Neuron, Vol. 5, 267-281,September,1990,Copyright© 1990by Cell Press

Localization of FGF Receptor mRNA in the Adult Rat Central Nervous System by In Situ Hybridization Akio Wanaka,* Eugene M. Johnson, Jr.* and Jeffrey Milbrandt~* * Department of Pharmacology t Department of Pathology Department of Internal Medicine Washington University School of Medicine St. Louis, Missouri 63110

Summary Fibroblast growth factor receptor (FG F-R) mRNA expression was examined in the adult rat CNS. Northern blot analysis showed a distinct 4.3 kb transcript in various CNS regions. In situ hybridization revealed widely distributed, but specific, populations of cells that express FGF-R mRNA. The most intense hybridization signals were observed in the hippocampus and in the pontine cholinergic neurons. The limbic system and brainstem nuclei, including motor nuclei, showed robust labeling. Cerebellar granule cells and spinal cord neurons were positive for FGF-R mRNA. The distribution of FGF-R mRNA differed significantly from that of NGF receptor mRNA; particularly, no hybridization signal was detected in basal forebrain cholinergic neurons. These results strongly suggest that FGF or FGF-like molecules may exert effects on specific neuronal populations in the mature CNS. Introduction Fibroblast growth factors (FGFs) are members of a family of pluripotent growth factors. Since FGF was first identified as a peptide with mitogenic activity for fibroblasts in brain extracts (Gospodarowicz, 1974), a wide variety of biological functions have been reported (for review see Gospodarowicz et al., 1987). For example, FGF serves as a potent mitogen or differentiation factor for mesoderm- and neuroectoderm-derived cells in culture (Baird et al., 1986; Gospodarowicz et al., 1987). In PC12 cells, basic FGF (bFGF) induces neurite outgrowth and ornithine decarboxylase activity in a manner similar to that caused by nerve growth factor (Togari et al., 1983, 1985; Rydel and Greene, 1987; Schubert et al., 1987). Subsequent study revealed that acidic FGF (aFGF) produced similar effects on PC12 cells (Wagner and D~more, 1986). Recently, bFGF and aFGF were found to have survival and/or differentiation effects on primary neuronal cultures of the CNS (Morrison et al., 1986; Walicke et al., 1986; Unsicker et al., 1987; Hatten et al., 1988; Walicke, 1988; Walicke and Baird , 1988; Ferrari et al., 1989; Mattson et al., 1989; Torres-Aleman et al., 1990). A survey of the effects of bFGF and aFGF on multiple regions of the embryonic day 18 (E18) fetal rat brain demonstrated that both FGFs are potent in vitro neurotrophic factors for cells from hippocampus, sev-

eral cortical regions, striatum, septum, and thalamus (Walicke, 1988). In cultured hippocampal neurons, bFGF not only affects survival and neurite outgrowth, but also antagonizes the excitotoxicity of glutamate (Mattson et al., 1989). Basic FGF also supports the survival of a population of spinal cord neurons (Unsicker et al., 1987), mesencephalic dopaminergic and GABAergic neurons (Ferrari et al., 1989), cerebellar granule cells (Hatten et al., 1988), and hypothalamic neurons (Torres-Aleman et al., 1990). Although a substantial number of nonneuronal cells are present in these culture systems and bFGF can influence these cells, it is likely that bFGF acts directly on some of these neuronal populations (Walicke and Baird, 1988). In addition to these in vitro studies, very intriguing in vivo experiments have shown that a continuous infusion of bFGF into the cerebral ventricle rescues axotomized (fimbria-fornix-transected) basal forebrain cholinergic neurons, suggesting that bFGF may serve as a neurotrophic factor even in the mature CNS (Anderson et al., 1988). To understand the functions of FGF in the mature CNS, it is necessary to identify cells that express the FGF receptor (FGF-R) and are therefore able to respond to FGE The recent purification and cDNA cloning of chicken bFGF-R now makes this possible (Lee et al., 1989). Furthermore, the human fig gene (Ruta et al., 1988) has considerable homology with the chicken bFGF-R sequence, suggesting that fig encodes the human bFGF-R (Lee et al., 1989). To obtain probes for in situ localization of FGF-R mRNA, we first isolated a partial clone of fig from human endothelial cell mRNA using the polymerase chain reaction (PCR). A rat embryonic brain cDNA library was screened with this fig clone to obtain a rat FGF-R clone. We examined the expression of the rat FGF-R mRNA in the rat CNS by Northern blot analysis and in situ hybridization. Northern blot analysis showed one major and three minor species of transcript in the CNS. In situ hybridization revealed that this receptor mRNA is expressed in a large number of specific neuronal populations of the adult rat CNS.

