Lipoprotein Lipase Gene Expression in Rat Adipocytes Is Regulated by Isoproterenol and Insulin through Different Mechanisms

Mary V. Raynolds, Paul D. Awald, David F. Gordon, Arthur Gutierrez-Hartmann*, Daniel C. Rule, William M. Wood, and Robert H. Eckel Division of Endocrinology, Department of Medicine (M.V.R., D.F.G., A.G.-H., W.M.W., R.H.E.) Departments of Cellular and Structural Biology (P.D.A.) and Biochemistry, Biophysics, and Genetics (A.G.-H., R.H.E.) University of Colorado Health Sciences Center Denver, Colorado 80262 Department of Animal Science University of Wyoming (D.C.R.) Laramie, Wyoming 82063

and myocytes, secreted by these cells, and bound to glycosamino-glycans on the luminal side of capillary endothelial cells. After activation by apolipoprotein-CII, LPL hydrolyzes triglycerides in the core of chylomicrons and very low density lipoprotein particles, releasing FFA for uptake by tissues. The FFA released by LPL-mediated hydrolysis are taken up by the cells of LPL origin for reesterification and storage in adipocytes, or fuel in muscle cells (1). LPL is regulated differently in adipose tissue by insulin and catecholamines. Insulin increases LPL enzyme activity in adipocytes, whereas catecholamines decrease LPL activity (2). The major effect of insulin is to increase the synthesis rate of the enzyme (3). Recent work has also documented increases in steady state levels of LPL mRNA after insulin treatment of rat adipocytes (3). The catecholamine-mediated decrease in LPL enzyme activity has been attributed to changes in activation and secretion of the enzyme (4), not to changes in the synthesis of LPL. The mechanisms through which catecholamines and insulin inversely control LPL activity are important for understanding hormone-mediated metabolic changes in the adipocyte. In this report regulation of LPL gene expression in adipocytes by isoproterenol, a j8-adrenergic agonist, and insulin has been assessed to determine whether these two effectors act through similar or different mechanisms.

Lipoprotein lipase (LPL) is highly regulated by catecholamines and insulin in adipocytes. Isoproterenol, a 0-adrenergic agonist, decreases LPL enzyme activity, whereas insulin increases LPL activity. We have isolated an 868-basepair rat LPL cDNA clone to assess hormone-mediated changes in LPL steady state mRNA levels and LPL gene transcription rates in adipocytes. Northern blot analysis of isoproterenol-treated (10~6 M) adipocytes showed that LPL steady state mRNA decreased by 15 min. Nuclear run-on transcription assays in isoproterenol-treated cells indicated that LPL gene transcription was also decreased at 15 min compared to that in control cells. Conversely, insulin (6.7 x 10~s M) mediated an increase in LPL steady state mRNA in treated adipocytes, yet LPL gene transcription was not different from that in control cells. Thus, the isoproterenolmediated decrease in LPL enzyme activity and steady state mRNA levels in adipocytes is associated with decreases in LPL gene transcription. Insulin, which does not affect LPL gene transcription, increases LPL enzyme activity and steady state mRNA levels. The effect of insulin on LPL mRNA is probably due to insulin-induced changes in mRNA stability. (Molecular Endocrinology 4: 1416-1422, 1990)

INTRODUCTION Lipoprotein lipase (LPL) is a key enzyme in lipoprotein metabolism. LPL is synthesized primarily by adipocytes

RESULTS

0888-8809/90/1416-1422$02.00/0 Molecular Endocrinology Copyright © 1990 by The Endocrine Society

To study the hormonal regulation of LPL gene expression at the mRNA level, we first cloned and isolated an 1416

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 19 November 2015. at 21:37 For personal use only. No other uses without permission. . All rights reserved.

1417

Regulation of LPL Gene Expression in Adipocytes

868-basepair (bp) LPL cDNA fragment for use as a hybridization probe in Northern analyses. The sequence is shown in Fig. 1. After screening a rat heart cDNA library in a Xgt10 bacteriophage vector with a radiolabeled antisense oligonucleotide derived from the published human sequence (5), one independent positive clone was identified and purified. The clone spanned the last 420 bp of the coding region (comprising 140 amino acids at the carboxy-terminus of the protein) and the first 448 bp of the 3' untranslated region. The nucleotide sequence of the rat LPL cDNA segment described here was found to be homologous to the cDNA sequences reported for other species: 84% similar to human (5), 94% similar to mouse (6), 8 1 % similar to bovine (7), and 84% similar to guinea pig (8). The amino acid sequence of this enzyme is also highly conserved across species boundaries. We have used this rat LPL cDNA as a probe for Northern analysis of LPL mRNA levels in rat adipocytes, with and without hormone treatment. Treatment of epididymal adipocytes with isoproterenol, a /3-adrenergic agonist, reduced both LPL enzyme activity and mRNA. Figures 2 and 3 show the time-dependent decrease in both enzyme activity (Fig. 2) and steady state mRNA (Fig. 3). Initial experiments in which adipocytes were treated with 10"5 M isoproterenol showed a timedependent decrease in LPL enzyme activity (Fig. 2) Studies of the effects of isoproterenol on LPL mRNA were performed using a concentration of 10" 6 M. LPL enzyme activity at this dose (10~6 M) decreased in a

LPL:

CGTGCCCTACAAAGTATTCCATTACCAAGTCAAG ATTCACTTTTCTGGAACTG A V P Y K V F H Y Q V K I H F S G T E

GAATGACAAGCAAAACAACCAGGCCTTCGAGATTTCTCTGTATGGCACAGTGGCTGAAAG N D K Q N N Q A F E I S L Y G T V A E S

75

25

240

120

minutes after isoproterenol addition Fig. 2. LPL Enzyme Activity in Epididymal Adipocytes Treated with Isoproterenol (10~5 M) O, Enzyme activity in treated cells, expressed as a percentage of the LPL activity in control cells (untreated cells harvested at the same time). The data are the mean of five independent experiments (±SEM).

«-.

100 -

cc E u

Lipoprotein lipase gene expression in rat adipocytes is regulated by isoproterenol and insulin through different mechanisms.

Lipoprotein lipase (LPL) is highly regulated by catecholamines and insulin in adipocytes. Isoproterenol, a beta-adrenergic agonist, decreases LPL enzy...
824KB Sizes 0 Downloads 0 Views