Appl Microbiol Biotechnol DOI 10.1007/s00253-014-6168-7
APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY
Linear B-cell epitope mapping of MAPK3 and MAPK4 from Leishmania braziliensis: implications for the serodiagnosis of human and canine leishmaniasis Daniel Menezes-Souza & Tiago Antônio de Oliveira Mendes & Ana Carolina de Araújo Leão & Matheus de Souza Gomes & Ricardo Toshio Fujiwara & Daniella Castanheira Bartholomeu
Received: 18 August 2014 / Revised: 13 October 2014 / Accepted: 14 October 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract The correct and early identification of humans and dogs infected with Leishmania are key steps in the control of leishmaniasis. Additionally, a method with high sensitivity and specificity at low cost that allows the screening of a large number of samples would be extremely valuable. In this study, we analyzed the potential of mitogen-activated protein kinase 3 (MAPK3) and mitogen-activated protein kinase 4 (MAPK4) proteins from Leishmania braziliensis to serve as antigen candidates for the serodiagnosis of human visceral and tegumentary leishmaniasis, as well as canine visceral disease. Moreover, we mapped linear B-cell epitopes in these proteins and selected those epitopes with sequences that were divergent in the corresponding orthologs in Homo sapiens, in Canis familiaris, and in Trypanosoma cruzi. We compared the performance of these peptides with the recombinant protein using ELISA. Both MAPK3 and MAPK4 recombinant proteins showed better specificity in the immunodiagnosis of human and canine leishmaniasis than soluble parasite antigens and the EIE-leishmaniose-visceral-canina-bio-manguinhos (EIE-LVC) kit. Furthermore, the performance of this serodiagnosis assay Daniel Menezes-Souza and Tiago Antônio de Oliveira Mendes contributed equally to this work Electronic supplementary material The online version of this article (doi:10.1007/s00253-014-6168-7) contains supplementary material, which is available to authorized users. D. Menezes-Souza : T. A. de Oliveira Mendes : A. C. de Araújo Leão : R. T. Fujiwara : D. C. Bartholomeu (*) Departamento de Parasitologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil e-mail: [email protected] M. de Souza Gomes Instituto de Genética e Bioquímica, Universidade Federal de Uberlândia, Patos de Minas, Minas Gerais, Brazil
was improved using synthetic peptides corresponding to B-cell epitopes derived from both proteins. Keywords Tegumentary and visceral human leishmaniasis . Canine visceral leishmaniasis . Immunodiagnosis . MAPK3 . MAPK4 . B-cell epitope mapping
Introduction Leishmaniasis is a disease caused by vector-borne parasites of Leishmania genus that affects approximately 12 million people around the world causing approximately 50,000 deaths each year (Desjeux 2001). Although the most affected countries are in tropical or subtropical regions, the disease is expanding to non-endemic areas in North America and Europe (Gonzalez et al. 2010; Ready 2010; Shaw 2007). Leishmaniasis encompasses multiple clinical syndromes that are classified as cutaneous, mucosal, and visceral, and the development of each clinical form is associated with the genetic variability of both parasite and host. Cutaneous and mucosal leishmaniasis can cause substantial morbidity (Molina et al. 1994), whereas visceral leishmaniasis is frequently fatal if untreated (Wilson and Streit 1996); thus, the correct and early diagnosis of infection is a key step in the control of this disease. Moreover, visceral leishmaniasis surveillance programs depend on the identification of infected dogs that are important reservoirs that maintain the domestic cycle of the parasite (Molina et al. 1994). As clinical manifestation lacks specificity, the diagnosis of visceral leishmaniasis should be performed by parasite detection in the infected tissue by microscopy, PCR, and/or serology (Chappuis et al. 2007; Sundar and Rai 2002). Most of the serological tests use crude Leishmania-antigen preparations
Appl Microbiol Biotechnol
that include soluble antigens. Those antigens show variable sensitivity due to antigenic differences among Leishmania isolates and lack specificity due to cross-reactivity with other diseases (Caballero et al. 2007; Zanette et al. 2014). The diagnosis of tegumentary leishmaniasis considers epidemiological data, clinical aspects, and laboratory tests (Goto and Lindoso 2010), which include the Montenegro skin test (MST) and the microscopic detection of the parasite in lesions (Alves et al. 2013). The MST identifies a delayed-type hypersensitivity response to parasite antigens in infected individuals, but does not discriminate between active and cured infection (Stockdale and Newton 2013). The correct and early identification of infected humans and dogs are key steps in disease control. Therefore, a low-cost method with high sensitivity and specificity that allows for the screening of a large number of samples would be extremely valuable. Serological tests have significant advantages for the diagnosis of leishmaniasis, including their non-invasive nature, their capacity for the early detection of infection before the formation of lesions, and their capacity to be automated and quantitative. However, a small number of well-characterized antigens have been described in the literature, hindering the development of new serodiagnostic tests with improved performance. Previous studies have demonstrated that conserved housekeeping genes and virulence factors have a high potential for the serodiagnosis of leishmaniasis (Lakhal-Naouar et al. 2009; Menezes-Souza et al. 2014a). Among these genes, mitogenactivated protein kinases (MAPKs) are proteins encoded in practically all eukaryote genomes and display signal transduction functions associated with cytoskeletal rearrangements, proliferation, differentiation, adaptation, and stress-response (Brumlik et al. 2011; Pearson et al. 2001). Genomic analyses revealed that there are 17 putative MAPKs in Leishmania spp., being one of the most expanded protein kinase families when compared to mammals (Brumlik et al. 2011; Wiese 2007). Several MAPKs, including mitogen-activated protein kinase 3 (MAPK3) and mitogen-activated protein kinase 4 (MAPK4), have been implicated in the differentiation process of promastigote into amastigote. Whereas MAPK3 displays control of flagellar length (Erdmann et al. 2006), the overexpression of MAPK4 increases stage-specific phosphorylase activity (Wang et al. 2005). Due to the importance of MAPK3 and MAPK4 in hostparasite interaction, we analyzed the potential of both proteins from Leishmania braziliensis to be used as antigens for the serological diagnosis of visceral and tegumentary human leishmaniasis and visceral canine disease. We also evaluated different protein characteristics that could influence the serodiagnosis performance, such as expression levels in parasite stages present in mammalian hosts and sequence similarity between other phylogenetically related parasites and hosts. Additionally, we mapped linear B-cell epitopes in these
proteins with sequences that were divergent from their orthologs in Homo sapiens, Canis familiaris, and Trypanosoma cruzi and compared their performance with recombinant protein using ELISA.