Results Sequence Comparison between Rat, Human, and Mouse FGF-R cDNA Analysis of the amino acid sequence of the chicken FGF-R demonstrated that it is homologous to the human fig gene (Lee et al., 1989), suggesting that fig encodes the human FGF-R. To begin our studies on the expression of the FGF-R, probes for both the human and the rat FGF-R, corresponding to a region that encompasses the highly conserved transmembrane domain, were obtained by the PCR. The nucleotide sequences of both the human and rat PCR products were determined to confirm their identity as the hu-

Neuron 268

A 50

Mouse cDNA 657

957

1257

2526

'm'

,, , :

,J ,,

,

~S~I

I

Tr. . . . . . b.... domain

prFGFR Pvull

~-sq i

,11

phFGFR

i*ASHincII

B

28S

1

23

456

--

m a n fig gene a n d its rat h o m o l o g . W h e n t h e rat FGF-R s e q u e n c e was c o m p a r e d to t h e h u m a n (Ruta et al., 1988) and m o u s e (Reid et al., 1990) s e q u e n c e s , it was

Figure1. Schematic Diagram of FGF-R cDNAs and Northern Analysis (A) Diagram illustrating rat (prFGFR) and human (phFGFR) FGF-R cDNAs. Their locations relative to the mouse bFGF-R cDNA are indicated. The sites of the restriction enzyme digestion (Pvull or Hincll) are indicated on the human cDNA. AS, antisense probe; S, sense probe. The nucleotide sequence of prFGFR is as follows: 5'-G GTCCAGAGAACTTGC CGTATGTCCAGATCCTCAAGACTGCTGGAGTFAATACCGACAAG GAAATGGAGGTGCTTCATCTACGGAATGTCTCCTTTGAGGATGC GG G GGAGTATAC GTGCTTGG C GGGTAACTCTATCGGACTCTCC CATCACTCTGCATGGTTGACC GTTCTGGAAG CCCTG GAAGAGAGACCAG CCGTGATGAC CTCACCTCTGTACCTGGAAATCATFATCTACTGCACC GGG GCCTTCCTGATCTCCTGTATGGTGG GCTCC GTCATCATCTACAAGATGAAG-3'. The deduced amino acid sequence (single letter code) of prFGFR is as follows: GPDN LPYVQ/LKTAGVNTTDKEM EVLHLRNVSFEDAGEYTCLAGNSIG LSH H SAWLTVLEALEERPAVMTSPLYLEII IYCTGAFLISCMVGSVl IYKMK. Comparison of this amino acid sequence with the corresponding routine sequences revealed a single change at residue 391: V to L (rat to mouse). All nucleotide and amino acid numbers are according to Reid et al. (1990). (B) Total RNA from liver (lane 1), cerebral cortrex (lane 2), hippocampus (lane 3), midbrain (lane 4), cerebellum (lane 5), or brainstem (lane 6) was probed with 32p_ labeled cRNA for rat FGF-R (A). Position of 28S ribosomal RNA is shown on the left side as a molecular size marker. Arrowheads on the right side indicate 11.5, 6.7, 5.3, and 4.3 kb bands from the top to the bottom of the figure.

f o u n d to be 91% a n d 97% h o m o l o g o u s , respectively, over t h e 300 n u c l e o t i d e span we have a n a l y z e d (see Figure 1). T h e in situ h y b r i d i z a t i o n p r o b e s t h a t w e

Figure 2. Specificity Control of In Situ Hybridization Histochemistry Dark-field photomicrographs of the hippocampal sections hybridized with sense probe (A) or antisense (B) probe. Bar, 200 p.m.

In Situ Localization of FGF-R mRNA in Adult Rat CNS 269

Figure 3. In Situ Localization of FGF-R Transcripts in the Telencephalon (A) Dark-field photomicrograph of the hippocampus. I, CA1 region; 4, CA4 region; dg, dentate gyrus. Note that hybridization signal of the CA4 region is stronger than that of the CA1 or the dentate gyrus. (B) Bright-field photomicrograph of the hippocampus. Silver grains are observed on the cell bodies of the CA4 region (arrows) and the dentate gyrus. (C) Dark-field photomicrograph of tenia tecta. Intense labeling is seen on the neurons. (D and E) Olfactory bulb sections hybridized with bFGF-R probe. Intense labeling is observed (E) on the mitral cell layer (m) and inner granular layer (ig). (F and G) Dark-field photomicrographs of the island of Calleja. Arrowheads in (F) indicate clustered neurons of the island of Calleja, and arrows in (G) indicate individual, labeled neurons. Bars, 200 p,m (A, C, D, E, F, and G); 50 l~m (B).

Neuron 270

Table 1. Distribution of FGF-R mRNA in the Adult Rat CNS

Tissue Telencephalon Olfactory bulb Inner granular layer Mitral cell layer Tenia tecta Islands of Calleja (see text) Primary olfactory cortex Bed nucleus of stria terminalis (medial part) Hippocampus CA1, CA2 regions CA3, CA4 regions Dentate gyrus Subiculum Cerebral cortex Layer 1 Layers 2-4 Layers 5,6 (Cingulate and entorhinal cortices) Amygdaloid complex Central Medial Cortical Diencephalon Medial preoptic area Supraoptic nucleus Paraventricular hypothalamic nucleus Dorsomedial hypothalamic nucleus Median eminence arcuate nucleus Medial habenular nucleus Lateral mammillary nucleus Medial mammillary nucleus (medial part) Mesencephalon Substantia nigra (compact part) Ventral tegmental area Interpeduncular nucleus (central) Oculomotor nucleus Dorsal raphe nucleus Pontine nucleus Trochlear nucleus

Relative Intensity of Labeling

++ ++ ++ + _+ ++ + + + +

+ ++ + +

_+ + ++ ++ ++ + + _+ ++ ++ + +++ + ++ + + + + _+ + + ++ + (continued)

have g e n e r a t e d f r o m t h e s e c D N A f r a g m e n t s , a l o n g w i t h t h e i r l o c a t i o n relative t o t h e m o u s e FGF-R c D N A s e q u e n c e , are s h o w n in Figure 1A.

