Am. J. Hum. Genet. 47:536-541, 1990

Linkage to D3S47 (C17) in One large Autosomal Dominant Retinitis Pigmentosa Family and Exclusion in Another: Confirmation of Genetic Heterogeneity D. H. Lester,* C. F. Inglehearn,* R. Bashir,* H. Ackford,* L. Esakowitzt M. Jayt A. C. Bird4 A. F. Wright,§ S. S. Papiha,* and S. S. Bhattacharya* Department of Human Genetics, University of Newcastle upon Tyne; England; TEye Clinic, Royal Alexandria Hospital, Paisley; $Department of Clinical Ophthalmology, Institute of Ophthalmology, Moorfields Eye Hospital, London; and §Medical Research Council Human Genetics Unit, Western General Hospital, Edinburgh

Summary Recently Dryja and his co-workers observed a mutation in the 23d codon of the rhodopsin gene in a proportion of autosomal dominant retinitis pigmentosa (ADRP) patients. Linkage analysis with a rhodopsin-linked probe C17 (D3S47) was carried out in two large British ADRP families, one with diffusetype (D-type) RP and the other with regional-type (R-type) RP. Significantly positive lod scores (lod score maximum [Zm.] = +5.58 at recombination fraction [0] = .0) were obtained between C17 and our D-type ADRP family showing complete penetrance. Sequence and oligonucleotide analysis has, however, shown that no point mutation at the 23d codon exists in affected individuals in our complete-penetrance pedigree, indicating that another rhodopsin mutation is probably responsible for ADRP in this family. Significantly negative lod scores (Z < -2 at 0 = .045) were, however, obtained between C17 and our R-type family which showed incomplete penetrance. Previous results presented by this laboratory also showed no linkage between C17 and another large British R-type ADRP family with incomplete penetrance. This confirms genetic heterogeneity. Some types of ADRP are being caused by different mutations in the rhodopsin locus (3q21-24) or another tightly linked gene in this region, while other types of ADRP are the result of mutations elsewhere in the genome. Introduction

Autosomal dominant retinitis pigmentosa (ADRP) is an inherited slow retinal degenerative disorder with clinical characteristics which include abnormal fundus appearance, narrowed retinal vessels, and changes in the electrophysiological responses of the eyes. Early signs are night blindness and constriction of the visual fields, with a variable age of onset (Merin and Auerbach 1976). It has been suggested that ADRP can be further subdivided into two groups based on age of onset, distribution of pigmentation, and other functional characteristics. Families with type I, or diffuse-type (D-type), Received March 22, 1990; revision received May 17, 1990. Address for correspondence and reprints: Dr. S. S. Bhattacharya, Molecular Genetics Unit, Markham Laboratories, Upper Claremont Street, Newcastle upon Tyne NE2 4AJ, England. 1990 by The American Society of Human Genetics. All rights

0002-9297/90/4703-0017$02.00 536

reserved.

ADRP exhibit a diffuse and severe pattern of loss of rod function, but relatively good preservation of cone function. Night blindness frequently occurs before 10 years, although pigmentary changes may not be evident until the second or third decade of life. ADRP type II, or regional-type (R-type), pedigrees generally have an equal loss of both rod and cone function which is patchy (or "regional") in appearance. (Massof and Finkelstein 1981; Arden et al. 1983; Farber et al. 1985; Lyness et al. 1985). However some R-type or type II ADRP families show variable expressivity with a wide range in the age of onset of symptoms, which occasionally appear to "skip" generations altogether (Daiger et al. 1989; M. Jay, unpublished results). Probably about half the patients diagnosed as having ADRP will be or are registered blind or partially sighted by the age of 40 (Bundey and Crews 1984), accounting for approximately 2% of blindness in the United Kingdom. ADRP can sometimes be distinguished simply by

