CSIRO PUBLISHING

Reproduction, Fertility and Development, 2016, 28, 682–689 http://dx.doi.org/10.1071/RD14301

Leukotriene production profiles and actions in the bovine endometrium during the oestrous cycle Anna J. Korzekwa A,C, Robert Milewski B, Martyna Łupicka A and Dariusz J. Skarzynski A A

Department of Reproductive Immunology and Pathology of the Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Tuwima 10 St., 10-747 Olsztyn, Poland. B Department of Statistics and Medical Informatics, Medical University of Bialystok, Szpitalna 37 St., 15-295 Bialystok, Poland. C Corresponding author. Email: [email protected]

Abstract. We have previously shown the influence of leukotrienes (LTs) on reproductive functions in vivo: LTB4 is luteotrophic and supports corpus luteum function inducing PGE2 and progesterone (P4) secretion, whereas LTC4 is luteolytic and stimulates PGF2a secretion in cattle. The aim of this study was to examine expression and production profiles of LTs and their actions in the endometrium. LT receptors (LTB4R for LTB4 and CysLTR2 for LTC4), 5-lipoxygenase (LO), 12-LO synthase (LTCS) and LTA4 hydrolase (LTAH) mRNA and protein expression, as well as LT production were measured in bovine endometrial tissue during the luteal phases of the oestrous cycle. The action of LTs on uterine function was studied by measuring the level of PGs after stimulating uterine slices with LTs on Days 8–10 of the cycle. Expression of 5-LO and LTB4R mRNA and protein were highest on Days 2–4 of the cycle, while CysLTR2 and LTCS were highest on Days 16–18 (P , 0.05). LTB4 concentration was highest on Days 2–4 of the cycle, whereas the greatest LTC4 level was on Days 16–18 (P , 0.05). Both LTB4 and C4 increased the content of PGE2 and F2a in endometrial slices at a dose of 107 M (P , 0.05). In summary, mRNA expression and activation of receptors for LTB4 and production occur in the first part of the cycle, whereas LTC4 and its receptors predominate at the end of the cycle. The 12-LO and 5-LO pathways are complementary routes of LT production in the bovine uterus. Additional keywords: arachidonic acid, cow, reproduction, uterus. Received 17 August 2014, accepted 10 September 2014, published online 13 November 2014

Introduction During the oestrous cycle the bovine endometrium exhibits characteristic morphological and functional changes. Production of prostaglandins (PG) by the endometrium and their influence on progesterone (P4) synthesis is the main mechanism responsible for the cyclic changes during the oestrous cycle in cattle (McCracken et al. 1999; Weems et al. 2006). Nevertheless, as well as PGs, leukotrienes (LTs) and lipoxins are synthesised from arachidonic acid (AA) in the female reproductive tract (Milvae et al. 1986; Blair et al. 1997; Ku¨hn and O’Donnell 2006). Lipoxygenases (5-LO, 12/15-LO) are enzymes that convert AA to LTs. These eicosanoids have roles in inflammation and are involved in the pathogenesis of asthma (Samuelsson 2000; Murphy and Gijo´n 2007). Two receptors for LTB4 have been molecularly identified (Tager and Luster 2003) and CysLTR1 and CysLTR2 for LTC4 (Jones and Rodger 1999; Izumi et al. 2002). LTA4 is synthesised from AA, which is further converted to LTB4 by LTA4 hydrolase (LTAH) or to LTC4 by LTC4 synthase (LTCS; Izumi et al. 2002). Journal compilation Ó CSIRO 2016

Leukotrienes were found to be auto- and paracrine factors that differentially modulate the secretory functions of ovarian cells depending on the stage of the cycle and type of LTs (Milvae et al. 1986; Korzekwa et al. 2010b, 2010c). Leukotriene B4 seems to play a luteotrophic role in the corpus luteum (CL), stimulating secretion of P4 and PGE2, whereas LTC4 stimulates secretion of luteolytic PGF2a and may enhance the luteolytic cascade within bovine CL (Korzekwa et al. 2010a, 2010b). Intraluteal infusion of PGF2a by a microdialysis system (MDS) on Day 12 of the oestrous cycle increased the levels of both LTB4 and C4 in CL perfusates (Blair et al. 1997). However, while LTs certainly have a role in CL function, there is a lack of knowledge about their role in bovine endometrial function. We showed that infusion of LT antagonists into the aorta abdominalis caused changes in PG and P4 concentrations in peripheral blood during 24 h of experiment (Korzekwa et al. 2010a). Moreover, the blockade of LT production by antagonists of LT action in the reproductive tract that caused the changes in hormone secretion (PGF2a, PGE2, P4) resulted in elongation of the luteal phase of the cycle or earlier luteolysis www.publish.csiro.au/journals/rfd