FGF-R mRNA Expression in the Nervous System: Northern Blot Analysis To d e t e r m i n e t h e s p e c i f i c i t y of t h e p r o b e w e g e n e r ated, RNA transfer analysis was p e r f o r m e d using RNAs obtained from cerebral cortex, hippocampus, midb r a i n , c e r e b e l l u m , a n d b r a i n s t e m (Figure 1B). Inspect i o n of t h e a u t o r a d i o g r a m r e v e a l e d t h a t each b r a i n reg i o n e x p r e s s e d p r e d o m i n a n t l y a 4.3 k b species, w h i c h m a y c o n s i s t of b o t h FGF-R m R N A s a n a l y z e d by Reid et al. (1990). In a d d i t i o n , w e c o n s i s t e n t l y d e t e c t e d several o t h e r m i n o r species m i g r a t i n g at 5.3, 6.7, a n d 11.5 k b (Figure 1B). T h e s e results are c o n s i s t e n t w i t h t h o s e

Table 1. Continued

Tissue Parabigeminal nucleus Laterodorsal tegmental nucleus Pedunculopontine tegmental nucleus Rombencephalon Motor trigeminal nucleus Principal sensory trigeminal nucleus Locus ceruleus Cerebellum Granule cell layer Purkinje cell layer Deep cerebellar nuclei Ventral cochlear nucleus Vestibular nuclei Facial nucleus Spinal trigeminal nucleus Abducens nucleus Prepositus hypoglossal nucleus Ambiguus nucleus Inferior olive Solitary tract nucleus External cuneate nucleus Dorsal motor nucleus of vagus nerve Hypoglossal nucleus Lateral reticular nucleus Spinal cord Layer 1 Layer 2 Layers 3-8 Layer 9 Layer 10 Circumventricular organs Subfornical organ OVLT Area postrema Nonneuronal cells Choroid plexus Ependymal cells Meningeal cells

Relative Intensity of Labeling + +++ +++ ++ + ++ ++ + ++ + ++ + ++ + ++ + ++ + ++ ++ ++ + + ++ + ++ ++ ++ +++ +++ +++

Relative intensity of labeling: very strong, + + +; strong to moderate, + +; moderate to weak, +; weak and diffuse, +; undetected, - .

o b s e r v e d by Reid et al. (1990) in m u r i n e e m b r y o n i c b r a i n s and n e u r o e p i t h e l i a l cell lines a n d are i m p o r t a n t t o c o n s i d e r w h e n i n t e r p r e t i n g t h e s e in situ hyb r i d i z a t i o n e x p e r i m e n t s (see Discussion).

FGF-R mRNA Expression in the Nervous System: In Situ Hybridization Histochemistry

Telencephalon T h e m o s t p r o m i n e n t l y l a b e l e d area in t h e t e l e n c e p h a Ion was t h e h i p p o c a m p a l f o r m a t i o n . Figure 2B s h o w s t h a t all C o r n u A m m o n ' s h o r n (CA) r e g i o n s a n d t h e d e n t a t e g y r u s w e r e i n t e n s e l y l a b e l e d , b u t each disp l a y e d r e g i o n a l d i f f e r e n c e s in i n t e n s i t y (Figure 2A s h o w s c o n t r o l s e c t i o n h y b r i d i z e d w i t h sense p r o b e ) . A m o n g h i p p o c a m p a l s u b d i v i s i o n s , t h e CA3 a n d CA4 r e g i o n s s h o w e d t h e h i g h e s t level of silver g r a i n ac-

In Situ Localizationof FGF-RmRNA in Adult Rat CNS 271

Figure 4. In Situ Localization of FGF-RTranscripts in the Bed Nucleus of Stria Terminalis and the Amygdala (A) Dark-field photomicrograph of the medial part of the bed nucleus of stria terminalis, iv, lateral ventricle. (B) Dark-field photomicrograph of the amygdala central nucleus. The neurons are labeled intensely. (C) Dark-field photomicrograph of the amygdala medial and cortical nuclei. Moderate and diffuse labeling is observed. (D) High power magnification of the amygdala central nucleus. Bars, 200 ~m.

cumulation, whereas the CA1 and CA2 regions and the dentate gyrus were less intensely labeled (Figure 3A; Table 1). This distribution pattern of FGF-R mRNA was identical t h r o u g h o u t the rostro-caudal extent of the hippocampus. These findings are consistent w i t h the demonstration that FGF supports the survival of hippocampal neurons cultured in vitro (Walicke, et al., 1986; Walicke, 1988; Mattson et al., 1989).

