histamine-induced changes in [Ca2⫹]m in WT, negative shRNA, LETM1-KD (sh2), and LETM1-rescue HeLa cells. Bold lines represent average from 3e independent experiments; shading represents means ⫾ sem. G) Peak amplitude of mitochondrial Ca2⫹ uptake. H) Image depicts expression of mitochondria-targeted Ca2⫹ indicator GCaMP2. I) GCaMP2-mt-expressing negative shRNA, LETM1-KD (sh2) and LETM1-KD ⫹ LETM1 cells were stimulated with histamine (100 ␮M). J) Mouse B lymphocytes purified from freshly isolated splenocytes were treated with LETM1 siRNA. Representative traces of mitochondrial Ca2⫹ uptake following IgM (5 ␮g/ml) stimulation are shown. K) Quantitation of peak amplitude. L) Similarly, neonatal cardiomyocytes (NRVMs) were treated with LETM1 siRNA and stimulated with thrombin. M) Quantitation of peak amplitude. N) Schematic representation of LETM1 showing full-length EF-hand deletion and EF-hand mutation regions. O) Representative images show the mitochondrial localization of mitoGFP, full-length ⌬EF and D676A D688K double-mutant LETM1. P) Representative traces show mitochondrial Ca2⫹ uptake (rhod-2 fluorescence) in HeLa cells expressing full-length, ⌬EF, and D676A D688K double-mutant LETM1 following histamine (100 ␮M) challenge. Bold line of the trace represents the average of values from 3 independent experiments; lighter bars in the trace represent sem. Q) Quantitation of peak amplitude for mitochondrial Ca2⫹ uptake. Data are represented as means ⫾ sem. n.s., not significant. *P ⬍ 0.05, **P ⬍ 0.01, ***P ⬍ 0.001; t test.

LETM1-MEDIATED CA2⫹ FLUX AND CELLULAR BIOENERGETICS

5

Ca2⫹ efflux, and release of total mitochondrial Ca2⫹, respectively. First, to trigger [Ca2⫹]m uptake, a 10 ␮M Ca2⫹ bolus was added to permeabilized HeLa cells in the presence of extramitochondrial Ca2⫹ indicator, Fura-2FF. The extramitochondrial Ca2⫹ clearance rate was reduced in the LETM1-KD and restored to neg shRNA levels in the LETM1 rescue construct (Fig. 2A, B). Second, we added Ru360, an inhibitor of MCU, to visualize [Ca2⫹]m efflux (Fig. 2A, C). Efflux rate was also diminished, suggesting that mitochondrial LETM1 participates in a Ca2⫹ uniporter-independent efflux pathway (Fig. 2C, D). The mitochondrial efflux was finally halted through the addition of NCLX inhibitor CGP-37157 (12). This stabilized the [Ca2⫹]m influx and efflux, as both MCU and NCLX were blocked. Third, the uncoupler, carbonyl cyanide m-chlorophenyl hydrazine (CCCP) was added to measure total mitochondrial Ca2⫹ levels (Fig. 2A, E). The [Ca2⫹]m was increased in LETM1-KD cells, indicating that LETM1-KD mitochondria hold more [Ca2⫹]m (Fig. 2E, F). In total, these experiments showed that during GPCR stimulation,

LETM1 KD lowers mitochondrial Ca2⫹ influx rate likely by a reduction in efflux rate (Fig. 1I and Fig. 2A, D). This reduction in efflux rate may shift the equilibrium of mitochondrial Ca2⫹, leading to greater mitochondrial Ca2⫹ accumulation. Since loss of LETM1 affects both influx and efflux rates, we tested whether LETM1 interacts with NCLX. Our immunoprecipitation data indicated that LETM1 and NCLX do not physically interact (data not shown). These results suggest that LETM1 alone provides a Ca2⫹ efflux mechanism. IMCU is independent of LETM1 If LETM1 is a regulator of MCU activity, then IMCU may be altered in LETM1-KD cells. Thus, LETM1-KD HeLa mitochondria were subjected to mitoplast preparation, and IMCU was recorded by patch clamp. In the patch clamp of whole-mitoplast configuration, the application of 5 mM Ca2⫹ to the bath produced an inwardly rectifying Ca2⫹ current (Fig. 3A, B). Compared to

Figure 2. LETM1-KD impairs both mitochondrial influx and efflux rates. A) HeLa cells permeabilized with 40 ␮g/ml of digitonin and loaded with the ratiometric Ca2⫹ indicator Fura2-FF were pulsed with 10 ␮M Ca2⫹ at 350 s to measure mitochondrial Ca2⫹ uptake, followed by the addition of the 1 ␮M Ru360 at 550 s, 10 ␮M CGP37157 at 610 s, and 2 ␮M uncoupler, CCCP, at 750 s. Average traces with mean data point for each time point plotted with sem. B) Quantitation of Ca2⫹ influx rate. C) Magnification of Ca2⫹ efflux from panel A (between 550 and 700 s). D) Quantitation of Ca2⫹ efflux rate after addition of Ru360. E) Magnification of Ca2⫹ release after CCCP addition from panel A (between 700 and 900 s). F) Quantitation of CCCP-induced release of accumulated mitochondria Ca2⫹. Data are means ⫾ sem (n⫽3). n.s., not significant. *P ⬍ 0.05, **P ⬍ 0.01 vs. neg shRNA.