Leukotriene action in bovine uterus

Reproduction, Fertility and Development

(Korzekwa et al. 2010a). Thus, potentially this action is not limited only to ovarian hormones but may also influence hormone production and secretion in the endometrium. The mRNA for 5-LO and LT receptors are expressed in different ovarian cell types: steroidogenic and endothelial CL cells and granulosa cells (Korzekwa et al. 2010b). However, there is no data on the direct action of LT in bovine endometrium. Thus, our main hypothesis was that LT action is not limited to the ovary, as we have shown previously (Korzekwa et al. 2010a, 2010b, 2010c) but that LTs could also be produced in the uterus and participate in the regulation of endometrial function. In this study we examined LT action in the bovine endometrium. Therefore, during the luteal phases of the oestrous cycle we determined the following: (1) capacity of the endometrium to produce LTs, based on mRNA and protein expression profiles, (2) the receptor mechanism of LT action in the uterus, (3) concentrations of LTs in uterine tissue and (4) the direct effect of LT on uterine secretory function. Materials and methods The Local Animal Care and Use Committee (Olsztyn, Poland) approved all procedures (Agreement No. 58/2005/N). Uterine tissues (middle segments of the uterus, ipsilateral to the active corpus luteum) were collected post-mortem and blood samples were taken just before slaughter from Holstein Polish Black and White dairy cows (75% and 25%, respectively; n ¼ 15; between 100 and 150 days postpartum at the Meat Processing Plant ‘Warmia’, Biskupiec, Poland). Owners culled the animals from their herds (Experimental Animal Farm of Polish Academy of Sciences in Baranowo and Agriculture Farm in Cieszymowo, Poland) because of low milk production. An analogue of PGF2a (Dinoprost, Dinolytic; Upjohn – Pharmacia N.V.SA, Puurs, Belgium) was injected twice with an 11-day interval for oestrus synchronisation in the cows, according to the vendor’s recommendation. Before slaughter, each animal was examined by a veterinarian via transrectal ultrasound examination using a Draminski Animalprofi Scanner (Draminski Electronics in

Agriculture, Olsztyn, Poland) and oestrus was confirmed by observing external signs (i.e. vaginal mucus, standing behaviour). Day 0 of the oestrous cycle was considered as the moment of oestrus recognition. The cows with evident signs of oestrus were selected for the study. The uterine tissue was removed within 20 min of exsanguination. Tissue samples were collected on Days 2–4 (n ¼ 5), 8–10 (n ¼ 5) and 16–18 (n ¼ 5) of the oestrous cycle and stored on ice or in liquid nitrogen until brought to the laboratory and then kept at 808C until analysis. First estimation of the oestrous cycle stages was confirmed by macroscopic observation of the ovaries and uteri after slaughter (Miyamoto et al. 2000) and by measurement of P4 concentration in peripheral blood samples collected from each cow. Experimental procedures Production of LTs in the endometrium: mRNA and protein expression The aim of the study was to compare changes in LT synthesis and production in the bovine endometrium during the oestrous cycle. Expression of mRNA was quantitatively measured in the bovine endometrium by real-time reverse transcription polymerase chain reaction (RT-PCR) for 5-LO, 12-LO, LT receptors (LTB4R for LTB4 and CysLTR1 and CysLTR2 for cysteinyl LTs), LTA4 hydrolase (LTAH) and LTC4 synthase (LTCS). The primers used are detailed in Table 1. Another section of endometrial tissue was assigned for western blot analysis of 5-LO, LT receptors (LTB4R, CysLTR2), LTAH and LTCS. Concentration of LTs during the oestrous cycle The aim of the study was to compare changes in the secretion and production of LT in the bovine endometrium during the oestrous cycle. The levels of LTB4 and C4 in the tissue after extraction were determined by direct enzyme immunoassay (EIA).

Table 1. Sequences of primers used for real-time PCR Gene name

Primer sequence

5-LO

F: CAC AGA CGC AAA GAA CTG GA R: CAG ATT GTC TGG CAG CTT CA F: AACTAGGCCTGGTGGAAA R: CTCACTCGGCCCTCACTTTG F: TTG GAT ATT TGG GGA CCT GA R: CTG ACG CTA GTG GCA TGA AG F: CCG CTG CCT TTT TAG TCA GT R: ATG CAG CCA GAG ACA AGG TT F: GCCCAGCCACATAGAGAACA R: ACACGACTGAGGGACTGAAC F: CCCTAAAGAACTGGTGGCACT R: GACTTTTCCACCTGCTCTTTC F: CCTGCTGCAAGCCTACTTCT R: GTTCACTTGGGCTCGGTAGA F: CAC CCT CAA GAT TGT CAG CA R: GGT CAT AAG TCC CTC CAC GA

LTB4R CysLTR1 CysLTR2 12-LO LTA4H LTC4S GAPDH

683

Product size (bp) 240 175 358 328 133 240 137 103

GenBank/References AJ306424 Korzekwa et al. 2010a D89078.1 NM006639 Korzekwa et al. 2010a XM593703 Korzekwa et al. 2010a NM_001192336.1 NM00103428 Korzekwa et al. 2011 NM001046098 Korzekwa et al. 2011 BC102589 Korzekwa et al. 2010a