In the olfactory bulb, dense labeling was observed in the inner granular and mitral cell layers (Figures 3D and 3E; Table 1), whereas the glomerular and the external and internal plexiform layers were not labeled. There were scattered small cells in the islands of Calleja that accumulated silver grains (Figures 3F and 3G), and tenia tectum neurons were also labeled (Figure 3C). No significant signal was found in the cau-

Neuron 272

i

F

Figure 5. In Situ Localization of FGF-R Transcripts in the Cerebral Cortex and Diencephalon (A) Dark-field photomicrographs of the frontal cortex. Note that layer 1 shows a low level of hybridization signal and layers 2-4 show moderate, diffuse labeling. Large neurons in layer 5 are labeled. 5, layer 5; 6, layer 6. (B) Dark-field photomicrograph of the habenular nucleus, m, medial habenular nucleus; I, lateral habenular nucleus. Note that the medial habenular nucleus is labeled intensely, whereas the lateral nucleus lacks labeling. The choroid plexus also shows intense labeling. (C) Dark-field photomicrograph of the supraoptic nucleus, oc, optic chiasm; bv, cerebral artery. Arrows indicate intense labeling on the meningeal cells. (D) Dark-field photomicrograph of the hypothalamus. The caudal portion of the dorsomedial hypothalamic nucleus is labeled. The median eminence is also intensely labeled. (E) Dark-field photomicrograph of the arcuate nucleus. Diffuse labeling can be seen. (F) Bright-field photomicrographs of the median eminence. 3V, third ventricle; i, inner layer of the median eminence; e, external layer of the median eminence. The hybridization signal is observed mainly in the external layer. Note the intense labeling on the ependymal cells. Bars, 200 I~m.

In Situ Localization of FGF-R mRNA in Adult Rat CNS 273

date-putamen, septal nucleus (lateral and medial), or nucleus of diagonal band (both vertical and horizontal limb; Table 1). More caudally, the medial part of the bed nucleus of stria terminalis was densely labeled (Figure 4A), but no signal was detected in the lateral part. In the amygdaloid complex, the neurons containing FGF-R mRNA were located in the central nucleus (Figures 4B and 4D). Although we identified moderate, diffuse labeling in the medial and cortical nuclei (Figure 4C), other subnuclei, such as the basolateral or lateral nuclei, were devoid of specific signal. It should be noted that the bed nucleus of stria terminails, olfactory bulb, and amygdala nuclei are known to have fiber connections with each other and are involved in emotion or learning (Smythies, 1970). The cerebral cortex generally showed diffuse labeling such that we are unable to identify the type(s) of cells (neurons, astrocytes, or capillary endothelial cells) expressing FGF-R mRNA. However, the fifth and sixth cortical layers, including a number of large neurons in the fifth layer known to be long-projecting neurons, showed relatively strong signals compared with other layers (Figure 5A). We also found distinct labeling of neurons located adjacent to the corpus callosum. Within the cerebral cortex, the intensity of labeling was strongest in the cingulate and entorhinal cortices.

Diencephalon Several hypothalamic nuclei were positive for FGF-R mRNA. Most rostrally, the medial preoptic area was positive, but the signal was weak and diffuse (Table 1). The paraventricular hypothalamic nucleus and supraoptic nucleus were both labeled moderately to strongly (Figure 5C). These nuclei project to the neurohypophysis of the pituitary gland, which contains significant amounts of FGF (Gospodarowicz et al., 1987), suggesting that FGF-mediated interactions between these nuclei and the neurohypophysis may exist. The median eminence, another neuroendocrine-related structure, showed intense labeling (Figures 5D and 5F). Although the type of cells expressing FGF-R mRNA in this region is not clear, the positive cells are predominantly located in the external layer (Figure 5F). It is likely that this strong labeling represents endothelial FGF-R mRNA present in the vessels that belong to the hypophyseal portal system. Dorsomedial hypothalamic and arcuate nuclei showed diffuse labeling (Figures 5D and 5E). In the rnammillary body, only the neurons of the lateral mammillary nucleus and the medial part of the medial mammillary nucleus were identified as FGF-R mRNA-positive (Table 1). In the thalamus, the only FGF-R mRNA-positive region was the medial habenular nucleus (Figure 5B); the lateral habenular nucleus was negative. Since these two nuclei are known to project to different areas (the medial habenular nucleus projects exclusively to the interpeduncular nucleus, whereas the lateral nucleus projects mainly to the reticular and raphe nuclei in the midbrain), the difference in FGF-R mRNA expression may reflect the difference in their terminal fields.

Mesencephalon In the mesencephalic region, very intense labeling was found in the pedunculopontine and laterodorsal tegmental nuclei (Figures 6D, 6E, 61=,and 6G). These nuclei contain cholinergic neurons and are thought to be involved in sleep functions (Hobson, 1990). Intense labeling was also localized in the pontine nucleus (Figure 6C). The neurons of the substantia nigra and ventral tegmental area, regions known to contain dopaminergic neurons, showed moderate labeling (Figure 6A). The interpeduncular nucleus was generally devoid of detectable FGF-R mRNA, except for a weak, diffuse signal observed in the central subnucleus (Table 1). Motor nuclei, such as the oculomotor and trochlear nuclei, were labeled moderately (Table 1). The dorsal raphe neurons, which are serotonergic, were identified as FGF-R mRNA-positive cells (Figure 6B). The neurons in the parabigeminal nucleus had weak labeling (Table 1). The trigeminal mesencephalic nucleus, previously shown to express high level of nerve growth factor receptor (NGF-R) message (Koh et al., 1989), was devoid of FGF-R mRNA expression. Other structures in the mesencephalon, such as the superior colliculus, geniculate bodies, inferior colliculus, cuneiform nucleus, and pontine reticular formation, failed to show any specific signal for FGF-R message.