Materials and methods Ethics statement and human and dog sera samples used Experiments involving human samples were approved by the Ethics Committee of the Federal University of Minas Gerais (UFMG) under protocol CAAE: 00842112.2.0000.5149. Before blood collection, all subjects provided written informed consent. A total of 65 sera samples from tegumentary leishmaniasis patients with cutaneous (cutaneous leishmaniasis (CL), n=45) or mucosal (mucosal leishmaniasis (ML), n=20) clinical manifestations were obtained from the Centro de Referência em Leishmaniose (Januária, Minas Gerais state, Brazil), and 55 sera samples from visceral leishmaniasis (VL) patients were obtained from the University Hospital (Montes Claros, Minas Gerais state, Brazil). The parasitological infection was confirmed by the presence of amastigotes in microscopic analyses of cutaneous lesions or bone marrow aspirates and by PCR assays using specific primers for the Leishmania Kinetoplastid DNA (kDNA) sequence (de Bruijn and Barker 1992). All Leishmania-infected patients were found to be uninfected with T. cruzi. Sera from 20 patients with Chagas disease (CD) were collected, with T. cruzi infection being confirmed by hemoculture or the Chagatest® recombinant ELISA v.3.0 kit and the Chagatest® hemagglutination inhibition test; these samples were uninfected with Leishmania. Sera from 50 healthy humans from a nonendemic area to Leishmania or Trypanosoma were used as negative controls (CT). The use of dog samples was carried out in agreement with the guidelines of the Brazilian College of Animal Experimentation, strictly following Brazilian law regarding “Procedures for the Scientific Use of Animals” (11.794/ 2008) and were approved by the Institutional Animal Care and Committee on Ethics of Animal Experimentation (CETEA) from the UFMG under protocol number 44/ 2012. Dog sera samples were obtained from the endemic area for canine visceral leishmaniasis (CVL) in Minas Gerais state, Brazil. Infection was confirmed by the presence of amastigotes in microscopic analyses of bone marrow aspirates from 30 animals. Samples from 15 dogs experimentally infected with T. cruzi (canine Chagas disease (CCD)) and negative for Leishmania were used to evaluate cross-reactivity. A total of 30 dogs from a non-endemic area for visceral leishmaniasis and negative to Leishmania and T. cruzi were included as a control group (canine control (CCT)).