6

Vol. 28

0 2014

The FASEB Journal 䡠 www.fasebj.org

DOONAN ET AL.

Figure 3. LETM1 is dispensable for IMCU. Mitoplast Ca2⫹ current (IMCU) from HeLa cells was recorded before and after application of 5 mM Ca2⫹ to the bath medium. Currents were measured during a voltage ramp as indicated. Traces are a representative single recording of IMCU from neg shRNA (black; A) and LETM1 KD (red; B). C) IMCU densities (pA/pF) for neg shRNA (black) and LETM1 KD (red). Data are expressed as means ⫾ sem (n⫽4). ns, not significant.

negative shRNA, stable KD of LETM1 in HeLa cells did not alter IMCU (Fig. 3C). This result indicates that LETM1 could be dispensable for IMCU activity. LETM1 deficiency alters cellular bioenergetics

Loss of LETM1 promotes mROS Impairment of mitochondrial function and bioenergetics promotes mROS overproduction (46); therefore, we hypothesized that silencing LETM1 could lead to mROS elevation. Indeed, we found that mROS was significantly elevated in LETM-KD HeLa cells (Fig. 5A), and, consistent with the results concerning OCR and ATP levels, shRNA insensitive LETM1 expression in sh2 cells restored physiological mROS levels (Fig. 5A, B). It has also been established that delivery of antioxidant genes attenuates mROS production and restores mitochondrial function (7, 38). To verify that the measured ROS was mitochondrial and investigate a possible link with the observed LETM1-KD bioenergetic defect, HeLa cells were transfected with mitochondrial-targeted manganese superoxide dismutase/glutathione peroxidase (MnSOD/GPX), then evaluated for complex IV OCR and ATP levels. Expectedly, overexpression of MnSOD/GPX abrogated mROS levels in LETM1-KD cells (Fig. 5A, B), and remarkably, overexpression of antioxidant genes in sh2 cells restored complex IV OCR and ATP levels (Fig. 5C, D). These results strongly suggest a link between mROS production and bioenergetic deficiency in LETM1-KD cells.

Aberrant mitochondrial Ca2⫹ uptake may lead to cellular metabolic changes. To determine the effects of the observed reduced mitochondrial Ca2⫹ uptake in cells with LETM1 knocked down, we examined ⌬⌿m, NAD(P)H levels, OCR, ATP levels, and proliferation in LETM1-KD HeLa cells. LETM1 KD had no effect on ⌬⌿m, nor did LETM1 KD affect NAD(P)H levels (Fig. 4A, B and Supplemental Fig. S3). Basal OCR in intact HeLa and 293T cells (Fig. 4C, D) was lowered in LETM1-KD cells, which was significantly rescued by reconstitution of LETM1 (Fig. 4C–E). Consistent with the NAD(P)H data, complex I/II substrate-induced OCR was unchanged in LETM1-KD cells (Fig. 4F), while further examination of the electron transport chain (ETC) revealed that complex IV substrate-induced OCR was markedly reduced in LETM1-KD cells. These data revealed that lower OCR in LETM1-KD cells is primarily due to the complex IV impairment. Consequently, basal ATP levels were also significantly decreased in LETM1-KD cells (Fig. 4G), and ectopic expression of shRNA insensitive LETM1 rescued both OCR (partial) and ATP levels (Fig. 4F, G). Having observed reduced bioenergetics in LETM1-KD cells, we next examined whether cell proliferation is hindered. Cell proliferation, measured as CFSE distribution, showed a marked reduction in LETM1-KD HeLa cells (Fig. 4H, I), and this was rescued by ectopic expression of shRNA-insensitive LETM1. Similarly, LETM1 also regulates cellular proliferation in primary cells, B-lymphocytes (Fig. 4J, K) and HPCs (Fig. 4L, M). These results demonstrate that bioenergetics and proliferation are impaired in LETM1 KD across several cell types.

To further explore the cell culture results and better understand the role of LETM1 in humans, primary fibroblasts derived from patients with WHS (caused by partial deletion of the subtelomeric region of the short arm of chromosome 4 encompassing LETM1) were examined. We found that patients with WHS had decreased LETM1 protein expression, but MCU, MCUR1, and MICU1 protein levels were unaltered (Fig. 6A). Next, we sought to determine whether the

LETM1-MEDIATED CA2⫹ FLUX AND CELLULAR BIOENERGETICS

7

WHS patient fibroblasts have decreased expression of LETM1 and impaired mitochondrial Ca2ⴙ uptake

Figure 4. LETM1 regulates cellular bioenergetics and cell proliferation in B lymphocytes and HPCs. A) ⌬⌿m was assessed in cells loaded with TMRE (50 nM) for 30 min. Confocal images were collected and the TMRE fluorescence quantitated using ImageJ software. Bar graph shows the quantitation of TMRE fluorescence (indicator of ⌬⌿m) in WT, negative shRNA, sh2, and LETM1 rescue HeLa cells. B) Bar graph represents NADH autofluorescence in WT, neg shRNA, and sh2 HeLa cells. C) OCR was measured in HeLa WT, sh2, and sh2 ⫹ LETM1 cells. After basal OCR was obtained, oligomycin, FCCP, rotenone, and antimycin A were added as indicated. D, E) Bar graph represents measurement of basal OCR in intact HeLa (D) and 293T (E) WT, sh2, and sh2 ⫹ LETM1 cells. *P ⬍ 0.05, **P ⬍ 0.01, ***P ⬍ 0.001; 1-way ANOVA with Tukey post hoc test. F) Mitochondrial OCR was measured (continued on next page) 8

Vol. 28

0 2014

The FASEB Journal 䡠 www.fasebj.org

DOONAN ET AL.