Molecular Genetic Study of ADRP genetic interpretation of affected family pedigrees from the clinically similar X-linked retinitis pigmentosa (XLRP), autosomal recessive retinitis pigmentosa (ARRP), and nongenetic RP. For example, in a British study of 138 retinitis pigmentosa patients in the city of Birmingham (Bundey and Crews 1984), 22% were classified as having ADRP, 10% were classified ARRP, and 14% were assigned as XLRP. Thirty-seven percent of the RP patients were, however, sporadic cases, without any affected relative and therefore unclassifiable into either a genetic or nongenetic RP category. The remaining 17% of the patients studied were classified as having an autosomal recessive syndrome, such as Usher syndrome (congenital profound deafness and teenage onset of retinitis pigmentosa). The finding of closely linked markers, and the cloning and identification of the genes responsible for the different genetic RPs, will probably lead to more accurate classification and therefore better genetic counseling for RP patients and their families. Recently McWilliam and co-workers (1989) reported strong linkage (lod score maximum [Zmax] = +14.7 at recombination fraction [0] = .00) between ADRP and C17 (D3S47), in a single large type I ADRP pedigree of Irish origin with complete penetrance. This polymorphic DNA marker maps to the long arm of chromosome 3, near the rhodopsin locus which is in the region 3q21-24 (Nathan et al. 1986; Naylor and Bishop 1989). Rhodopsin is an integral membrane protein of the rod outer segment (Nathans and Hogness 1984) and was thus a candidate locus for ADRP. Dryja and his co-workers, using genomic sequencing and oligohybridization, found a single point mutation in the 23d codon of the rhodopsin first exon, changing a proline to a histidine (CCC--CAC), in 17 of 148 ADRP patients (Dryja et al. 1990). Also, 10 affected members of an extended pedigree, of British ancestry, were found to have this mutation, while no unaffected members did. None of the 102 normal controls were found to have the mutation. This point mutation may therefore be the cause of ADRP in a proportion of affected families. The CCC--CAC point mutation in rhodopsin was, however, not found in affected ADRP individuals taken from the large Irish family reported by McWilliam and co-workers (P. Humphries, Trinity College, Dublin, personal communication). Probably another rhodopsin mutation is responsible for ADRP in this family. Our laboratory previously presented evidence for the genetic heterogeneity of ADRP by showing absence of linkage between C17 and ADRP in a single large British family known as ADRP5 with late-onset, R-type

537

ADRP with incomplete penetrance (Inglehearn et al. 1990). This makes it extremely unlikely that a mutation in rhodopsin or any other genes in this region is the cause of ADRP in this particular family. We now present further evidence from two large ADRP pedigrees confirming that C17 is linked to some ADRP families but unlinked to other ADRP families. This demonstrates that rhodopsin mutations are responsible for ADRP in only a proportion of affected families. Material and Methods Family Studies Two large British ADRP families were used in this study (fig. 1). Individuals from the first family (of Irish origin), known as ADRP3, had onset of night blindness in early life to mid-teens, field loss was consistently reported even early in the disease, and pigment migration was identified within 10 years of the symptoms. Comparative rod and cone function tests have confirmed that this family falls into the D-type category. There does appear to be 100% penetrance of the disease in this pedigree. The second family, known as ADRP7, was diagnosed as R-type ADRP with variable expressivity, with age at onset of symptoms from 7 to 53. As a precaution against lack of complete penetrance, in the ADRP3 family only unaffected members over the age of 25 were used, while in the variable-expressivity family ADRP7 only unaffected members over the age of 40 who had been examined by an ophthalmologist were used in the present study. DNA Analysis Aliquots of 5 pg DNA were digested to completion with 20 units MspI restriction enzyme, at room temperature (200-250C), as partials were found to occur at 37°C. Samples were size fractionated on 0.8% or 1% agarose gels and blotted, by the method of Southern (1975) to Hybond-N (Amersham). The first exon of rhodopsin was amplified from 100 ng total genomic DNA by the polymerase chain reaction and dot blotted onto Hybond-N filters using the Bio-Rad dot blot system. The DNA was fixed to the membranes by UV transillumination and prehybridized and hybridized in 2 x 15 ml 0.5 M sodium phosphate buffer, 7% SDS, and 10% dextran sulphate. C17 was oligolabeled by the method of Feinberg and Vogelstein (1983) and competed with sheared total human DNA to block repeat sequences before hybridization (Sealey et al. 1985). Oligonucleotides were end labeled using T4 polynucleotide kinase. (Richardson 1965).

Lester et al.