684

Reproduction, Fertility and Development

Effect of LTs on prostaglandin secretion by bovine endometrium The aim of the study was to determine the direct effect of LT on uterine secretory function. The phase of the oestrous cycle (Days 8–10 of the cycle) was determined based on the highest level of P4 measured in the blood. The mid-luteal stage was selected for our experiment because on these days the switch between mid-stage CL and pregnant CL takes place in the case of successful fertilisation (Cerri et al. 2011, 2012). Beside, our earlier study showed that LTs influence peripheral PG production in the mid-luteal stage (Korzekwa et al. 2010a). The levels of PGE2 and PGF2a in the culture medium after 24 h of incubating endometrial tissue explants with LTB4 (106 M and 107 M) or C4 (106 M and 107 M) were measured by EIA. Total RNA isolation and cDNA synthesis TRIZOL reagent was used for total RNA extraction from endometrium of uteri according to the manufacturer’s instructions. For RT-PCR, the SuperScript First-Strand Synthesis System (Life Technologies, Warsaw, Poland) was used with one microgram of total RNA sample, as described in the supplier’s protocol. The cDNA was stored at 208C until real-time PCR was carried out. Real-time PCR quantification Quantitative fluorescence real-time PCR was performed using the Applied Biosystems 7300 System (Foster City, CA, USA) with a SYBR Green PCR master mix (Applied Biosystems) following the manufacturer’s instructions. Each sample for real-time PCR included 12.5 mL SYBR Green PCR Master Mix, 1 mL reverse-transcribed cDNA and 0.5 mM each forward and reverse primer in a toal volume of 25 mL. All primers for mRNA expression are detailed in Table 1. Amplification was preceded by an initial denaturation step (15 min at 958C). The PCR programs for each gene were performed as follows: 40 cycles of denaturation (15 s at 958C), annealing (30 s at 568C) and elongation (60 s at 728C). Serial dilutions of the appropriate purified cDNA were plotted for quantification of standard curves. After PCR, a melting curve was acquired by increases at a temperature of 50–958C and analysed to ensure that a single product was amplified in the reaction. The specificity of PCR products for the genes examined was confirmed by sequencing and the sequence homology obtained in the experiment was 97–99%. The DDCT method was used for data normalisation. Data are shown as the average n-fold increase, with standard error (s.e.m.). Messenger RNA expression was analysed relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene, which was expressed at a similar level (CT values) for all genes examined and at all stages of the oestrous cycle. Samples were run in triplicate. Western blotting analyses Equal amounts (60 mg) of protein were dissolved in sodium dodecyl sulfate (SDS) gel-loading buffer (50 mM TRIS-HCl, pH 6.8; 4% SDS, 20% glycerol and 2% b-mercaptoethanol), heated to 958C for 4 min and separated on a 10% polyacrylamide gel for GAPDH, 5-LO, LTB4R, CysLTR2, LTAH and LTCS. Separated proteins were electroblotted onto 0.2-mm nitrocellulose membrane in transfer buffer (20 mM TRIS-HCl buffer, pH

A. J. Korzekwa et al.

8.2; 150 mM glycine, 20% methanol). After blocking in 5% nonfat dry milk in Tris-buffered saline buffer containing 0.1% Tween-20 (TBS-T) for 1.5 h at 25.68C, the membranes were incubated overnight with antibodies to 5-LO (160402, 1 : 1000; CaymanChem, Tallinn, Estonia), LTB4R (sc-20128, 1 : 1000; Santa Cruz Biotechnology, Heidelberg, Germany), CysLTR2 (sc-98864, 1 : 200; Santa Cruz Biotechnology), LTAH (160250, 1 : 500; CaymanChem) and LTCS (sc-22566, 1 : 200; Santa Cruz Biotechnology). Protein expression of GAPDH (Sigma, Poznan´, Poland) was used as a reference. Subsequently, proteins were detected by incubating the membrane with 1 : 20 000 dilution of secondary polyclonal anti-rabbit or anti-goat alkaline phosphatase-conjugated antibodies (A 3687, A 3562; Sigma) for 1.5 h at 25.68C. Molecular weight marker was used for determination of detected proteins (Precision Plus Protein All Blue Standards; Bio Rad, Warsaw, Poland). Bovine lung tissue was used as the positive control for each determined factor (Singh et al. 2010). Immune complexes were observed using the standard alkaline phosphatase visualisation procedure. Western blots were quantitated using Kodak 1D program (Eastman Kodak, Rochester, NY, USA). Extraction of hormones from uteri Extraction of LTs from endometrial tissue was performed according to the method described previously (Korzekwa et al. 2008). Hormone determination Measurements of P4 in plasma were performed using EIA as described previously (Skarzynski et al. 2003). The antibodies (anti-P4, SO/91/4; kindly donated by Dr S. Okrasa, WarmiaMazury University, Olsztyn, Poland) were characterised previously (Ciereszko et al. 2001). The standard curve ranged from 0.39 to 100 ng mL1 and the effective dose for 50% inhibition (ID50) of the assay was 4.5 ng mL1. The intra- and inter-assay coefficients of variation (CV) were 5.5% and 8.5%, respectively. The concentrations of LTB4 and C4 in endometrial tissue were determined using commercially available EIA kits (Leukotriene C4 EIA Kit, Leukotriene B4 EIA Kit; Cayman, Tallin, Estonia) according to Korzekwa et al. (2010c). The LTB4 standard curve ranged from 1.96 pg mL1 to 1000 pg mL1 and the ID50 of the assay was 2.5 pg mL1. The intra- and inter-assay coefficients of variation were on average 4.1% and 6.2%, respectively. The LTC4 standard curve ranged from 0.98 pg mL1 to 500 pg mL1; the ID50 of the assay was 1.85 pg mL1 and the intra- and interassay CV were on average 4.9% and 7.4%, respectively. The concentration of PGE2 in conditioned medium was determined using the Prostaglandin E2 EIA kit (Cayman) according to the manufacturer’s instructions. The concentration of PGF2a was determined using the direct EIA method as described previously by Uenoyama et al. (1997) with modification. The PGE2 standard curve ranged from 0.39 ng mL1 to 100 ng mL1 and the concentration of 50% binding (ED50) was 0.56 ng mL1. The intra- and inter-assay coefficients of variation were 1.6% and 11.0%, respectively. The PGF2a standard curve ranged from 0.09 ng mL1 to 25 ng mL1; the ED50 was 0.15 ng mL1 and the intra- and inter-assay coefficients of variation were on average 7.1% and 11.3%, respectively.