Figure 5. LETM1 deficiency promotes mitochondrial ROS production. A) HeLa clones lacking LETM1 (sh2), overexpressing shRNA-insensitive LETM1 cDNA or sh2 cells overexpressing MnSOD/GPX constructs, and control cells were stained with the mitochondrial superoxide indicator, mitoSOX RED (10 ␮M), counterstained with Hoechst 33342, and imaged by confocal microscopy. B) Representative images and quantitation of mitoSOX red-stained HeLa WT, neg shRNA, LETM1-KD (sh2), LETM1 rescue, and MnSOD/GPX-overexpressing sh2 cells. C) LETM1 induced reduction in complex IV-mediated OCR. D) ATP levels were rescued by LETM1 rescue or MnSOD/GPX overexpression. Bars represent means ⫾ sem. n.s., not significant. *P ⬍ 0.05, **P ⬍ 0.01, ***P ⬍ 0.001; t test determined using 1-way ANOVA with Tukey post hoc test.

patient mitochondria retain normal mitochondrial function. The mitochondrial morphology appeared healthy and elongated except in patient 2, where mitochondria loaded with TMRE appear somewhat diffuse and rounded, while ⌬⌿m remained similar across patients (Fig. 6B, C). Interestingly, mitochondrial Ca2⫹ uptake was impaired in all three patients with WHS (Fig. 6D, E). Finally, to confirm the cell culture results that showed loss of LETM1 leads to increased mROS and bioenergetic dysfunction, mROS and ATP from WHS-derived fibroblasts were measured using MitoSOX Red and ATP luminescence, respectively. We observed that WHS fibroblasts exhibit elevated mROS (Fig. 6F, G) and a likely decreased ATP level (Fig. 6H) that when combined with the cell culture data indicate that loss of letm1 is responsible for these consequences.

LETM1 is linked to autophagy Having demonstrated that KD of LETM1 results in considerable decline of ATP levels, we hypothesized that ADP/ATP and AMP/ATP could be altered. Cells with high AMP/ATP ratio may result in phosphorylation-triggered activation of AMPK, a bioenergetic sensor that results in autophagosome formation (47). We monitored autophagosome binding protein, microtubule-associated protein light chain 3 (LC3), a ubiquitinlike protein indicative of autophagy. Interestingly, a large number of LC3 puncta were seen in LETM1-KD cells, which was partially rescued by reconstituted shRNA insensitive LETM1 (Fig. 7A). LC3 processing of full-length LC3-I and LC3-II was also elevated in LETM1-KD cells (Fig. 7B). In addition to LC3 puncta formation and processing, we observed increased phos-

in permeabilized WT, neg shRNA, sh2, and LETM1 rescue HeLa cells by successive additions of complex I (5 mM malate ⫹ 5 mM pyruvate), complex II (5 mM succinate) and complex IV (0.4 mM TMPD ⫹ 2.5 mM ascorbate) substrates using Strathkelvin sealed oxygen chamber. Bar graph represents complex I-, II-, and IV-mediated OCR in WT, neg shRNA, sh2, and LETM1 rescue HeLa cells. G) ATP levels were measured using Cell Titer-Glo luminescent assay. H) Representative histogram obtained by flow cytometric analysis of CFSE-stained cells shows decreased proliferation in LETM1-KD cells. I) Bar chart represents percentage proliferation of LETM1-KD, rescue, and control cells. J) Purified mouse B lymphocytes were treated with LETM1 siRNA. Representative histogram obtained by flow cytometric analysis of CFSE-stained B cells. K) Bar chart represents percentage proliferation of LETM1-KD and control cells. L, M) Similarly, bar charts represent HPC proliferation (L) and quantitation (M). Bars represent means ⫾ sem. n.s., not significant. **P ⬍ 0.01, ***P ⬍ 0.001; t test (all panels except D, E). LETM1-MEDIATED CA2⫹ FLUX AND CELLULAR BIOENERGETICS

9

Figure 6. WHS patient fibroblasts express less LETM1, leading to attenuated mitochondrial Ca2⫹ uptake, increased superoxide production, and decreased ATP levels. A) Whole-cell lysates (20 ␮g) of fibroblasts derived from healthy individuals and patients with WHS were used to probe for LETM1, MCU, MCUR1, and MICU1 protein expression. Western blot shows reduced LETM1 protein levels in patients with WHS. B) ⌬⌿m, as indicated by TMRE fluorescence, remained unaltered in WHS patient fibroblasts. ⌬⌿m was assessed in fibroblasts loaded with TMRE (50 nM) for 30 min. C) Confocal images were collected, and the TMRE fluorescence was quantitated using ImageJ software. D) Representative changes in mitochondrial calcium uptake (rhod-2 fluorescence) in control and WHS patient fibroblasts following thrombin (250 mU) challenge. Bold line of the trace represents the average of values from 3 independent experiments; lighter bars in the trace represent sem. E) Bar chart shows quantitation of peak rhod-2 fluorescence. F) Representative images of mitoSOX red-stained control and WHS patient fibroblasts showing mitoSOX red fluorescence (indicator of mitochondrial superoxide). G) Bar graph represents the quantitation of mitoSOX red fluorescence in control and WHS fibroblasts. H) Bar graph of ATP levels in control and WHS fibroblasts measured with Cell Titer-Glo luminescent assay. Data are presented as means ⫾ sem. n.s. not significant. *P ⬍ 0.05, **P ⬍ 0.01, ***P ⬍ 0.001; t test.