Rhombencephalon Motor nuclei, such as the motor trigeminal nucleus, facial nucleus (Figure 7D), abducens nucleus, prepositus hypoglossal nucleus, ambiguus nucleus, hypoglossal nucleus (Figures 7E and 7F), and dorsal motor nucleus of vagus nerve (Figure 7F), were labeled intensely, in contrast to the motoneurons in the mesencephalic region. The ventral cochlear nucleus was labeled intensely (Figure 7C), and the vestibular nuclei were moderately labeled (Table 1). The neurons in the locus coelureus expressed a significant amount of bFGF-R message (Figures 7A and 7B), but subceruleus neurons failed to show any positivity. The solitary tract nucleus contained FGF-R mRNA-positive neurons (Figures 7E and 7F). In the cerebellum, intense labeling was observed in the granule cell layer (Figures 8C and 8D), whereas the Purkinje cell and molecular layers expressed little FGF-R mRNA (Figure 8D). The deep cerebellar nuclei and the inferior olive, structures functionally related to the cerebellum, showed moderate labeling (Table 1). In the principal sensory trigeminal and spinal trigeminal nuclei, we observed a weak signal in neurons. The caudal part of the spinal t'rigeminal nucleus (Figure 8A) contaiffed more FGF-R mRNA than did the oral and interpolar parts. In the caudal region of the brainstem, intense labeling was observed in the external cuneate and lateral reticular nuclei (Figures 8A and 8B) and in motoneurons.

Spinal cord In the spinal cord, several neuronal types were labeled (Figure 8E). This hybridization pattern was similar from the upper cervical to the sacral region. We

Neuron 274

Figure 6. FGF-R mRNA Expression in the Mesencephalon (A) Dark-field photomicrograph of the substantia nigra and ventral tegmental area. Arrow indicates the ventral tegmental area, and arrowheads indicate the compact part of the substantia nigra. (B) Dark-field photomicrograph of the dorsal raphe nucleus. The neurons are labeled moderately. (C) Dark-field photomicrograph of the pontine nucleus. The neurons are labeled intensely. (D-G) Dark-field photomicrographs showing the strong labeling of the pedunculopontine (D and E) and laterodorsal tegmental (E-G) nuclei, scp: superior cerebellar peduncle. Bar in (E), 200 p~m for (A), (C), (E), and (F). Bar in (G), 200 I~m, for (B), (D), and (G).

Figure Z In Situ Localization of FGF-R Transcripts in the Rhombencephalon (A and B) Dark-field photomicrographs of the locus ceruleus. The neurons are intensely labeled. (C) Dark-field photomicrograph of the ventral cochlear nucleus. (D) Dark-field photomicrograph of the facial nucleus. The large neurons are labeled. (E and F) Dark-field photomicrographs showing that the neurons in the solitary tract nucleus (arrowheads), the dorsal motor nucleus of the vagus nerve (arrow), and the hypoglossal nucleus (12) are labeled. Area postrema (ap) is also labeled diffusely. Bars, 200 p.m (bar in [B] is also for [D] and [F]).

Neuron 276

o t o

O

t

~!~i~ ~

o t

h

F

In Situ Localization of FGF-RmRNA in Adult Rat CNS 277

summarized the distribution of labeled cells according to Rexed's classification (Rexed, 1952; Table 1). Layer 1 was devoid of positive signal, and layer 2 was labeled diffusely. The remaining layers contained many labeled neurons (Table 1). Figure 8F shows a brightfield image of motoneurons in the lumber spinal cord in which silver grains were clearly observed on these cell bodies. In the lower cervical and thoracic spinal cord, the neurons of intermediolateral cell column, which are preganglionic neurons, were also FGF-R mRNA-positive.

Circumventricular Organs and Nonneuronal Cells All the circumventricular organs (subfornical organs, OVLT, and area postrema) showed moderate to strong labeling in a uniform pattern (Table 1). The choroid plexus expressed a high level of FGF-R mRNA (Figure 5B). These tissues contain significant amounts of capillary endothelial cells; thus it is likely that this labeling represents FGF-R mRNA in these cells. Also, ependymal cells (Figures 5D and 5E) and meningeal cells (Figure 5C) exhibited intense labeling. Discussion Cloning of Human and Rat FGF-R cDNA We have isolated partial cDNA clones for the rat and human FGF-R based on sequence homologies to the chicken bFGF-R (Lee et al., 1989). At least seven members are known to be included in the FGF family: bFGF, aFGF, int-2 (Dickson et al., 1984), hst (Delli Bovi et al., 1987), FGF-5 (Zahn et al., 1988), keratinocyte growth factor (Finch et al., 1989), and FGF-6 (Marics et al., 1989). Reid et al. (1990) demonstrated that the bFGF-R belongs to a multiple receptor tyrosine kinase family that most likely contains receptors for other FGF family members. They identified at least four members of this receptor family that have highly conserved tyrosine kinase domains and relatively unique extracellular domains. They described in detail two cDNA species that differ by 267 nucleotides within the extracellular domain. It is possible, given the broad nature of the band(s) at 4.3 kb in our Northern blot (Figure 1B), that both species are detected in the present experiments. Recently, Safran et al. (1990) reported the cloning of a virtually identical murine FGF-R. Antibodies to the peptide of the carboxyl terminus of this protein were raised and used in cross-

linking experiments to demonstrate that this receptor binds both bFGF and aFGF. These results are consistent with previous cross-linking studies which suggested that aFGF and bFGF might share the same receptor (Neufeld and Gospodarowicz, 1986). Because the probe we used is derived from the highly conserved region surrounding and including the transmembrane domain, the widespread expression of FGF-R mRNA in the adult CNS detected by our in situ hybridization experiment could conceivably represent different mRNA species in different neuronal populations. However, this seems unlikely because of the similarity in the relative expression of the multiple FGF-R mRNA species in each of the CNS regions examined (Figure 1B). Further characterization of the FGF-R family will be required to clarify these issues and to provide specific probes for each member.