538

ADRP3 (D)

AD

OD DD

ADRP7 (R)

BD

DD

CD

BD

AD

CD CD

DD DD

DO

AD AD

Segregation of C17 alleles in ADRP3 and ADRP7 pedigrees. DNAs from individuals of these families were digested with Figure I MspI and probed with competed C17 (D3S47). D3S47 has two independent but tightly linked polymorphic systems, Al (14.0 kb), A2 (12.3 kb) and Bi (5.2 kb), B2 (3.5 kb). Since no crossovers between the two C17 MspI allelic systems have been observed (to date, Zmax = +6.02 at 0 = .0), we haplotyped indicated individuals as follows: A = AlBM (.0875), B = A1B2 (.2625), C = A2B1 (.1625) D = A2B2 (.4875). The bracketed figures are allele frequencies observed in a sample of 44 unrelated, "normal" British individuals. The ADRP phenotype appears to be segregating with an A haplotype in the ADRP3 pedigree, with no recombinants being observed. Pedigree ADRP7 shows autosomal dominant segregation of the type 11 (R) phenotype. ADRP does not appear to be segregating with any particular C17 haplotype in the ADRP7 pedigree, and several obligatory crossovers can be observed.

Stringent washes were at 65°C in 0.5 x SSC and 0.1% SDS for Southern blots (fig. 2) and at 50°C for dot blots (fig. 3). Sequence analysis was carried out using T7 DNA polymerase (sequenase). Double-stranded PCR-amplified rhodopsin first exon was purified on a G50 column, heat denatured, then sequenced with an end-labeled internal oligomer (fig. 4). Autoradiographic images were obtained with Kodak XAR5 film. Linkage Analysis

The data-management package LINKSYS (Attwood and Bryant 1988), in conjunction with the programme LIPED (Ott 1974), was used to compute lod scores for the two families. Results and Discussion

As can be seen from table 1, ADRP is significantly linked to the 3q polymorphic marker C17 in the D-type

ADRP3 pedigree (Zmax = +5.58 at 0 = .00). Contrary to findings reported by Dryja et al. (1990) the oligonucleotide and sequencing data shown in figures 3 and 4 show that a rhodopsin mutation in the 23d codon of the rhodopsin gene is not present either in normal or affected members of ADRP3. Another mutation at a different location in the rhodopsin gene is probably responsible for ADRP in this family. These results are similar to those of McWilliam et al. (1989), who, in their large type I (D-type) Irish ADRP family (TCDM1), achieved a Zmax of +14.70 at 0 = .00 with C17 and yet detected no point mutation in the 23d codon of rhodopsin (P. Humphries, Trinity College, Dublin, personal communication). Since ADRP3 is also of Irish origin there is a possibility that the two families are in fact related. However, the maiden name of the affected Irish progenitor of ADRP3 is not shared by any member of TCDM1. Furthermore, while the ADRP disease appears to segregate with the C haplo-

Molecular Genetic Study of ADRP

539

CDI

DD

AD AD -Al -A2

-_B

-B2

Figure 2 Genomic DNAs from ADRP7 digested with MspI and probed with competed C17. One obligatory recombinant can be observed as both affected and unaffected individuals appear to be inheriting the same D haplotype. Haplotypes are as described in figure 1.

type of C17 (12.3-kb and 5.2-kb bands), in TCDM1 it appears to be linked to the A haplotype (14-kb and 5.2-kb bands) in ADRP3. If TCDM1 and ADRP3 were later proved to be part of the same pedigree, this apparent discrepancy could be explained by a recombination event between the ADRP locus and C17 locus, before the ancestors of the ADRP3 pedigree emigrated to Britain. Retinitis pigmentosa researchers are, however, reluctant to pool separate family data due to possible genetic heterogeneity. Recently it has been demonstrated that XLRP maps to not one, but at least two loci, both on the short arm of the X chromosome, one in band Xpll and the other in band Xp21 (Ott et al. 1990). The R-type ADRP7 family, like the previously reported R-type ADRP5 family (Inglehearn et al. 1990), has been shown to be significantly unlinked to C17 and presumably rhodopsin (table 1), with a Z of less than -2.00, the generally accepted value for significant exclusion, at 0 = .045. Conclusions

The results of the three ADRP pedigrees studied so

Figure 3 The rhodopsin first exons from ADRP3 normal (1N, 2N, and 3N) and affected (4A, 5A, 6A, and 7A) individuals DNA amplified using the primers 5' TTCGCAGCATTCTTGGGTGG 3' and 5' ACTCTCCCAGACCCCTCCAT 3'. The DNA was denatured with 0.4 M NaOH, 10 mM EDTA and boiling for 10 min before dot blotting. Blot a was probed with an oligomeric normal probe based on the normal oligo sequence 5' CGCAGCCCCTTCGAG 3', and blot b was probed using another oligo with the 23d-codon mutation 5' GGCAGCCACTTCGAG 3. It can be seen that the mutant oligo appears to hybridize to both affected and unaffected individuals from the ADRP3 pedigree with an equally low intensity compared to that of the normal oligo. This indicates that the 23d codon point mutation is not present in this family.