10

Vol. 28

0 2014

The FASEB Journal 䡠 www.fasebj.org

DOONAN ET AL.

Figure 7. LETM1 ablation influences basal autophagy, AMPK activation, and cell cycle arrest. A) Representative confocal images of GFP-LC3 in WT, negative shRNA, sh2, and LETM1 rescue HeLa cells. Increased LC3-GFP puncta formation is seen in sh2 HeLa cells. B) Western blot of LC3 and tubulin in WT, negative shRNA, sh2, and LETM1 rescue HeLa cells (top panel) and quantification of LC3-II/(LC3-I ⫹ LC3-II) (bottom panel) expressed as fold increase over WT levels. C) Western blot of P-AMPK, AMPK, or tubulin in WT, negative shRNA, sh2, and LETM1 rescue HeLa cells (top panel) and quantification of P-AMPK/AMPK expressed as a fold increase over WT levels (bottom panel). D) Representative histogram (left panel) and the quantitative data table (right panel) of cell cycle stages in negative shRNA, sh2, and LETM1 rescue HeLa cells at 24 and 48 h. Cells were stained at 24 and 48 h with propidium iodide and analyzed by flow cytometry.

LETM1, an EF-hand domain-containing leucine zipper protein with several coiled-coil regions, was proposed to

play a role in mitochondrial Ca2⫹ homeostasis (2). A decade later, the role of LETM1 in mitochondrial Ca2⫹ transport was elucidated using a genome-wide RNAi screen in a Drosophila cell line (20). Our results with LETM1 EF-hand domain deletion and point mutations revealed the critical role of the EF-hand motif in mitochondrial Ca2⫹ uptake. Further, our targeted RNA interference studies with both siRNA and lentiviral shRNAs confirmed the role of LETM1 in mitochondrial Ca2⫹ uptake. Using cells from 3 different species (mouse, rat and human), we show that LETM1 mediates mitochondrial Ca2⫹ uptake, which suggests that LETM1-dependent mitochondrial flux is crucial for mitochondrial physiology. To link our findings to pathophysiological WHS conditions, patient-derived fi-

LETM1-MEDIATED CA2⫹ FLUX AND CELLULAR BIOENERGETICS

11

phorylated AMPK levels in LETM1 KD cells (Fig. 7C). Having observed retardation of cell proliferation after LETM1 KD, we next examined whether silencing of LETM1 affects the cell cycle. Intriguingly, we found an accumulation of S-phase cells in LETM1-KD condition, which could be reversed by reexpression of LETM1 (Fig. 7D). These data suggest a possible role for LETM1 in mitochondrial bioenergetics and cell cycle progression.

DISCUSSION

broblasts demonstrated reduced mitochondrial Ca2⫹ flux after thrombin challenge. Global deletion of letm1 in a mouse model resulted in embryonic lethality (24). letm1 heterozygous deletion is 50% embryonically lethal (24), while homozygous MCU-knockout mice showed modest phenotype (48), which suggests that LETM1 is critical for mitochondrial bioenergetics during development. WHS is also a heterozygous deletion, further affirming that the phenotype of the heterozygous deletion in mice is conserved in humans. Although LETM1 loss causes growth retardation, apoptosis is unchanged, which strongly points to LETM1 as a major factor in bioenergetics, and LETM1 heterozygotes were, indeed, shown to have lower basal and maximal OCR under low glucose conditions (24). Our results using 3 different approaches (dominantnegative, siRNA, and shRNA) were able to show that LETM1 plays a role in mitochondrial Ca2⫹ transport. The role of LETM1 in mitochondrial Ca2⫹ entry has been evaluated in several cells types (S2, HeLa, and EA.hy926), but the phenotypic changes that occur due to partial loss of LETM1 remain poorly understood. Interestingly, ⬃70% KD of LETM1 in HeLa cells still appeared viable, with little effect on gross mitochondrial morphology. While others observed mitochondrial fragmentation in either cells treated with two different siRNAs against LETM1 or cells that overexpress LETM1 (49), our studies with both siRNA and stable lentiviral-shRNA mediated LETM1 KD did not show mitochondrial fragmentation. Mitochondria are known to influence the spatiotemporal pattern of cytosolic Ca2⫹ levels by matrix Ca2⫹ sequestration. Consistent with previous reports (24, 49), KD of LETM1 did not alter mitochondrial membrane potential but may have an effect on mitochondrial pH (50, 51). However, an extended proliferative doubling time in LETM1-KD cells prompted us to investigate the bioenergetic parameters. We found that disruption of LETM1 lowers the ATP production in HeLa cells, suggesting the importance of LETM1-mediated Ca2⫹ transport for mitochondrial bioenergetics. [Ca2⫹]m stimulates the tricarboxylic acid (TCA) cycle and oxidative phosphorylation, thus coordinating up-regulation of respiratory chain and ATP synthase activities resulting in higher ATP synthesis. Lower ATP levels in LETM1-KD HeLa cells suggested a defect in ETC activity. Interestingly, we found a marked inhibition of complex IV activity in LETM1-KD cells, but other complex activities remain unchanged, suggesting that the physiological synchronization of ETC by mitochondrial Ca2⫹ may be perturbed. In most cell types, ROS response to stimuli are necessary for cell signaling, but ROS overproduction leads to mitochondrial dysfunction. In LETM1-KD cells, the reduced activity of complex IV resulted in an elevation of mitochondrial superoxide levels. Either reconstitution of LETM1 or ectopic expression of antioxidant genes abrogated the superoxide overproduction in LETM1-KD cells. Our study reveals a link between LETM1 and mROS production. In addition, 12