Leukotriene action in bovine uterus

Reproduction, Fertility and Development

Results Production of LTs in the endometrium: mRNA and protein expression The highest level of 12-LO mRNA expression occurred on Days 8–10 of the oestrous cycle and the lowest expression on Days 2–4 of the cycle (Fig. 1a; P , 0.05).

20.52 6

19.9 b

20.3

GAPDH Ct

5 4 c

3 2 1

a

0

4

20.12

20.14

GAPDH Ct

a

3 2

b b

1 0

(e)

mRNA expression Ltah/gapdh (arbitrary units)

21.12

21.19

20.9

GAPDH Ct

3 a 2 a a 1

0

(d )

20.0

20.5

20.9

21.0

3

2 a a 1

a

0 2–4

8–10

Days of estrous cycle

16–18

GAPDH Ct

mRNA expression CysLTR2/gapdh (arbitrary units)

mRNA expression LTB4R/gapdh (arbitrary units)

(c)

(b)

20.0

20.12

20.41

GAPDH Ct

6 b

4 a a 2

0

(f )

mRNA expression Ltcs/gapdh (arbitrary units)

mRNA expression 12-LO/gapdh (arbitrary units)

(a)

Expression of mRNA for 5-LO (Fig. 1b) and LTB4R (Fig. 1c) were upregulated on Days 2–4 of the oestrous cycle (P , 0.05), whereas CysLTR2 (Fig. 1d) mRNA expression was the highest on Days 16–18 (P , 0.05). LTAH mRNA expression was unchanged during the oestrous cycle (Fig. 1e; P , 0.05). LTCS mRNA expression was upregulated on Days 8–10 and 16–18 of the cycle (Fig. 1f; P . 0.05). CysLTR1 mRNA expression was below the level of detection by real-time PCR in all analysed samples (data not shown). Protein expression for 5-LO, LTB4R and LTAH was higher on Days 2–4 of the oestrous cycle compared with expression on Days 8–10 and 16–18 (P , 0.05; Fig. 2a, b, d ). In contrast, CysLTR2 and LTCS protein expression were highest on Days 16–18 of the cycle (P , 0.05; Fig. 2c, e). Because CysLTR1 mRNA expression was low, studies on its protein expression were not pursued. Exemplary blots are shown in Fig. 3. mRNA expression 5-LO/gapdh (arbitrary units)

Statistical analysis Data are shown as the mean  s.e.m. of values obtained in separate experiments, each performed in triplicate. Statistical analyses of mRNA, protein expression and LT secretion and the influence of LT on PG secretion by endometrial explants were determined by nonparametric one-way ANOVA Kruskal– Wallis followed by Bonferroni’s post-hoc test (GraphPad Software Version 5; San Diego, CA, USA).

685

3

20.9

21.0

21.2

GAPDH Ct

b 2

1

b

a

0 2–4

8–10

16–18

Days of estrous cycle

Fig. 1. Pattern of mRNA expression for (a) 12-LO, (b) 5-LO, (c) LTB4R, (d ) CysLTR2, (e) LTAH and ( f ) LTCS on selected days of the oestrous cycle in bovine endometrial tissue. Data are expressed as arbitrary units normalised against GAPDH mRNA expression. Small letters (a, b and c) indicate statistical differences in mRNA quantitative expression between groups of animals on the same days of the oestrous cycle (P , 0.05). Upper panel indicates Ct for GAPDH mRNA expression.

Reproduction, Fertility and Development

A. J. Korzekwa et al.

Protein expression 5-LO/gapdh (arbitrary units)

(a)

(b) 3

2

a

b

b 1

0

Protein expression Ltcs/gapdh (arbitrary units)

(e)

5 a 4 3 2 b

b

1 0

(d ) Protein expression Ltah/gapdh (arbitrary units)

Protein expression CysLTR2/gapdh (arbitrary units)

(c)

Protein expression LTB4R/gapdh (arbitrary units)

686

3 b 2 ab a

1

0

3

a 2 b 1 c

0 2–4

8–10

16–18

Days of estrous cycle 6 b 4 a 2 a

0 2–4

8–10

16–18

Days of estrous cycle Fig. 2. Pattern of protein expression for (a) 5-LO, (b) LTB4R, (c) CysLTR2, (d ) LTAH and (e) LTCS on selected days of the oestrous cycle in bovine endometrial tissue. Data are expressed as arbitrary units normalised against GAPDH protein expression. Small letters (a, b and c) indicate statistical differences in protein quantitative expression between groups of animals on the same days of the oestrous cycle (P , 0.05).