Appl Microbiol Biotechnol
Sequence analysis and linear B-cell epitope prediction The sequences of L. braziliensis MAPK3 (LbMAPK3; ID: LbrM.10.0620) and L. braziliensis MAPK4 (LbMAPK4; ID: LbrM.19.1710) from L. braziliensis were retrieved from TriTrypDB (Aslett et al. 2010). Orthologous proteins in Leishmania infantum and T. cruzi were obtained from an orthologs list present in TriTrypDB and confirmed as the best hit using LbMAPK3 and LbMAPK4 as queries in a Protein Basic Local Alignment Search Tool (BLASTp) search (Altschul et al. 1990) against whole protein sequences of the two species. BLASTp was also used to identify the more similar human and dog protein sequences in the NCBI Reference Sequence (RefSeq) database, and global multiple sequence alignments were performed using ClustalX 2.0 (Thompson et al. 2002) with default parameters. Linear Bcell epitopes were identified by BepiPred program (Larsen et al. 2006) with a cutoff of 1.3, and epitopes were considered as those with at least nine continuous amino acids with individual prediction scores above the cutoff. Intrinsically unstructured/disordered regions (IURs) were considered as those with at least nine continuous amino acids with an individual score above 0.5 predicted by IUPred program (Dosztanyi et al. 2005). Parasites L. braziliensis (MHOM/BR/75/M2904) is a reference strain from the Evandro Chagas Institute, Belém, Brazil. This strain was isolated by direct culture from a lesion on the right side of the thorax of a man who had been performing survey work in Serra dos Carajás, Brazilian Amazonia. Parasites were gently provided by Prof. Maria Norma de Melo (UFMG). Promastigote stages were maintained in Schneider’s insect medium (Sigma-Aldrich) supplemented with 10 % inactivated fetal bovine serum, 100 U/mL penicillin and 100 μg/mL streptomycin (Life Technologies) at 23 °C ± 1 °C. Metacyclic promastigote forms were obtained after the purification of stationary cultures of L. braziliensis with peanut lectin, as previously described (Alcolea et al. 2009). Intracellular amastigotes were obtained by infecting 1×105 macrophages with 1×106 stationary promastigotes for 24 to 60 h at 37 °C and 5 % CO2. RNA extraction and quantitative real-time PCR (qRT-PCR) assays Total RNA from the different developmental stages of L. braziliensis was extracted using the Total RNA isolation kit (Macherey-Nagel) according to the manufacturer’s recommendations. cDNA synthesis was carried out using the High Capacity cDNA Reverse Transcription kit (PE Applied Biosystems), and qRT-PCR was performed as previously
described (Menezes-Souza et al. 2012). The primer sequences of the MAPK3 and MAPK4 genes as well as of five constitutive control genes (GAPDH, 18s, α-tubulin, β-tubulin, and Actin) are listed in Table S1. Logarithmic promastigotes were used as a calibrator group by the 2−ΔΔCt method (Bustin et al. 2009). Soluble L. braziliensis antigen (SLbA) A total of 1×1010 L. braziliensis promastigotes were washed three times with cold phosphate-buffered saline followed by three cycles of freezing in liquid nitrogen and thawing (42 °C). After ultrasonication with ten alternating cycles of 30 s at 35 MHz, the lysate was centrifuged at 6,000×g at 4 °C for 15 min. The supernatant containing SLbA was collected, and the protein concentration was estimated using the Pierce™ BCA™ Protein Assay (Thermo Scientific). Cloning, recombinant protein expression, and purification LbMAPK3 and LbMAPK4 genes were amplified from the genomic DNA of L. braziliensis by PCR using the forward (GCTAGCATGCACAAGAGCAACCAGGA) and reverse (GGATCCTTAGTGATGGTGGGCGCTG) primers for MAPK3 and the forward (GCTAGCATGACTCAACTCGT CCCT) and reverse (CTCGAGCTATTCATTCGAATGTGA GTAAGC) primers for MAPK4. NheI and BamHI restriction sites were added to the forward and reverse primers for MAPK3 and NheI and XhoI for MAPK4. The 1,167-kb fragments of MAPK3 and 1,104 kb of MAPK4 were excised from the agarose gel, purified, digested with the restriction enzymes, and ligated to the pET28a-TEV vector previously digested with the same restriction enzymes (Coitinho et al. 2012). Electrocompetent Escherichia coli BL21 Arctic Express (DE3) (Agilent Technologies) cells were transfected with recombinant plasmids by electroporation using a MicroPulser Electroporation Apparatus (Bio-Rad Laboratories). Gene insertion was confirmed by colony PCR and sequencing using T7 primers (Macrogen). Recombinant LbMAPK3 and LbMAPK4 were expressed by adding 1.0 mM Isopropyl-β-D-thiogalactopyranoside (IPTG, Promega) for 24 h at 12 °C with shaking at 200 rpm. The cells were then lysed by sonication and centrifuged at 6,000×g for 30 min at 4 °C. The recombinant proteins were purified using a HisTrap HP affinity column connected to the ÄKTAprime chromatography system (GE Healthcare). The eluted fractions containing recombinant LbMAPK3 (rLbMAPK3) and recombinant LbMAPK4 (rLbMAPK4) were concentrated using Amicon® Ultra 15 Centrifugal Filters 10,000 NMWL (Millipore) and further purified on a SuperdexTM 200 gel filtration column (GE Healthcare).
Appl Microbiol Biotechnol
Peptide synthesis Soluble peptides were manually synthesized in solid phase on a 30-μmol scale using 9-florenyl-methoxy-carbonyl (Fmoc) chemistry (Mendes et al. 2013b; Wellings and Atherton 1997). First, Fmoc-amino acids were activated with a 1:2 solution of Oxyme and DIC. The activated amino acids were incorporated into Rink amide resin with a substitution degree of 0.61. Fmoc deprotection was then performed using 25 % 4methylpiperidine. These steps were repeated until the synthesis of the peptide was complete. The side chain was unprotected and released form the resin by treatment with a solution of 95.0 % trifluoroacetic acid, 2.5 % water, and 2.5 % triisopropylsilane. The peptide was precipitated with cold diisopropyl ether and purified by high-performance liquid chromatography on a C18 reverse-phase column using a gradient program of 0 to 25 % acetonitrile. The peptides were obtained with 90 % purity, as confirmed by mass spectrometry using Autoflex Speed MALDI/TOF equipment.