Vol. 28

0 2014

KD of LETM1 is known to decrease mitochondrial supercomplex formation (52). Without proper supercomplex formation, the ability of complex IV to retain partially reduced oxygen decreases, resulting in basal ROS elevation. AMPK activity has been implicated in cell growth, proliferation, and prosurvival. It is well established that an increase in AMP/ATP ratio results in the activation of cellular energy sensor AMPK (47). Activation of AMPK has been known to be associated with cell cycle arrest (53). Having demonstrated the decline in ATP levels in LETM1-KD cells, we speculated whether AMPK-dependent autophagy exists in these cells. Consistent with this hypothesis, our results show that AMPK is elevated in LETM1-KD cells, and AMPK and partial LC3 levels are reversible by reconstitution of LETM1. Of note, our results indicate that although AMPK elevation is reversed, the re-expression of LETM1 had partial inhibitory effect on LC3 processing. Until recently, the molecular identity of the MCU was unknown (4, 5). With the discovery of the channel pore, MCU, the molecules responsible for its regulation have become a new frontier. In addition to MCU, MICU1, MCUR1, MCUb, MICU2, UPC2/3, and EMRE were shown to control Ca2⫹ flux. Intriguingly, using an RNAi approach, De Stefani et al. (5) and Baughman et al. (4) reported that KD of MCU protein expression impaired mitochondrial Ca2⫹ uptake but a minimal uptake remained, suggesting the existence of alternative mode of Ca2⫹ entry. Our work shows that stable KD of LETM1 impairs mitochondrial Ca2⫹ uptake by ⬃25% (Figs. 1 and 2), whereas MCU KD impairs mitochondrial Ca2⫹ uptake by ⬃75% (28). Further work is necessary to determine the complete characterization of mitochondrial Ca2⫹ uptake pathways. In summary, our results demonstrate that loss of LETM1 promotes mROS production, a decline in ATP levels, and bioenergetic collapse. LETM1-dependent ATP loss and oxidative stress trigger autophagy and halt cell proliferation. The authors thank Drs. Donald L. Gill and Walter J. Koch for their comments on the manuscript. The authors thank Maggie Cheung and Karthik Mallilamkaraman for their cell culture work. This work was supported by the U.S. National Institutes of Health (R01HL-086699, R01HL-119306 and 1S10RR-027327-01 to M.M).

REFERENCES 1.

Hirschhorn, K., Cooper, H. L., and Firschein, I. L. (1965) Deletion of short arms of chromosome 4 –5 in a child with defects of midline fusion. Humangenetik 1, 479 –482 2. Endele, S., Fuhry, M., Pak, S. J., Zabel, B. U., and Winterpacht, A. (1999) LETM1, a novel gene encoding a putative EF-hand Ca2⫹-binding protein, flanks the Wolf-Hirschhorn syndrome (WHS) critical region and is deleted in most WHS patients. Genomics 60, 218 –225 3. Schlickum, S., Moghekar, A., Simpson, J. C., Steglich, C., O’Brien, R. J., Winterpacht, A., and Endele, S. U. (2004) LETM1, a gene deleted in Wolf-Hirschhorn syndrome, encodes an evolutionarily conserved mitochondrial protein. Genomics 83, 254 –261

The FASEB Journal 䡠 www.fasebj.org

DOONAN ET AL.

4.

5. 6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17. 18.

19.