Concentration of LTs during the oestrous cycle LTB4 concentration increased in the endometrial tissue on Days 2–4, whereas LTC4 concentration was highest on Days 16–18 of the cycle (P , 0.05; Fig. 4a, b). Effect of LT on prostaglandin secretion in bovine endometrium Leukotriene B4 increased the content of PGE2 from endometrial slices at doses of 106 and 107 M and increased PGF2a at a dose of 107 M (P , 0.05). Leukotriene C4 increased the content of PGE2 and PGF2a in endometrial slices at a dose of 107 M (P , 0.05; Fig. 5a, b).

Discussion In the present study, we found that LTs are produced and released in the bovine endometrium during the oestrous cycle, where they modulate the secretion of PGs. Our results revealed that both LTs stimulate PG secretion in endometrium in the mid-luteal stage. Leukotrienes are commonly known as proinflammatory factors and the increase of their secretion in the endometrium of cows with clinical endometritis has been described by Baran´ski et al. (2013). Besides, LTB4 promotes uterine involution and reduces the risk of uterine infections in cows (Slama et al. 1993). In humans, 5-LO mRNA expression was higher in the first trimester of pregnancy than in the second and third trimesters in the

Leukotriene action in bovine uterus

Reproduction, Fertility and Development

Days of the estrous cycle Lung

2–4

8–10

16–18

(a) Marker

2000 a

37 kDa

(b) 5-LO 78 kDa

50 kDa

LTB4 (pg g⫺1 of tissue)

(a) GAPDH 37 kDa

687

1500 b 1000 b 500

(c) 37 kDa

(b)

(d) CysLTR2 43 kDa

75 kDa

(f ) LTCS 16 kDa

2000

37 kDa

(e) LTAH 69 kDa

0

15 kDa

LTC4 (pg g⫺1 of tissue)

LTB4R 36 kDa

b 1500

1000

a a

500

Fig. 3. Exemplary blots of (a) GAPDH, (b) 5-LO, (c) LTB4R, (d ) CysLTR2, (e) LTAH and ( f ) LTCS protein expression. 0

chorion-decidua (Brown et al. 1999). These studies indicate multiple actions of LTs as factors involved both in inflammatory processes and in the course of pregnancy. The highest expression of 12-LO during the oestrous cycle was obtained on Days 8–10 in this study. The possible role of 5- and 12-LO and the cyclooxygenase pathway in human myometrial contractility has been pointed out in only a small number of studies (Padma et al. 2007; Corriveau et al. 2010). The development of inflammation in the uterus occurs predominantly during the luteal stages of the oestrous cycle, not during oestrus or luteolysis (Sheldon et al. 2009). Thus, there is the possible relationship between the highest expression of 12-LO in endometrium and myometrium contractility and inflammatory processes on Days 8–10 of the cycle. 12-LO is described as an enzyme connected with inflammatory processes and found in macrophages (Ku¨hn and O’Donnell 2006) but the profile of its expression in endometrium is not known so far. We showed in our earlier studies that 5-LO is an enzyme expressed in the bovine ovary (Korzekwa et al. 2010a, 2010b). 5-LO is the key enzyme involved in LT biosynthesis and catalyses the initial steps in the conversion of AA to these biologically active lipid mediators (Samuelsson 2000). Since our previous results showed that production of LT in the ovary depends on 5-LO expression, we decided to continue evaluating 5-LO expression in the bovine endometrium. 5-LO mRNA and protein expression were the highest on Days 2–4 of the cycle. Previously, we described the expression pattern of this gene in bovine CL tissue, which was unchanged during the cycle (Korzekwa et al. 2010c). Comparison of 5-LO mRNA expression between steroidogenic, endothelial CL and

2–4

8–9

18–19

Days of estrous cycle Fig. 4. Concentrations of (a) LTB4 and (b) LTC4 in endometrial tissue on selected days of the oestrous cycle. Data are expressed as pg g1 of tissue. Small letters (a and b) indicate statistical differences in LT concentrations between groups of animals (P , 0.05).

granulosa cells revealed the highest level of mRNA expression in endothelial CL cells (Korzekwa et al. 2010b), which suggests an action of LTs on vascular remodelling. The highest 5LO mRNA and protein expression in the early-luteal stage in endometrium may also suggest that in this stage it is needed for LT production because of LT involvement in the increase of uterine artery pulsatility and velocity of blood flow in this stage of the oestrous cycle (Bollwein et al. 2000). According to Molin et al. (2010) both the 5-LO and 12-LO pathways are involved during neovascularisation and endothelial development, which suggests the participation of LTs in uterine blood flow regulation. The mRNA and protein expression profiles for LTAH and LTB4R were similar. Upregulation of enzymes synthesising LTB4 and its receptors is pronounced in the early-luteal stage in bovine endometrium. However, LTC4 appears to play an opposite role because both LTCS and CysLTR2 mRNA and protein expression are higher in the late-luteal stage. This profile for LT production in the endometrium is in agreement with earlier studies in the bovine ovary. We showed expression of the same kind of LT receptors in endometrial tissue (mRNA and protein) as were demonstrated previously in bovine ovarian