Fig. 2 Sequence divergence and prediction of B-cell linear epitopes and intrinsically unstructured/disordered regions in L. braziliensis MAPK3 and MAPK4 and its orthologs. a Alignment between L. braziliensis MAPK3 (TritrypDB ID: LbrM.10.0620) and orthologous proteins present in L. infantum (TritrypDB: LinJ.10.0540), T. cruzi (TritrypDB: LinJ.10.0540), H. sapiens (RefSeq ID: NP_620581.1), and C. familiaris (RefSeq ID: NP_001003206.1). b Alignment between L. braziliensis MAPK4 (TritrypDB ID: LbrM.19.1710) and orthologous proteins present in L. infantum (TritrypDB ID: LinJ.19.1480), T. cruzi (TritrypDB ID: TcCLB.511299.70), H. sapiens (RefSeq ID: NP_620581.1), and C. familiaris (RefSeq ID: NP_001003206.1). The yellow boxes mark predicted linear B-cell epitopes, and the gray boxes mark predicted disordered regions. The continuous black underlined amino acid sequences represent potential B-cell epitopes predicted by BepiPred in the MAPK3 and MAPK4 proteins, and green highlight amino acid conservations in the T. cruzi, C. familiaris, and H. sapiens sequences in relation to the L. braziliensis sequence
Initially, recombinant proteins and SLbA were coated onto 96well microplates (Nalge Nunc Intl.) overnight at 2–8 °C at a
concentration of 250 ng/well for rLbMAPK3 and rLbMAPK4 and 50 ng/well for SLbA. For the peptides, flat-bottom plates (Costar®) were coated with 10 μg/well of soluble peptide overnight at 37 °C. After blocking with 5 % BSA in phosphate-buffered saline (PBS) for 1 h at 37 °C, followed by three washing steps with PBS containing 0.05% Tween 20 (PBS-T), the plates were incubated with human or dog serum (dilution 1:100). The plates were washed three times with PBST, and secondary HRP-conjugated antihuman or antidog IgG antibody 1:5,000 was added for 1 h at 37 °C, followed by four
Fig. 1 Pipeline for the identification of new targets for the serodiagnosis of canine and human leishmaniasis The presence of linear B-cell epitopes in Leishmania protein targets (LbMAPK3 and LbMAPK4) were predicted by BepiPred program (a), and orthologous proteins of T. cruzi and mammalian hosts were retrieved from the TritrypDB and NCBI RefSeq using the BLASTp algorithm (b). Leishmania and other orthologous protein sequences were aligned using CLUSTALW (c), and linear B-cell epitopes specific for Leishmania parasites were identified (d and e). The RNA expression level of LbMAPK3 and LbMAPK4 in log-phase and metacyclic promastigotes and amastigotes were measured by real-time
PCR (f) to identify proteins with increased expression in parasite forms present in mammalian host cells. Recombinant proteins produced by heterologous expression in E. coli (g) were used in ELISA protocols (h) to diagnose canine and human leishmaniasis. Synthetic peptides representing linear B-cell epitopes were synthesized by the Fmoc approach (i), and their contribution to the overall antigenic properties of the corresponding recombinant proteins were evaluated by depletion ELISA (j). The performance of specific peptides was also evaluated to serodiagnosis of canine and human leishmaniasis (k)
ELISA and depletion ELISA assay
Appl Microbiol Biotechnol
Appl Microbiol Biotechnol
washes. TMB substrate (Sigma-Aldrich) in citrate buffer containing hydrogen peroxide was used for detection; the reaction was stopped after 30 min with 4 N H2SO4, and the absorbance was measured at 450 nm. For depletion ELISAs, the sera were previously incubated in peptide-coated and blocked plates at a 1:100 dilution and incubated overnight at 2–8 °C. Depleted and undepleted samples were transferred to plates coated overnight with recombinant proteins (50 ng/well) and blocked, and the ELISAs were performed as described above. Statistical analysis The cutoffs for rLbMAPK3, rLbMAPK4, SLbA, and peptide1 and peptide-2 were established for optimal sensitivity and specificity using the receiver-operator curve (ROC) curve. The cutoff was chosen based on the point that provided the maximum of the sum of the sensitivity and specificity (Linnet et al. 2012). The EIE-leishmaniose-visceral-canina-biomanguinhos (EIE-LVC) cutoff was obtained according to the manufacturer (twice the average of the negative control provided by the kit). The performance of each test was evaluated according to the sensitivity (Se), specificity (Sp), positive predictive value (PPV), negative predictive value (NPV), area under the curve (AUC), and accuracy (AC). The degree of agreement between the ELISA assays using the recombinant proteins, SLbA, or the EIE-LVC kit with the parasitological test (biopsy, aspirate, or PCR) was determined by Kappa index (κ) values with 95% confidence intervals and interpreted according to the following Fleiss scale: 0.00– 0.20, poor; 0.21–0.40, fair; 0.41–0.60, moderate; 0.61–0.80, good; 0.81–0.99, very good; and 1.00, perfect. The onesample Kolmogorov-Smirnoff test was used to determine whether a variable was normally distributed. For depletion assays, significant differences were detected using a two-way ANOVA. The differences were considered statistically significant at p
APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY
Linear B-cell epitope mapping of MAPK3 and MAPK4 from Leishmania braziliensis: implications for the serodiagnosis of human and canine leishmaniasis Daniel Menezes-Souza & Tiago Antônio de Oliveira Mendes & Ana Carolina de Araújo Leão & Matheus de Souza Gomes & Ricardo Toshio Fujiwara & Daniella Castanheira Bartholomeu