Baughman, J. M., Perocchi, F., Girgis, H. S., Plovanich, M., Belcher-Timme, C. A., Sancak, Y., Bao, X. R., Strittmatter, L., Goldberger, O., Bogorad, R. L., Koteliansky, V., and Mootha, V. K. (2011) Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter. Nature 476, 341–345 De Stefani, D., Raffaello, A., Teardo, E., Szabo, I., and Rizzuto, R. (2011) A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter. Nature 476, 336 –340 Perocchi, F., Gohil, V. M., Girgis, H. S., Bao, X. R., McCombs, J. E., Palmer, A. E., and Mootha, V. K. (2010) MICU1 encodes a mitochondrial EF hand protein required for Ca2⫹ uptake. Nature 467, 291–296 Mallilankaraman, K., Doonan, P., Cardenas, C., Chandramoorthy, H. C., Muller, M., Miller, R., Hoffman, N. E., Gandhirajan, R. K., Molgo, J., Birnbaum, M. J., Rothberg, B. S., Mak, D. O., Foskett, J. K., and Madesh, M. (2012) MICU1 is an essential gatekeeper for MCU-mediated mitochondrial Ca2⫹ uptake that regulates cell survival. Cell 151, 630 –644 Mallilankaraman, K., Cardenas, C., Doonan, P. J., Chandramoorthy, H. C., Irrinki, K. M., Golenar, T., Csordas, G., Madireddi, P., Yang, J., Muller, M., Miller, R., Kolesar, J. E., Molgo, J., Kaufman, B., Hajnoczky, G., Foskett, J. K., and Madesh, M. (2012) MCUR1 is an essential component of mitochondrial Ca2⫹ uptake that regulates cellular metabolism. Nat. Cell Biol. 15, 123 Plovanich, M., Bogorad, R. L., Sancak, Y., Kamer, K. J., Strittmatter, L., Li, A. A., Girgis, H. S., Kuchimanchi, S., De Groot, J., Speciner, L., Taneja, N., Oshea, J., Koteliansky, V., and Mootha, V. K. (2013) MICU2, a paralog of MICU1, resides within the mitochondrial uniporter complex to regulate calcium handling. PLoS One 8, e55785 Raffaello, A., De Stefani, D., Sabbadin, D., Teardo, E., Merli, G., Picard, A., Checchetto, V., Moro, S., Szabo, I., and Rizzuto, R. (2013) The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit. EMBO J. 32, 2362–2376 Sancak, Y., Markhard, A. L., Kitami, T., Kovacs-Bogdan, E., Kamer, K. J., Udeshi, N. D., Carr, S. A., Chaudhuri, D., Clapham, D. E., Li, A. A., Calvo, S. E., Goldberger, O., and Mootha, V. K. (2013) EMRE is an essential component of the mitochondrial calcium uniporter complex. Science 342, 1379 –1382 Palty, R., Silverman, W. F., Hershfinkel, M., Caporale, T., Sensi, S. L., Parnis, J., Nolte, C., Fishman, D., Shoshan-Barmatz, V., Herrmann, S., Khananshvili, D., and Sekler, I. (2010) NCLX is an essential component of mitochondrial Na⫹/Ca2⫹ exchange. Proc. Natl. Acad. Sci. U. S. A. 107, 436 –441 Hoffman, N. E., Chandramoorthy, H. C., Shanmughapriya, S., Zhang, X. Q., Vallem, S., Doonan, P. J., Malliankaraman, K., Guo, S., Rajan, S., Elrod, J. W., Koch, W. J., Cheung, J. Y., and Madesh, M. (2014) SLC25A23 augments mitochondrial Ca2⫹ uptake, interacts with MCU, and induces oxidative stress-mediated cell death. Mol. Biol. Cell 25, 936 –947 Baines, C. P., Kaiser, R. A., Purcell, N. H., Blair, N. S., Osinska, H., Hambleton, M. A., Brunskill, E. W., Sayen, M. R., Gottlieb, R. A., Dorn, G. W., Robbins, J., and Molkentin, J. D. (2005) Loss of cyclophilin D reveals a critical role for mitochondrial permeability transition in cell death. Nature 434, 658 –662 Nakagawa, T., Shimizu, S., Watanabe, T., Yamaguchi, O., Otsu, K., Yamagata, H., Inohara, H., Kubo, T., and Tsujimoto, Y. (2005) Cyclophilin D-dependent mitochondrial permeability transition regulates some necrotic but not apoptotic cell death. Nature 434, 652–658 Halestrap, A. P., Connern, C. P., Griffiths, E. J., and Kerr, P. M. (1997) Cyclosporin A binding to mitochondrial cyclophilin inhibits the permeability transition pore and protects hearts from ischaemia/reperfusion injury. Mol. Cell. Biochem. 174, 167–172 Halestrap, A. (2005) Biochemistry: a pore way to die. Nature 434, 578 –579 Basso, E., Fante, L., Fowlkes, J., Petronilli, V., Forte, M. A., and Bernardi, P. (2005) Properties of the permeability transition pore in mitochondria devoid of cyclophilin D. J. Biol. Chem. 280, 18558 –18561 Baines, C. P. (2010) The cardiac mitochondrion: nexus of stress. Annu. Rev. Physiol. 72, 61–80

LETM1-MEDIATED CA2⫹ FLUX AND CELLULAR BIOENERGETICS

20. 21. 22.

23.

24.

25. 26.

27.

28.

29.

30.

31.

32. 33. 34.

35.

36.