688

Reproduction, Fertility and Development

A. J. Korzekwa et al.

(a) 3000

PGE2 (ng g⫺1 of tissue)

∗∗∗ 2500 ∗

∗∗

2000 1500 1000 500

(b)

50

PGF2α (ng g⫺1 of tissue)

0

40

∗ ∗

30

20

10

0 Control

10⫺6 M

10⫺7 M LTB4

10⫺6 M

10⫺7 M LTC4

Fig. 5. Influence of LTB4 and C4 (both at 106 M and 107 M) on (a) PGE2 and (b) PGF2a secretion from mid-luteal stage endometrial explants. All values are expressed as ng g1 of tissue. Asterisks indicate significant differences (*P , 0.05; **P , 0.01; ***P , 0.001) from the respective control.

cells: steroidogenic and endothelial CL and granulosa cells (Korzekwa et al. 2010b) and CL tissue (Korzekwa et al. 2010a). These results indicate that if mRNA and protein expression of LTB4R is highest in the early luteal phase, LTB4 action is mainly connected with angiogenesis, whereas LTC4 action is occurs predominantly in the late luteal phase since CysLTR2 expression is the highest in the late-luteal stage in the endometrium. CysLTR2 expression was also upregulated on Days 17–19 but LTB4R mRNA expression was on the same level during the oestrous cycle in CL tissue (Korzekwa et al. 2010a). The differences in mRNA expression for LT receptors may be caused by other processes regulated by LTs depending on the stage of the oestrous cycle and organ of the reproductive tract (ovary vs uterus). The highest mRNA expression for LT receptors was observed in endothelial CL cells (Korzekwa et al. 2010b), which again suggests the involvement of LTs in vascular remodelling in the CL. It is also possible that in the bovine endometrium LTs are potentially necessary for angiogenesis in the early luteal phase of the cycle and for reduction of blood flow in vessels in the late luteal phase. Our results indicate that the dominant form of LTC4 receptor in endometrium is CysLTR2. CysLTR2 mRNA expression

was indicated in human coronary artery smooth-muscle cells (Kamohara et al. 2001) whereas CysLTR1 expression was connected with proinflammatory processes induced experimentally in these cells (Eaton et al. 2012). To the best of our knowledge, there are no data describing the pattern of LT secretion in bovine endometrium during the oestrous cycle. In vivo, the level of LTC4 in the peripheral blood plasma increases between Days 15 and 17 of the cycle, whereas the profile of LTB4 remains unchanged in the cycle (Korzekwa et al. 2010a). In the present study, the concentration of LTC4 in endometrial tissue was also elevated at the end of the luteal phase but LTB4 concentration was the highest on Days 2–4 of the cycle. In our in vivo study (Korzekwa et al. 2010a), the levels of LTs were measured in peripheral blood plasma, thus the results may have been the combined effect of processes occurring simultaneously with the action of these eicosanoids locally in the endometrium but also other organs besides the reproductive tract. Previously, by infusion of LT antagonists into the aorta abdominalis (on Days 15–16 of the cycle), we determined the effect of LT block in the bovine reproductive tract on the levels of PGs and P4 in peripheral blood (Korzekwa et al. 2010a). Leukotrienes not only modified secretion of the measured hormones during 24 h of study following infusion but also altered the duration of the cycle, measured by P4 plasma level. Administration of a LTB4 antagonist caused a temporary decrease in P4 levels, whereas administration of a LTC4 antagonist extended the luteal phase of the cycle (Korzekwa et al. 2010a). Such results imply an interaction of LTs not only with P4 in the CL (Korzekwa et al. 2010a, 2010b, 2010c) but also with PGs in the whole bovine reproductive tract. With this in mind, we evaluated the level of PGs in endometrial explants after LT stimulation. Our results showed that LTs (both B4 and C4) stimulated PGE2 and PGF2a in endometrial slices after 24 h in a dose-dependent manner. These results again argue for an interaction between PG and LT in the uterus but the intracellular mechanism requires further study. In conclusion, the present work shows that LTs are produced and secreted in the endometrium to different extents depending upon the stage of the luteal phase of the oestrous cycle. The highest levels of LTB4 production were observed in the earlyluteal stage (Days 2–4) of the cycle, whereas LTC4 was highest in the late-luteal stage (Days 16–18). These differences may indicate involvement of LTB4 and LTC4 in different and opposite processes in the endometrium during the luteal stage of the oestrous cycle, such as cell proliferation and endometrial tissue remodelling and, at least, in luteolysis. Moreover, synthesis of LT in the bovine endometrium occurs both by the 5-LO and 12-LO pathways. Acknowledgements The authors thank Mr. Marek Domin, owner of the slaughterhouse (Zaklady Miesne ‘Warmia’ in Biskupiec, Poland), for allowing the material collection, and the firm Draminski (Olsztyn, Poland) for use of the USG scanner to monitor the phase of the oestrous cycle in experimental cows. This research was supported by Grants-in-Aid for Scientific Research from the Polish Ministry of Scientific Research and Higher Education (NN311013837 and JP2010019370).