Received: 18 August 2014 / Revised: 13 October 2014 / Accepted: 14 October 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract The correct and early identification of humans and dogs infected with Leishmania are key steps in the control of leishmaniasis. Additionally, a method with high sensitivity and specificity at low cost that allows the screening of a large number of samples would be extremely valuable. In this study, we analyzed the potential of mitogen-activated protein kinase 3 (MAPK3) and mitogen-activated protein kinase 4 (MAPK4) proteins from Leishmania braziliensis to serve as antigen candidates for the serodiagnosis of human visceral and tegumentary leishmaniasis, as well as canine visceral disease. Moreover, we mapped linear B-cell epitopes in these proteins and selected those epitopes with sequences that were divergent in the corresponding orthologs in Homo sapiens, in Canis familiaris, and in Trypanosoma cruzi. We compared the performance of these peptides with the recombinant protein using ELISA. Both MAPK3 and MAPK4 recombinant proteins showed better specificity in the immunodiagnosis of human and canine leishmaniasis than soluble parasite antigens and the EIE-leishmaniose-visceral-canina-bio-manguinhos (EIE-LVC) kit. Furthermore, the performance of this serodiagnosis assay Daniel Menezes-Souza and Tiago Antônio de Oliveira Mendes contributed equally to this work Electronic supplementary material The online version of this article (doi:10.1007/s00253-014-6168-7) contains supplementary material, which is available to authorized users. D. Menezes-Souza : T. A. de Oliveira Mendes : A. C. de Araújo Leão : R. T. Fujiwara : D. C. Bartholomeu (*) Departamento de Parasitologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil e-mail: [email protected] M. de Souza Gomes Instituto de Genética e Bioquímica, Universidade Federal de Uberlândia, Patos de Minas, Minas Gerais, Brazil
was improved using synthetic peptides corresponding to B-cell epitopes derived from both proteins. Keywords Tegumentary and visceral human leishmaniasis . Canine visceral leishmaniasis . Immunodiagnosis . MAPK3 . MAPK4 . B-cell epitope mapping
Introduction Leishmaniasis is a disease caused by vector-borne parasites of Leishmania genus that affects approximately 12 million people around the world causing approximately 50,000 deaths each year (Desjeux 2001). Although the most affected countries are in tropical or subtropical regions, the disease is expanding to non-endemic areas in North America and Europe (Gonzalez et al. 2010; Ready 2010; Shaw 2007). Leishmaniasis encompasses multiple clinical syndromes that are classified as cutaneous, mucosal, and visceral, and the development of each clinical form is associated with the genetic variability of both parasite and host. Cutaneous and mucosal leishmaniasis can cause substantial morbidity (Molina et al. 1994), whereas visceral leishmaniasis is frequently fatal if untreated (Wilson and Streit 1996); thus, the correct and early diagnosis of infection is a key step in the control of this disease. Moreover, visceral leishmaniasis surveillance programs depend on the identification of infected dogs that are important reservoirs that maintain the domestic cycle of the parasite (Molina et al. 1994). As clinical manifestation lacks specificity, the diagnosis of visceral leishmaniasis should be performed by parasite detection in the infected tissue by microscopy, PCR, and/or serology (Chappuis et al. 2007; Sundar and Rai 2002). Most of the serological tests use crude Leishmania-antigen preparations
Appl Microbiol Biotechnol
that include soluble antigens. Those antigens show variable sensitivity due to antigenic differences among Leishmania isolates and lack specificity due to cross-reactivity with other diseases (Caballero et al. 2007; Zanette et al. 2014). The diagnosis of tegumentary leishmaniasis considers epidemiological data, clinical aspects, and laboratory tests (Goto and Lindoso 2010), which include the Montenegro skin test (MST) and the microscopic detection of the parasite in lesions (Alves et al. 2013). The MST identifies a delayed-type hypersensitivity response to parasite antigens in infected individuals, but does not discriminate between active and cured infection (Stockdale and Newton 2013). The correct and early identification of infected humans and dogs are key steps in disease control. Therefore, a low-cost method with high sensitivity and specificity that allows for the screening of a large number of samples would be extremely valuable. Serological tests have significant advantages for the diagnosis of leishmaniasis, including their non-invasive nature, their capacity for the early detection of infection before the formation of lesions, and their capacity to be automated and quantitative. However, a small number of well-characterized antigens have been described in the literature, hindering the development of new serodiagnostic tests with improved performance. Previous studies have demonstrated that conserved housekeeping genes and virulence factors have a high potential for the serodiagnosis of leishmaniasis (Lakhal-Naouar et al. 2009; Menezes-Souza et al. 2014a). Among these genes, mitogenactivated protein kinases (MAPKs) are proteins encoded in practically all eukaryote genomes and display signal transduction functions associated with cytoskeletal rearrangements, proliferation, differentiation, adaptation, and stress-response (Brumlik et al. 2011; Pearson et al. 2001). Genomic analyses revealed that there are 17 putative MAPKs in Leishmania spp., being one of the most expanded protein kinase families when compared to mammals (Brumlik et al. 2011; Wiese 2007). Several MAPKs, including mitogen-activated protein kinase 3 (MAPK3) and mitogen-activated protein kinase 4 (MAPK4), have been implicated in the differentiation process of promastigote into amastigote. Whereas MAPK3 displays control of flagellar length (Erdmann et al. 2006), the overexpression of MAPK4 increases stage-specific phosphorylase activity (Wang et al. 2005). Due to the importance of MAPK3 and MAPK4 in hostparasite interaction, we analyzed the potential of both proteins from Leishmania braziliensis to be used as antigens for the serological diagnosis of visceral and tegumentary human leishmaniasis and visceral canine disease. We also evaluated different protein characteristics that could influence the serodiagnosis performance, such as expression levels in parasite stages present in mammalian hosts and sequence similarity between other phylogenetically related parasites and hosts. Additionally, we mapped linear B-cell epitopes in these
proteins with sequences that were divergent from their orthologs in Homo sapiens, Canis familiaris, and Trypanosoma cruzi and compared their performance with recombinant protein using ELISA.