Jiang, D., Zhao, L., and Clapham, D. E. (2009) Genome-wide RNAi screen identifies Letm1 as a mitochondrial Ca2⫹/H⫹ antiporter. Science 326, 144 –147 Tsai, M. F., Jiang, D., Zhao, L., Clapham, D., and Miller, C. (2014) Functional reconstitution of the mitochondrial Ca2⫹/H⫹ antiporter Letm1. J. Gen. Physiol. 143, 67–73 Nowikovsky, K., Froschauer, E. M., Zsurka, G., Samaj, J., Reipert, S., Kolisek, M., Wiesenberger, G., and Schweyen, R. J. (2004) The LETM1/YOL027 gene family encodes a factor of the mitochondrial K⫹ homeostasis with a potential role in the Wolf-Hirschhorn syndrome. J. Biol. Chem. 279, 30307–30315 McQuibban, A. G., Joza, N., Megighian, A., Scorzeto, M., Zanini, D., Reipert, S., Richter, C., Schweyen, R. J., and Nowikovsky, K. (2010) A Drosophila mutant of LETM1, a candidate gene for seizures in Wolf-Hirschhorn syndrome. Hum. Mol. Genet. 19, 987–1000 Jiang, D., Zhao, L., Clish, C. B., and Clapham, D. E. (2013) Letm1, the mitochondrial Ca2⫹/H⫹ antiporter, is essential for normal glucose metabolism and alters brain function in WolfHirschhorn syndrome. Proc. Natl. Acad. Sci. U. S. A. 110, E2249 – E2254 Hanley-Lopez, J., Estabrooks, L. L., and Stiehm, R. (1998) Antibody deficiency in Wolf-Hirschhorn syndrome. J. Pediatr. 133, 141–143 Vagnozzi, R. J., Gatto, G. J., Jr., Kallander, L. S., Hoffman, N. E., Mallilankaraman, K., Ballard, V. L., Lawhorn, B. G., Stoy, P., Philp, J., Graves, A. P., Naito, Y., Lepore, J. J., Gao, E., Madesh, M., and Force, T. (2013) Inhibition of the cardiomyocytespecific kinase TNNI3K limits oxidative stress, injury, and adverse remodeling in the ischemic heart. Sci. Transl. Med. 5, 207ra141 Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., and Trono, D. (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272, 263–267 Hoffman, N. E., Chandramoorthy, H. C., Shamugapriya, S., Zhang, X., Rajan, S., Mallilankaraman, K., Gandhirajan, R. K., Vagnozzi, R. J., Ferrer, L. M., Sreekrishnanilayam, K., Natarajaseenivasan, K., Vallem, S., Force, T., Choi, E. T., Cheung, J. Y., and Madesh, M. (2013) MICU1 motifs define mitochondrial calcium uniporter binding and activity. Cell Rep. 5, 1576 –1588 Madesh, M., Hawkins, B. J., Milovanova, T., Bhanumathy, C. D., Joseph, S. K., Ramachandrarao, S. P., Sharma, K., Kurosaki, T., and Fisher, A. B. (2005) Selective role for superoxide in InsP3 receptor-mediated mitochondrial dysfunction and endothelial apoptosis. J. Cell Biol. 170, 1079 –1090 Madesh, M., Zong, W. X., Hawkins, B. J., Ramasamy, S., Venkatachalam, T., Mukhopadhyay, P., Doonan, P. J., Irrinki, K. M., Rajesh, M., Pacher, P., and Thompson, C. B. (2009) Execution of superoxide-induced cell death by the proapoptotic Bcl-2related proteins Bid and Bak. Mol. Cell. Biol. 29, 3099 –3112 Hoffman, N. E., Chandramoorthy, H. C., Shanmughapriya, S., Zhang, X. Q., Vallem, S., Doonan, P. J., Malliankaraman, K., Guo, S., Rajan, S., Elrod, J. W., Koch, W. J., Cheung, J. Y., and Madesh, M. (2014) SLC25A23 augments mitochondrial Ca2⫹ uptake, interacts with MCU, and induces oxidative stress-mediated cell death. Mol. Biol. Cell 25, 936 –947 Kirichok, Y., Krapivinsky, G., and Clapham, D. E. (2004) The mitochondrial calcium uniporter is a highly selective ion channel. Nature 427, 360 –364 Fieni, F., Lee, S. B., Jan, Y. N., and Kirichok, Y. (2012) Activity of the mitochondrial calcium uniporter varies greatly between tissues. Nat. Commun. 3, 1317 Joiner, M. L., Koval, O. M., Li, J., He, B. J., Allamargot, C., Gao, Z., Luczak, E. D., Hall, D. D., Fink, B. D., Chen, B., Yang, J., Moore, S. A., Scholz, T. D., Strack, S., Mohler, P. J., Sivitz, W. I., Song, L. S., and Anderson, M. E. (2012) CaMKII determines mitochondrial stress responses in heart. Nature 491, 269 –273 Mallilankaraman, K., Cardenas, C., Doonan, P. J., Chandramoorthy, H. C., Irrinki, K. M., Golenar, T., Csordas, G., Madireddi, P., Yang, J., Muller, M., Miller, R., Kolesar, J. E., Molgo, J., Kaufman, B., Hajnoczky, G., Foskett, J. K., and Madesh, M. (2012) MCUR1 is an essential component of mitochondrial Ca2⫹ uptake that regulates cellular metabolism. Nat. Cell Biol. 14, 1336 –1343 Miller, B. A., Hoffman, N. E., Merali, S., Zhang, X. Q., Wang, J., Rajan, S., Shanmughapriya, S., Gao, E., Barrero, C. A., Mallilan-

13

37.

38.

39.

40.

41.

42.

43.

44.