Comparison with Previous In Vitro Studies It was demonstrated that FGF supported the survival of neurons from the hippocampus, cerebral cortex, striatum, septum, and thalamus of the fetal (E18) rat brain (Walicke, 1988). In the present study, we observed FGF-R mRNA in the hippocampus and cerebral cortex, but failed to identify message in the striatum, septum, or thalamus. This discrepancy could be due to altered expression of the FGF-R in the fetal versus the adult brain. Indeed, we have observed high levels of bFGF-R mRNA expression in the periventricular zone of E17 rat brain, in which the mitotic neuronal precursor cells reside (Wanaka et al., unpublished data). In addition, Gensburger et al. (1987) reported that bFGF stimulates the proliferation of rat neuronal precursor cells in culture. Hence, part of the survival effects reported by Walicke may represent the mitogenic actions of FGF on these precursor cells. It is also possible that FGF-R present on developing neurons is lost in adulthood as has been previously observed with NGF-R expression on motoneurons (Yan and Johnson, 1988). Our ongoing study to investigate the expression of FGF-R mRNA in the developing nervous system should provide further insights into these issues. Other than our inability to observe FGF-R mRNA in the striatum, septum, and thalamus , these results are consistent with previous reports showing neurotrophic effects of bFGF on cultured neurons. For example, mesencephalic dopaminergic cells are supported by bFGF in vitro (Ferrari et al., 1989). We observed a

Figure 8. In Situ Localization of FGF-RTranscripts in the Rhombencephalon and the Spinal Cord (A and B) Dark-field photomicrographs of the caudal part of the brainstem. Arrows in (A) indicate the lateral reticular nucleus. Arrowheads indicate the labeled neurons of the spinal trigeminal nucleus (caudal part). In (B), The intensely labeled neurons of the lateral reticular nucleus are shown. (C and D) Dark- and bright-field photomicrographs of the cerebellar cortex, p, Purkinje cell. Note that the granule cell layer is labeled intensely, whereas the Purkinje cell and molecular layers show only background level of labeling. (E) Dark-field photomicrograph of the upper cervical spinal cord. Arrowheads indicate labeled motoneurons, and arrows indicate labeled interneurons. (F) Bright-field photomicrograph of the ventral horn of the lumber spinal cord. Silver grains accumulate on the cell bodies of motoneurons. Bars, 200 p,m (A, B, C, and E); 50 ~m (D and F).

Neuron 278

moderate level of hybridization in the compact part of the substantia nigra and the ventral tegmental area, which are known to contain dopaminergic neurons. Hatten et al. (1988) reported that astroglial FGF stimulates neurite outgrowth from cultured cerebellar granule cells. In accordance with that observation, a high level of FGF-R mRNA was detected in the granule cell layer of the cerebellum. We also found that several hypothalamic nuclei expressed FGF-R mRNA. Another example includes the recent report that bFGF has trophic effects on the neurons of the fetal hypothalamus (Torres-Aleman et al., 1990), a region where we detected FGF-R mRNA. Functional Implication of FGF in the Mature CNS In the present study, we localized FGDR mRNA in the adult CNS. Although most of the labeled cells appear to belong to neuronal populations, in some regions, such as the cerebral cortex, the hybridization signals were distributed diffusely such that we could not distinguish neuronal from nonneuronal localization. However, given the fact that we failed to detect distinct cellular labeling of nonneuronal elements in the parenchyma of most CNS areas, we conclude that FGF-R mRNA is generally expressed at much lower levels in nonneuronal elements than in the specific neuronal populations we have identified. In the telencephalon-mesencephalon region, most of the FGF-R mRNA-positive neurons were found in the limbic system or its related structures. For example, the olfactory bulb, amygdala, and bed nucleus of stria terminalis have a close functional relationship and are connected to one another with afferent and efferent fibers (Smythies, 1970). Hypothalamic nuclei (paraventricular hypothalamic nucleus, supraoptic nucleus, dorsomedial hypothalamic nucleus, and median eminence) also belong to the limbic system and function as a neuroendocrine system; they contained moderate to high levels of FGF-R mRNA. The pituitary gland contains high levels of FGF (Baird et al., 1986; Gospodarowicz et al., 1987), so that FGF-R mRNA in the paraventricular hypothalamic nucleus and the supraoptic nucleus may reflect some FGF-mediated interactions between the pituitary and these nuclei. In the limbic system, the most intense labeling was observed in the hippocampus. This is consistent with studies demonstrating survival effects of FGF on cultured hippocampal neurons (Walicke, 1988; Mattson et al., 1989) and suggests a functional role for FGF in adult neurons. Mattson et al. (1989) recently reported that FGF raises the threshold for glutamate neurotoxicity and antagonizes the inhibition of neurite outgrowth by glutamate. They proposed an intriguing hypothesis that the relative levels of growth factors and neurotransmitters determine the fate of dendrites, as well as that of neurons, during neuronal development. Since glutamate is one of the main excitatory neu rotransmitters in the hippocampus (Collinridge et al., 1983; Fonnum, 1984), localization of FGF-R mRNA to this area suggests that both FGF and glutamate act