Materials and methods Ethics statement and human and dog sera samples used Experiments involving human samples were approved by the Ethics Committee of the Federal University of Minas Gerais (UFMG) under protocol CAAE: 00842112.2.0000.5149. Before blood collection, all subjects provided written informed consent. A total of 65 sera samples from tegumentary leishmaniasis patients with cutaneous (cutaneous leishmaniasis (CL), n=45) or mucosal (mucosal leishmaniasis (ML), n=20) clinical manifestations were obtained from the Centro de Referência em Leishmaniose (Januária, Minas Gerais state, Brazil), and 55 sera samples from visceral leishmaniasis (VL) patients were obtained from the University Hospital (Montes Claros, Minas Gerais state, Brazil). The parasitological infection was confirmed by the presence of amastigotes in microscopic analyses of cutaneous lesions or bone marrow aspirates and by PCR assays using specific primers for the Leishmania Kinetoplastid DNA (kDNA) sequence (de Bruijn and Barker 1992). All Leishmania-infected patients were found to be uninfected with T. cruzi. Sera from 20 patients with Chagas disease (CD) were collected, with T. cruzi infection being confirmed by hemoculture or the Chagatest® recombinant ELISA v.3.0 kit and the Chagatest® hemagglutination inhibition test; these samples were uninfected with Leishmania. Sera from 50 healthy humans from a nonendemic area to Leishmania or Trypanosoma were used as negative controls (CT). The use of dog samples was carried out in agreement with the guidelines of the Brazilian College of Animal Experimentation, strictly following Brazilian law regarding “Procedures for the Scientific Use of Animals” (11.794/ 2008) and were approved by the Institutional Animal Care and Committee on Ethics of Animal Experimentation (CETEA) from the UFMG under protocol number 44/ 2012. Dog sera samples were obtained from the endemic area for canine visceral leishmaniasis (CVL) in Minas Gerais state, Brazil. Infection was confirmed by the presence of amastigotes in microscopic analyses of bone marrow aspirates from 30 animals. Samples from 15 dogs experimentally infected with T. cruzi (canine Chagas disease (CCD)) and negative for Leishmania were used to evaluate cross-reactivity. A total of 30 dogs from a non-endemic area for visceral leishmaniasis and negative to Leishmania and T. cruzi were included as a control group (canine control (CCT)).