Leukotriene action in bovine uterus

Reproduction, Fertility and Development

References Baran´ski, W., Łukasik, K., Skarz˙yn´ski, D., Sztachan´ska, M., Zdun´czyk, S., and Janowski, T. (2013). Secretion of prostaglandins and leukotrienes by endometrial cells in cows with subclinical and clinical endometritis. Theriogenology 80, 766–772. doi:10.1016/J.THERIOGENOLOGY. 2013.07.001 Blair, R. M., Saatman, R., Liou, S. S., Fortune, J. E., and Hansel, W. (1997). Roles of leukotrienes in bovine corpus luteum regression: an in vivo microdialysis study. Proc. Soc. Exp. Biol. Med. 216, 72–80. doi:10.3181/ 00379727-216-44158 Bollwein, H., Meyer, H. H., Maierl, J., Weber, F., Baumgartner, U., and Stolla, R. (2000). Transrectal Doppler sonography of uterine blood flow. Theriogenology 53, 1541–1552. doi:10.1016/S0093-691X(00)00296-X Brown, N. L., Slater, D. M., Alvi, S. A., Elder, M. G., Sullivan, M. H., and Bennett, P. R. (1999). Expression of 5-lipoxygenase and 5-lipoxygenaseactivating protein in human fetal membranes throughout pregnancy and at term. Mol. Hum. Reprod. 5, 668–674. doi:10.1093/MOLEHR/5.7.668 Cerri, R. L., Chebel, R. C., Rivera, F., Narciso, C. D., Oliveira, R. A., Amstalden, M., Baez-Sandoval, G. M., Oliveira, L. J., Thatcher, W. W., and Santos, J. E. (2011). Concentration of progesterone during the development of the ovulatory follicle: II. Ovarian and uterine responses. J. Dairy Sci. 94, 3352–3365. doi:10.3168/JDS.2010-3735 Cerri, R. L., Thompson, I. M., Kim, I. H., Ealy, A. D., Hansen, P. J., Staples, C. R., Li, J. L., Santos, J. E., and Thatcher, W. W. (2012). Effects of lactation and pregnancy on gene expression of endometrium of Holstein cows at Day 17 of the oestrous cycle or pregnancy. J. Dairy Sci. 95, 5657–5675. doi:10.3168/JDS.2011-5114 Ciereszko, R., Opałka, M., Kamin´ska, B., Wojtczak, M., Okrasa, S., and Dusza, L. (2001). Luteotrophic action of prolactin during the early luteal phase in pigs: the involvement of protein kinases and phosphatases. Reprod. Biol. 1, 62–83. Corriveau, S., Rousseau, E., Berthiaume, M., and Pasquier, J. C. (2010). Lipoxygenase and cyclooxygenase inhibitors reveal a complementary role of arachidonic acid derivatives in pregnant human myometrium. Am. J. Obstet. Gynecol. 203, 266.e1–266.e7. doi:10.1016/J.AJOG.2010. 06.009 Eaton, A., Nagy, E., Pacault, M., Fauconnier, J., and Ba¨ck, M. (2012). Cysteinyl leukotriene signalling through perinuclear CysLT(1) receptors on vascular smooth muscle cells transduces nuclear calcium signalling and alterations of gene expression. J. Mol. Med. (Berl) 90, 1223–1231. doi:10.1007/S00109-012-0904-1 Izumi, T., Yokomizo, T., Obinata, H., Ogasawara, H., and Shimizu, T. (2002). Leukotriene receptors: classification, gene expression and signal transduction. J. Biochem. 132, 1–6. doi:10.1093/OXFORDJOURNALS. JBCHEM.A003185 Jones, T. R., and Rodger, I. W. (1999). Role of leukotrienes and leukotriene receptor antagonists in asthma. Pulm. Pharmacol. Ther. 12, 107–110. doi:10.1006/PUPT.1999.0188 Kamohara, M., Takasaki, J., Matsumoto, M., Matsumoto, S., Saito, T., Soga, T., Matsushime, H., and Furuichi, K. (2001). Functional characterization of cysteinyl leukotriene CysLT(2) receptor on human coronary artery smooth-muscle cells. Biochem. Biophys. Res. Commun. 287, 1088–1092. doi:10.1006/BBRC.2001.5695 Korzekwa, A., Murakami, S., Wocławek-Potocka, I., Bah, M. M., Okuda, K., and Skarzynski, D. J. (2008). The influence of tumour necrosis factor alpha (TNF) on the secretory function of bovine corpus luteum: TNF and its receptors expression during the oestrous cycle. Reprod. Biol. 8, 245–262. doi:10.1016/S1642-431X(12)60015-1 Korzekwa, A. J., Bah, M. M., Kurzynowski, A., Lukasik, K., Groblewska, A., and Skarzynski, D. J. (2010a). Leukotrienes modulate secretion of progesterone and prostaglandins during the oestrous cycle and early pregnancy in cattle: an in vivo study. Reproduction 140, 767–776. doi:10.1530/REP-10-0202