simultaneously on mature neurons in vivo. Hence, FGF may play a pivotal role in the neuronal plasticity of the adult, as well as the developing, hippocampus. It has also been suggested that imbalances in relative levels of FGF and glutamate may account for the neurodegeneration in the hippocampus (Mattson et al., 1989). In this respect, it would be of interest to examine FGF and FGF-R gene expression in aged animals or postmortem human brain. Another region that was very strongly labeled was the pedunculopontine and laterodorsal tegmental nuclei in the mesencephalon. These neurons contain acetylcholine as a neurotransmitter and project to the frontal cortex (Sakanaka et al., 1983; Vincent et al., 1983), thalamus, basal ganglia, and basal forebrain (Woolf and Butcher, 1986). Although little is known about the functions of these neurons, they are thought to be involved in sleep functions (for review see Hobson, 1990). Injection of cholinomimetic drug into these regions induces a state indistinguishable from rapid eye movement sleep (Hobson et al., 1983). Therefore, FGF may be involved in these sleep functions. The locus ceruleus, dorsal raphe nucleus, substantia nigra (compact part), and ventral tegmental area were labeled moderately to strongly; these nuclei are major sources of noradrenergic (Moore and Card, 1984), serotonergic (Steinbusch and Nieuwenhuys, 1983), and dopaminergic (Bj~rklund and Lindvall, 1984) fibers in the CNS, respectively. The substantia nigra is considered to be the primary target of Parkinson's disease (for review see Mawdsley, 1975), and neuronal loss in the locus ceruleus has been reported in Alzheimer's disease (Bondareff et al., 1982). Since it is postulated that neurotrophic factors may be involved in these neurodegenerative phenomena (Appel, 1986), FGF could be a possible candidate. Motoneurons in the brainstem and spinal cord expressed high levels of FGF-R mRNA, suggesting that these neurons may be responsive to FGF, which is made in significant amounts by muscle cells (Gospodarowicz et al., 1987). It has been reported that muscle-derived factors support the survival of motoneurons in culture (Smith and Appel, 1983; Smith et al., 1985). The present results are also in good agreement with studies demonstrating that bFGF serves as a trophic factor for preganglionic neurons in the spinal cord (Blottner et al., 1989). In fact, we found that the majority of spinal cord neurons, including interneurons and preganglionic neurons, in addition to motoneurons, expressed FGF-R message. Although the consistency between the present results and the previous in vitro studies suggests a possible neurotrophic role for FGF in the adult CNS, FGF may also exert other effects, such as induction of neurotransmitter expression. Comparison with NGF-R mRNA Distribution in the CNS When the present results are compared with the NGF-R mRNA distribution in the rat CNS (Koh et al.,