Lester

540

Figure 4 Sequence analysis of an ADRP3 affected individual showing a normal rhodopsin sequence at and around the 23d codon. Rhodopsin first-exon DNA was amplified as above, and then the sequence was primed with an internal oligomer, 5' GCTAGGTTGAGCAGGATGTA 3'.

Lod Scores between C17 Mspl RFLPs and ADRP Families Studied

0

D-type: ADRP3 ..... TCDM1b R-type: ADRP7 ..... ADRP5C .....

.000

.001

.01

.05

.10

.20

.30

.40

+5.58 +14.70

+5.58 +14.67

+ 5.55 '+ 14

+5.31 +13.54

+4.87 +12.32

+3.77 + 9.68

+2.50 + 6.72

+ 3.38

99.9 - 99.9

- 6.87 - 12.59

-3.88 -7.34

- 1.83 - 3.92

- 1.04 - 2.27

-.42 - .77

-.18 - .18

-.07 +.09

Data are from present study. McWilliam et al. (1989). c Inglehearn et al. (1990). a

b

al.

far by our laboratory (ADRP3, ADRP5, and ADRP7), the single ADRP pedigree TCDM1 described by McWilliam et al. (1989), and the two different ADRP pedigrees (one of which did not appear to segregate with the rhodopsin gene) reported by Dryja et al. (1990), provide clear evidence for the existence of at least two different and unlinked loci for the ADRP defect. The results shown in table 1 suggest that some ADRP phenotypes may result from different mutations in the rhodopsin gene, all of which should segregate with the closely linked C17 locus. R-type ADRP with variable expressivity has now been shown not to be linked to C17 in two families, so that it is highly unlikely to be caused by a rhodopsin mutation. This must therefore map at another locus or at other loci in the human genome. Recently, however, results presented by Olsson et al. (1990) showed linkage (Zmax = 4.78 at 0 = .08) in a type II ADRP family with full penetrance. Thus it remains possible that some type II ADRP defects originate in the 3q21-24 area, possibly in the rhodopsin gene itself, although this result also raises the possibility of a second gene some distance from C17. The locus causing type II ADRP in Olsson et al.'s family, from this evidence, must, however, be different from the locus causing ADRP in our variably expressive ADRP5 and ADRP7 type II pedigrees, since these two families are significantly unlinked to the C17 locus (table 1). Reduced levels of rhodopsin have been observed in RP patients (Kemp et al. 1984; Kemp et al. 1988), giving weight to the finding that a point mutation in rhodopsin is the causative defect in some ADRP patients. How a single mutation, in one of the allefic pair of rhodopsin genes, causes ADRP, a slow progressive domi-

Table I

ADRP FAMILY

et

+1.11

Molecular Genetic Study of ADRP nant blinding disorder, is as yet unknown. We are presently sequencing the rhodopsin gene of a patient taken from our ADRP3 family (linked to C17) in order to find if another mutation is responsible for the disease in this family. Also, further linkage studies with C17, the rhodopsin microsatellite region (Weber and May 1989), and other rhodopsin-linked probes are being continued in other ADRP families in our laboratory. This should shed further light on the possible relationship between phenotypic and genetic variation in ADRP. Meanwhile, the search for linkage in the rhodopsin (and C17) unlinked families (i.e., ADRPS and ADRP7) with variable expressivity is being continued with polymorphic probes at other regions of the genome.

Acknowledgments We gratefully acknowledge the generous support provided by the National Retinitis Pigmentosa Foundation Fighting Blindness USA and the George Gund Foundation for funding this research. Thanks also go to Professor Calbert Phillips, Mr. Tony Moore and Professor Barry Jay for clinical details and help with collecting the families described, to Anthea Stephenson for assistance with linkage analysis, and to Pauline Battista for typing. Thanks to Grampian Health Board (Scotland) for support to L.E.