Appl Microbiol Biotechnol
Sequence analysis and linear B-cell epitope prediction The sequences of L. braziliensis MAPK3 (LbMAPK3; ID: LbrM.10.0620) and L. braziliensis MAPK4 (LbMAPK4; ID: LbrM.19.1710) from L. braziliensis were retrieved from TriTrypDB (Aslett et al. 2010). Orthologous proteins in Leishmania infantum and T. cruzi were obtained from an orthologs list present in TriTrypDB and confirmed as the best hit using LbMAPK3 and LbMAPK4 as queries in a Protein Basic Local Alignment Search Tool (BLASTp) search (Altschul et al. 1990) against whole protein sequences of the two species. BLASTp was also used to identify the more similar human and dog protein sequences in the NCBI Reference Sequence (RefSeq) database, and global multiple sequence alignments were performed using ClustalX 2.0 (Thompson et al. 2002) with default parameters. Linear Bcell epitopes were identified by BepiPred program (Larsen et al. 2006) with a cutoff of 1.3, and epitopes were considered as those with at least nine continuous amino acids with individual prediction scores above the cutoff. Intrinsically unstructured/disordered regions (IURs) were considered as those with at least nine continuous amino acids with an individual score above 0.5 predicted by IUPred program (Dosztanyi et al. 2005). Parasites L. braziliensis (MHOM/BR/75/M2904) is a reference strain from the Evandro Chagas Institute, Belém, Brazil. This strain was isolated by direct culture from a lesion on the right side of the thorax of a man who had been performing survey work in Serra dos Carajás, Brazilian Amazonia. Parasites were gently provided by Prof. Maria Norma de Melo (UFMG). Promastigote stages were maintained in Schneider’s insect medium (Sigma-Aldrich) supplemented with 10 % inactivated fetal bovine serum, 100 U/mL penicillin and 100 μg/mL streptomycin (Life Technologies) at 23 °C ± 1 °C. Metacyclic promastigote forms were obtained after the purification of stationary cultures of L. braziliensis with peanut lectin, as previously described (Alcolea et al. 2009). Intracellular amastigotes were obtained by infecting 1×105 macrophages with 1×106 stationary promastigotes for 24 to 60 h at 37 °C and 5 % CO2. RNA extraction and quantitative real-time PCR (qRT-PCR) assays Total RNA from the different developmental stages of L. braziliensis was extracted using the Total RNA isolation kit (Macherey-Nagel) according to the manufacturer’s recommendations. cDNA synthesis was carried out using the High Capacity cDNA Reverse Transcription kit (PE Applied Biosystems), and qRT-PCR was performed as previously
described (Menezes-Souza et al. 2012). The primer sequences of the MAPK3 and MAPK4 genes as well as of five constitutive control genes (GAPDH, 18s, α-tubulin, β-tubulin, and Actin) are listed in Table S1. Logarithmic promastigotes were used as a calibrator group by the 2−ΔΔCt method (Bustin et al. 2009). Soluble L. braziliensis antigen (SLbA) A total of 1×1010 L. braziliensis promastigotes were washed three times with cold phosphate-buffered saline followed by three cycles of freezing in liquid nitrogen and thawing (42 °C). After ultrasonication with ten alternating cycles of 30 s at 35 MHz, the lysate was centrifuged at 6,000×g at 4 °C for 15 min. The supernatant containing SLbA was collected, and the protein concentration was estimated using the Pierce™ BCA™ Protein Assay (Thermo Scientific). Cloning, recombinant protein expression, and purification LbMAPK3 and LbMAPK4 genes were amplified from the genomic DNA of L. braziliensis by PCR using the forward (GCTAGCATGCACAAGAGCAACCAGGA) and reverse (GGATCCTTAGTGATGGTGGGCGCTG) primers for MAPK3 and the forward (GCTAGCATGACTCAACTCGT CCCT) and reverse (CTCGAGCTATTCATTCGAATGTGA GTAAGC) primers for MAPK4. NheI and BamHI restriction sites were added to the forward and reverse primers for MAPK3 and NheI and XhoI for MAPK4. The 1,167-kb fragments of MAPK3 and 1,104 kb of MAPK4 were excised from the agarose gel, purified, digested with the restriction enzymes, and ligated to the pET28a-TEV vector previously digested with the same restriction enzymes (Coitinho et al. 2012). Electrocompetent Escherichia coli BL21 Arctic Express (DE3) (Agilent Technologies) cells were transfected with recombinant plasmids by electroporation using a MicroPulser Electroporation Apparatus (Bio-Rad Laboratories). Gene insertion was confirmed by colony PCR and sequencing using T7 primers (Macrogen). Recombinant LbMAPK3 and LbMAPK4 were expressed by adding 1.0 mM Isopropyl-β-D-thiogalactopyranoside (IPTG, Promega) for 24 h at 12 °C with shaking at 200 rpm. The cells were then lysed by sonication and centrifuged at 6,000×g for 30 min at 4 °C. The recombinant proteins were purified using a HisTrap HP affinity column connected to the ÄKTAprime chromatography system (GE Healthcare). The eluted fractions containing recombinant LbMAPK3 (rLbMAPK3) and recombinant LbMAPK4 (rLbMAPK4) were concentrated using Amicon® Ultra 15 Centrifugal Filters 10,000 NMWL (Millipore) and further purified on a SuperdexTM 200 gel filtration column (GE Healthcare).
Appl Microbiol Biotechnol
Peptide synthesis Soluble peptides were manually synthesized in solid phase on a 30-μmol scale using 9-florenyl-methoxy-carbonyl (Fmoc) chemistry (Mendes et al. 2013b; Wellings and Atherton 1997). First, Fmoc-amino acids were activated with a 1:2 solution of Oxyme and DIC. The activated amino acids were incorporated into Rink amide resin with a substitution degree of 0.61. Fmoc deprotection was then performed using 25 % 4methylpiperidine. These steps were repeated until the synthesis of the peptide was complete. The side chain was unprotected and released form the resin by treatment with a solution of 95.0 % trifluoroacetic acid, 2.5 % water, and 2.5 % triisopropylsilane. The peptide was precipitated with cold diisopropyl ether and purified by high-performance liquid chromatography on a C18 reverse-phase column using a gradient program of 0 to 25 % acetonitrile. The peptides were obtained with 90 % purity, as confirmed by mass spectrometry using Autoflex Speed MALDI/TOF equipment.