14

karaman, K., Song, J., Gu, T., Hirschler-Laszkiewicz, I., Koch, W. J., Feldman, A. M., Madesh, M., and Cheung, J. Y. (2014) TRPM2 channels protect against cardiac ischemia-reperfusion injury: role of mitochondria. J. Biol. Chem. 289, 7615–7629 Hawkins, B. J., Levin, M. D., Doonan, P. J., Petrenko, N. B., Davis, C. W., Patel, V. V., and Madesh, M. (2010) Mitochondrial complex II prevents hypoxic but not calcium- and proapoptotic Bcl-2 protein-induced mitochondrial membrane potential loss. J. Biol. Chem. 285, 26494 –26505 Irrinki, K. M., Mallilankaraman, K., Thapa, R. J., Chandramoorthy, H. C., Smith, F. J., Jog, N. R., Gandhirajan, R. K., Kelsen, S. G., Houser, S. R., May, M. J., Balachandran, S., and Madesh, M. (2011) Requirement of FADD, NEMO, and BAX/BAK for aberrant mitochondrial function in tumor necrosis factor alphainduced necrosis. Mol. Cell. Biol. 31, 3745–3758 Hawkins, B. J., Madesh, M., Kirkpatrick, C. J., and Fisher, A. B. (2007) Superoxide flux in endothelial cells via the chloride channel-3 mediates intracellular signaling. Mol. Biol. Cell 18, 2002–2012 Jones, R. G., Bui, T., White, C., Madesh, M., Krawczyk, C. M., Lindsten, T., Hawkins, B. J., Kubek, S., Frauwirth, K. A., Wang, Y. L., Conway, S. J., Roderick, H. L., Bootman, M. D., Shen, H., Foskett, J. K., and Thompson, C. B. (2007) The proapoptotic factors Bax and Bak regulate T-cell proliferation through control of endoplasmic reticulum Ca2⫹ homeostasis. Immunity 27, 268 –280 White, C., Li, C., Yang, J., Petrenko, N. B., Madesh, M., Thompson, C. B., and Foskett, J. K. (2005) The endoplasmic reticulum gateway to apoptosis by Bcl-X(L) modulation of the InsP3R. Nat. Cell Biol. 7, 1021–1028 Madesh, M., Antonsson, B., Srinivasula, S. M., Alnemri, E. S., and Hajnoczky, G. (2002) Rapid kinetics of tBid-induced cytochrome c and Smac/DIABLO release and mitochondrial depolarization. J. Biol. Chem. 277, 5651–5659 Madesh, M., and Hajnoczky, G. (2001) VDAC-dependent permeabilization of the outer mitochondrial membrane by superoxide induces rapid and massive cytochrome c release. J. Cell Biol. 155, 1003–1015 Waldeck-Weiermair, M., Jean-Quartier, C., Rost, R., Khan, M. J., Vishnu, N., Bondarenko, A. I., Imamura, H., Malli, R., and Graier, W. F. (2011) Leucine zipper EF hand-containing transmembrane protein 1 (Letm1) and uncoupling proteins 2 and 3

Vol. 28

0 2014

45.

46. 47.

48.

49.

50. 51.

52.

53.

(UCP2/3) contribute to two distinct mitochondrial Ca2⫹ uptake pathways. J. Biol. Chem. 286, 28444 –28455 Nowikovsky, K., Pozzan, T., Rizzuto, R., Scorrano, L., and Bernardi, P. (2012) Perspectives on SGP symposium on mitochondrial physiology and medicine: the pathophysiology of LETM1. J. Gen. Physiol. 139, 445–454 Hamanaka, R. B., and Chandel, N. S. (2010) Mitochondrial reactive oxygen species regulate cellular signaling and dictate biological outcomes. Trends Biochem. Sci. 35, 505–513 Cardenas, C., Miller, R. A., Smith, I., Bui, T., Molgo, J., Muller, M., Vais, H., Cheung, K. H., Yang, J., Parker, I., Thompson, C. B., Birnbaum, M. J., Hallows, K. R., and Foskett, J. K. (2010) Essential regulation of cell bioenergetics by constitutive InsP3 receptor Ca2⫹ transfer to mitochondria. Cell 142, 270 –283 Pan, X., Liu, J., Nguyen, T., Liu, C., Sun, J., Teng, Y., Fergusson, M. M., Rovira, I. I., Allen, M., Springer, D. A., Aponte, A. M., Gucek, M., Balaban, R. S., Murphy, E., and Finkel, T. (2013) The physiological role of mitochondrial calcium revealed by mice lacking the mitochondrial calcium uniporter. Nat. Cell Biol. 15, 1464 –1472 Dimmer, K. S., Navoni, F., Casarin, A., Trevisson, E., Endele, S., Winterpacht, A., Salviati, L., and Scorrano, L. (2008) LETM1, deleted in Wolf-Hirschhorn syndrome is required for normal mitochondrial morphology and cellular viability. Hum. Mol. Genet. 17, 201–214 Santo-Domingo, J., and Demaurex, N. (2012) Perspectives on SGP symposium on mitochondrial physiology and medicine: the renaissance of mitochondrial pH. J. Gen. Physiol. 139, 415–423 Sheu, S. S., Dirksen, R. T., and Pugh, E. N., Jr. (2012) Perspectives on SGP symposium on mitochondrial physiology and medicine: mitochondria take center stage. J. Gen. Physiol. 139, 391–393 Tamai, S., Iida, H., Yokota, S., Sayano, T., Kiguchiya, S., Ishihara, N., Hayashi, J., Mihara, K., and Oka, T. (2008) Characterization of the mitochondrial protein LETM1, which maintains the mitochondrial tubular shapes and interacts with the AAAATPase BCS1L. J. Cell Sci. 121, 2588 –2600 Hardie, D. G. (2011) AMP-activated protein kinase: an energy sensor that regulates all aspects of cell function. Genes Dev. 25, 1895–1908

The FASEB Journal 䡠 www.fasebj.org

Received for publication May 27, 2014. Accepted for publication July 21, 2014.

DOONAN ET AL.