References Arden GB, Carter RM, Hogg CR, Powell DJ, Ernst WKJ, Clover GM, Lyness AL, et al (1983) Rod and cone activity in patients with dominantly inherited retinitis pigmentosa: comparisons between psychophysical and electroretinographic measurements. Br J Ophthalmol 67:405-418 Attwood J, Bryant S (1988) A computer programme to make analysis with LIPED and LINKAGE easier to perform and less prone to input errors. Ann Hum Genet 52:259 Bundey S, Crews SJ (1984) A study of retinitis pigmentosa in the city of Birmingham. II. Clinical and genetic heterogeneity. J Med Genet 21:421-428 Daiger SP, Humphries MM, Gieserschlay N, Sharp E, McWilliam P, Farrer J, Bradley D, et al (1989) Linkage analysis of human chromosome 4: exclusion of autosomal dominant retinitis pigmentosa (ADRP) and detection of new linkage groups. Cytogenet Cell Genet 50:181-187 Dryja TP, McGee TL, Reichel E, Hahn LB, Cowley GS, Yandell DW, Sandberg MA, et al (1990) A point mutation of the rhodopsin gene in one form of retinitis pigmentosa. Nature 343: 364-366 Farber MD, Fishman GA, Weiss RW (1985) Autosomal dominantly inherited retinitis pigmentosa: visual acuity loss by subtype. Arch Ophthalmol 103:524-528 Feinberg AP, Vogelstein B (1983) A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6-13

541 Inglehearn CF, Jay M, Lester DH, Bashir R, Jay B, Bird AC, Wright AF, et al (1990) No evidence for linkage between late onset autosomal dominant retinitis pigmentosa and chromosome 3 locus D3S47 (C17): evidence for genetic heterogeneity. Genomics 6:168-173 Kemp CM, Faulkner DJ, Jacobson SG (1984) Visual pigment levels in retinitis pigmentosa. Trans Ophthalmol Soc UK 103:453-457 Kemp CM, Jacobson SG, Faulkner DJ (1988) Two types of visual dysfunction in autosomal dominant retinitis pigmentosa. Invest Ophthalmol Vis Sci 29:1235-1241 Lyness AL, Ernst W, Quinlan MP, Glover GM, Arden GB, Carter RM, Bird AC, et al (1985) A clinical, psychophysical and electroretinographic survey of patients with autosomal dominant retinitis pigmentosa. Br J Ophthalmol 69:326-339 McWilliam P, Farrar GJ, Kenna P, Bradley DJ, Marian MM, Sharp EM, McConnel DJ, et al (1989) Autosomal dominant retinitis pigmentosa (ADRP): localisation of an ADRP gene to the long arm of chromosome 3. Genomics 5: 619-622 Massof RW, Finkelstein D (1981) Two forms of autosomal dominant retinitis pigmentosa. Doc Ophthalmol 51:289-346 Merin S, Auerbach E (1976) Retinitis pigmentosa. Surv Ophthalmol 20:303-346 Nathans J, Hogness DS (1984) Isolation and nucleotide sequence of the gene encoding human rhodopsin. Proc Natl Acad Sci USA 81:4851-4855 Nathans J, Piantanida TP, Eddy RL, Shows TB, Hogness DS (1986) Molecular genetics of inherited variation in human colour vision. Science 232:203-210 Naylor SL, Bishop DT (1989) Report of the committee on the genetic constitution of chromosome 3. Cytogenet Cell Genet 51:106-120 Olsson JE, Samanns CH, Jiminez J, Pongratz J, Chand A, Watty A, Seuchter SA, et al (1990) Gene of type II autosomal dominant retinitis pigmentosa maps on the long arm of chromosome 3. Am J Med Genet 35:595-599 Ott J (1974) Estimation of the recombination fraction in human pedigrees: efficient computation of the likelihood for human linkage studies. Am J Hum Genet 26:588-597 Ott J, Bhattacharya S, Chen JD, Denton MJ, Donald J, Dubay C, Farrar CJ, et al (1990) Localizing multiple X-chromosome linked retinitis pigmentosa loci using multilocus homogeneity tests. Proc Natl Acad Sci USA 87:701-704 Richardson CC (1965) Phosphorylation of nucleic acid by an enzyme from T4 bacteriophage-infected Escherichia coli. Proc Natl Acad Sci USA 54:158-165 Sealey PG, Whittaker PA, Southern EM (1985) Removal of repeat sequences from hybridisation probes. Nucleic Acids Res 13:1905-1922 Southern EM (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503-517 Weber JL, May PE (1989) Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am J Hum Genet 44:388-396