Fig. 2 Sequence divergence and prediction of B-cell linear epitopes and intrinsically unstructured/disordered regions in L. braziliensis MAPK3 and MAPK4 and its orthologs. a Alignment between L. braziliensis MAPK3 (TritrypDB ID: LbrM.10.0620) and orthologous proteins present in L. infantum (TritrypDB: LinJ.10.0540), T. cruzi (TritrypDB: LinJ.10.0540), H. sapiens (RefSeq ID: NP_620581.1), and C. familiaris (RefSeq ID: NP_001003206.1). b Alignment between L. braziliensis MAPK4 (TritrypDB ID: LbrM.19.1710) and orthologous proteins present in L. infantum (TritrypDB ID: LinJ.19.1480), T. cruzi (TritrypDB ID: TcCLB.511299.70), H. sapiens (RefSeq ID: NP_620581.1), and C. familiaris (RefSeq ID: NP_001003206.1). The yellow boxes mark predicted linear B-cell epitopes, and the gray boxes mark predicted disordered regions. The continuous black underlined amino acid sequences represent potential B-cell epitopes predicted by BepiPred in the MAPK3 and MAPK4 proteins, and green highlight amino acid conservations in the T. cruzi, C. familiaris, and H. sapiens sequences in relation to the L. braziliensis sequence
Initially, recombinant proteins and SLbA were coated onto 96well microplates (Nalge Nunc Intl.) overnight at 2–8 °C at a
concentration of 250 ng/well for rLbMAPK3 and rLbMAPK4 and 50 ng/well for SLbA. For the peptides, flat-bottom plates (Costar®) were coated with 10 μg/well of soluble peptide overnight at 37 °C. After blocking with 5 % BSA in phosphate-buffered saline (PBS) for 1 h at 37 °C, followed by three washing steps with PBS containing 0.05% Tween 20 (PBS-T), the plates were incubated with human or dog serum (dilution 1:100). The plates were washed three times with PBST, and secondary HRP-conjugated antihuman or antidog IgG antibody 1:5,000 was added for 1 h at 37 °C, followed by four
Fig. 1 Pipeline for the identification of new targets for the serodiagnosis of canine and human leishmaniasis The presence of linear B-cell epitopes in Leishmania protein targets (LbMAPK3 and LbMAPK4) were predicted by BepiPred program (a), and orthologous proteins of T. cruzi and mammalian hosts were retrieved from the TritrypDB and NCBI RefSeq using the BLASTp algorithm (b). Leishmania and other orthologous protein sequences were aligned using CLUSTALW (c), and linear B-cell epitopes specific for Leishmania parasites were identified (d and e). The RNA expression level of LbMAPK3 and LbMAPK4 in log-phase and metacyclic promastigotes and amastigotes were measured by real-time
PCR (f) to identify proteins with increased expression in parasite forms present in mammalian host cells. Recombinant proteins produced by heterologous expression in E. coli (g) were used in ELISA protocols (h) to diagnose canine and human leishmaniasis. Synthetic peptides representing linear B-cell epitopes were synthesized by the Fmoc approach (i), and their contribution to the overall antigenic properties of the corresponding recombinant proteins were evaluated by depletion ELISA (j). The performance of specific peptides was also evaluated to serodiagnosis of canine and human leishmaniasis (k)
ELISA and depletion ELISA assay
Appl Microbiol Biotechnol
Appl Microbiol Biotechnol
washes. TMB substrate (Sigma-Aldrich) in citrate buffer containing hydrogen peroxide was used for detection; the reaction was stopped after 30 min with 4 N H2SO4, and the absorbance was measured at 450 nm. For depletion ELISAs, the sera were previously incubated in peptide-coated and blocked plates at a 1:100 dilution and incubated overnight at 2–8 °C. Depleted and undepleted samples were transferred to plates coated overnight with recombinant proteins (50 ng/well) and blocked, and the ELISAs were performed as described above. Statistical analysis The cutoffs for rLbMAPK3, rLbMAPK4, SLbA, and peptide1 and peptide-2 were established for optimal sensitivity and specificity using the receiver-operator curve (ROC) curve. The cutoff was chosen based on the point that provided the maximum of the sum of the sensitivity and specificity (Linnet et al. 2012). The EIE-leishmaniose-visceral-canina-biomanguinhos (EIE-LVC) cutoff was obtained according to the manufacturer (twice the average of the negative control provided by the kit). The performance of each test was evaluated according to the sensitivity (Se), specificity (Sp), positive predictive value (PPV), negative predictive value (NPV), area under the curve (AUC), and accuracy (AC). The degree of agreement between the ELISA assays using the recombinant proteins, SLbA, or the EIE-LVC kit with the parasitological test (biopsy, aspirate, or PCR) was determined by Kappa index (κ) values with 95% confidence intervals and interpreted according to the following Fleiss scale: 0.00– 0.20, poor; 0.21–0.40, fair; 0.41–0.60, moderate; 0.61–0.80, good; 0.81–0.99, very good; and 1.00, perfect. The onesample Kolmogorov-Smirnoff test was used to determine whether a variable was normally distributed. For depletion assays, significant differences were detected using a two-way ANOVA. The differences were considered statistically significant at p