689

Korzekwa, A. J., Acosta, T. J., Miklewicz, M., Lee, S. H., and Skarzynski, D. J. (2010b). Leukotrienes affect secretory function of ovarian cells in vitro. Reprod. Domest. Anim. 45, e288–e296. doi:10.1111/J.1439-0531.2009. 01559.X Korzekwa, A., Lukasik, K., and Skarzynski, D. J. (2010c). Leukotrienes are auto-/paracrine factors in the bovine corpus luteum: an in vitro study. Reprod. Domest. Anim. 45, 1089–1097. doi:10.1111/J.1439-0531.2009. 01500.X Korzekwa, A. J., Bodek, G., Bukowska, J., Blitek, A., and Skarzynski, D. J. (2011). Characterization of bovine immortalized luteal endothelial cells: action of cytokines on production and content of arachidonic acid metabolites. Reprod. Biol. Endocrinol. 9, 27. doi:10.1186/1477-78279-27 Ku¨hn, H., and O’Donnell, V. B. (2006). Inflammation and immune regulation by 12/15-lipoxygenases. Prog. Lipid Res. 45, 334–356. doi:10.1016/ J.PLIPRES.2006.02.003 McCracken, J. A., Custer, E. E., and Lamsa, J. C. (1999). Luteolysis: a neuroendocrine-mediated event. Physiol. Rev. 79, 263–323. Milvae, R. A., Alila, H. W., and Hansel, W. (1986). Involvement of lipoxygenase products of arachidonic acid metabolism in bovine luteal function. Biol. Reprod. 35, 1210–1215. doi:10.1095/BIOLREPROD35. 5.1210 Miyamoto, Y., Skarzynski, D. J., and Okuda, K. (2000). Is tumour necrosis factor-a a trigger for the initiation of prostaglandin F2a release at luteolysis in cattle? Biol. Reprod. 62, 1109–1115. doi:10.1095/BIOLRE PROD62.5.1109 Molin, D. G., van den Akker, N. M., and Post, M. J. (2010). ‘Lox on neovascularisation’: leukotrienes as mediators in endothelial biology. Cardiovasc. Res. 86, 6–8. doi:10.1093/CVR/CVQ054 Murphy, R. C., and Gijo´n, M. A. (2007). Biosynthesis and metabolism of leukotrienes. Biochem. J. 405, 379–395. doi:10.1042/BJ20070289 Padma, A. S., Agarwal, S., Reddy, D. B., Prasad, T. S., and Reddanna, P. (2007). Metabolism of arachidonic acid in sheep uterus: in vitro studies. Indian J. Biochem. Biophys. 44, 216–222. Samuelsson, B. (2000). The discovery of the leukotrienes. Am. J. Respir. Crit. Care Med. 161, S2–S6. doi:10.1164/AJRCCM.161.SUPPLE MENT_1.LTTA-1 Sheldon, I. M., Cronin, J., Goetze, L., Donofrio, G., and Schuberth, H. J. (2009). Defining postpartum uterine disease and the mechanisms of infection and immunity in the female reproductive tract in cattle. Biol. Reprod. 81, 1025–1032. doi:10.1095/BIOLREPROD.109. 077370 Singh, R. K., Gupta, S., Dastidar, S., and Ray, A. (2010). Cysteinyl leukotrienes and their receptors: molecular and functional characteristics. Pharmacology 85, 336–349. doi:10.1159/000312669 Skarzynski, D. J., Bah, M. M., Deptula, K. M., Woclawek-Potocka, I., Korzekwa, A., Shibaya, M., Pilawski, W., and Okuda, K. (2003). Roles of tumour necrosis factor-alpha of the oestrous cycle in cattle: an in vivo study. Biol. Reprod. 69, 1907–1913. doi:10.1095/BIOLREPROD.103. 016212 Slama, H., Vaillancourt, D., and Goff, A. K. (1993). Leukotriene B4 in cows with normal calving, and in cows with retained fetal membranes and/or uterine subinvolution. Can. J. Vet. Res. 57, 293–299. Tager, A. M., and Luster, A. D. (2003). BLT1 and BLT2: the leukotriene B4 receptors. Prostaglandins Leukot. Essent. Fatty Acids 69, 123–134. doi:10.1016/S0952-3278(03)00073-5 Uenoyama, Y., Hattori, S., Miyake, M., and Okuda, K. (1997). Upregulation of oxytocin receptors in porcine endometrium by adenosine 30 ,50 -monophosphate. Biol. Reprod. 57, 723–728. doi:10.1095/ BIOLREPROD57.4.723 Weems, C. W., Weems, Y. S., and Randel, R. D. (2006). Prostaglandins and reproduction in female farm animals. Vet. J. 171, 206–228. doi:10.1016/ J.TVJL.2004.11.014

www.publish.csiro.au/journals/rfd

Leukotriene production profiles and actions in the bovine endometrium during the oestrous cycle.

We have previously shown the influence of leukotrienes (LTs) on reproductive functions in vivo: LTB4 is luteotrophic and supports corpus luteum functi...
461KB Sizes 1 Downloads 4 Views