In Situ Localization of FGF-RmRNA in Adult Rat CNS 279

1989), o n e observes t h a t these receptors are rarely c o e x p r e s s e d by n e u r o n s in t h e a d u l t rat. For e x a m p l e , in t h e c e r e b e l l a r cortex Purkinje cells express o n l y NGF-R mRNA, w h e r e a s g r a n u l e cells express o n l y bFGF-R mRNA. NGF-R m R N A has been d e t e c t e d in t h e m e s e n c e p h a l i c t r i g e m i n a l nucleus (Koh et al., 1989), w h e r e a s FGF-R message was not present. Areas t h a t c o n t a i n e d high levels of FGF-R m R N A , such as h i p p o c a m p u s and p o n t i n e c h o l i n e r g i c neurons, d o n o t c o n t a i n NGF-R mRNA. A l t h o u g h in s o m e regions, such as t h e ventral cochlear, p r e p o s i t u s hypoglossal, a m b i g u u s , and raphe nuclei, c o l o c a l i z a t i o n of b o t h mRNAs is possible, it is likely t h a i NGF a n d FGF act largely on discrete p o p u l a t i o n s of n e u r o n s in t h e a d u l t rat CNS. Based on t h e a b i l i t y of FGF to prevent t h e d e a t h of basal f o r e b r a i n c h o l i n e r g i c n e u r o n s after axotomy, it has been p o s t u l a t e d t h a t FGF acts on t h e s e n e u r o n s via the FGF-R ( A n d e r s o n et al., 1988). The p r e s e n t results d e m o n s t r a t i n g t h a t the m e d i a l septal nucleus and t h e nucleus of d i a g o n a l b a n d a p p e a r d e v o i d of FGF-R m R N A and t h e recent r e p o r t s h o w i n g that t h e c u l t u r e d septal n e u r o n s of fetal rat brain c o n t a i n little r e c e p t o r p r o t e i n (Walicke et al., 1989) are i n c o n s i s t e n t w i t h this idea. O n e possible e x p l a n a t i o n f o r this disc r e p a n c y is t h a t FGF may act indirectly: FGF may ind u c e t h e synthesis of NGF, as it d o e s in c u l t u r e d astrocytes (Spranger et al., 1990), or of o t h e r t r o p h i c factors in the h i p p o c a m p u s o r at t h e site of injury. These in t u r n w o u l d s u p p o r t f i m b r i a - f o r n i x - t r a n s e c t e d basal f o r e b r a i n neurons. A n o t h e r p o s s i b i l i t y is t h a t basal f o r e b r a i n n e u r o n s n o r m a l l y express very l o w levels of FGF-R b u t t h a t FGF-R levels are u p - r e g u l a t e d after neuronal injury. However, p r e l i m i n a r y e x p e r i m e n t s w i t h f i m b r i a - f o r n i x - t r a n s e c t e d animals have failed to d e m onstrate FGF-R m R N A in these neurons. F u r t h e r invest i g a t i o n s are in progress to address these issues. In s u m m a r y , w e have d e t e r m i n e d by N o r t h e r n b l o t analysis t h a t FGF-R m R N A is b r o a d l y d i s t r i b u t e d in t h e a d u l t rat CNS. In situ h y b r i d i z a t i o n analysis d e m o n strated t h a t FGF-R transcripts are o b s e r v e d p r i m a r i l y in neurons, w h e r e a s n o n n e u r o n a l e l e m e n t s (glial o r e n d o t h e l i a l cells in t h e p a r e n c h y m a ) express few, if any, receptors in the intact brain. FGF-R m R N A is observed in m a n y specific n e u r o n a l p o p u l a t i o n s . These results are c o n s i s t e n t w i t h the idea t h a t FGF o r FGFlike m o l e c u l e s may exert effects such as a n e u r o t r o p h i c effect on specific n e u r o n a l cell types. Experimental Procedures Isolation of Human and Rat FGF-R cDNA Putative human FGF-R cDNA (fig; Ruta et al., 1988) was isolated by using the PCR. Briefly, first-strand cDNA was synthesized with AMV-reverse transcriptase from total RNA of a human umbilical endothelial cell line (HUV-EC-C, ATCC CRL 1730; a gift of Dr. Elonora Scarpati). Two 30-mer oligonucleotides were synthesized according to the published fig sequence (nucleotides 1-30 and 601-630). With these oligonucleotides as primers, the PCR was conducted on the first-strand cDNA. The expected 630 nucleotide fragment was digested with Kpnl and EcoRI and subcloned into pBluescript (Stratagene). Sequence analysis re-

vealed that this cDNA fragment was a partial clone of fig. This plasmid (phFGFR; Figure 1A) was used for in situ hybridization analysis (see below). A rat E18 brain cDNA library (approximately 106 pfu; Clonetech) was screened with 32p-labeled human FGF-R cDNA prob e. Five positive clones were identified, and DNA from one of these clones (designated as 6-2) was purified. The DNA was digested with EcoRl, and the 2.4 kb cDNA insert was subcloned into pBluescript. The nucleotide sequence analysis confirmed its identity as the rat FGF-R sequence. To construct a template for in vitro transcription, a fragment extending from nucleotide 957 to nucleotide 1257 was subcloned and sequenced. This plasmid (prFGFR; Figures 1A and 1B) was used for Northern analysis and in situ hybridization (see below). Preparation of RNA Probe phFGFR was linearized by cutting with Hincll (for the antisense probe) or with Pvull (for the sense probe). In vitro transcription was performed using appropriate RNA polymerase (]3 RNA polymerase for antisense; T7 RNA polymerase for sense probe) and [c~-35S]UTP.This yielded 130 nucleotide and 140 nucleotide RNAs for the antisense and sense probes, respectively (Figure 1A). prFGFR was linearized by digesting with EcoRl (antisense) or Kpnl (sense). In vitro transcription was performed as described above, except that [32P]UTP was used to produce antisense probe for Northern analysis (Figure 1A). Northern Blot Analysis Total RNA was isolated from several brain regions (cerebral cortex, hippocampus, cerebellum, brainstem, and midbrain) and from liver according to Chomczynski and Sacchi (1987). Fifteen micrograms of each total RNA was fractionated on a 1% agarose-formaldehyde gel, and RNA was transferred to a nitrocellulose membrane. This membrane was hybridized with 32P-labeled RNA probe (106 cpm/ml) for 18 hr at 60°C and washed twice in 2x SSC (lx SSC = 0.15 M NaCI, 0.015 M sodium citrate) at room temperature for 20 rain, then twice in 0.2x SSC, 0.1% SDS at 72°C for 45 rain, and subjected to autoradiography. In Situ Hybridization Histochemistry Sprague-Dawley rats (200-250 g; Sasco) were perfused with 4% paraformaldehyde in 0.1 M sodium phosphate buffer (NaPB) (2 ml per g of body weight). Brains and spinal cords were dissected, immersed in fixative overnight at 4°C, and incubated in 30% sucrose in 0.1 M NaPB overnight at 4°C. They were quickly frozen with powdered dry ice. Coronal sections (12 pore)were cut on a cryostat and thaw-mounted on TESTA (3-amino propyl triethoxysilane)-treated slides. The slides were kept at -80°C until use. In situ hybridization procedures were based on those of Wilkinson et al. (1988) with some modifications. Slides were equilibrated to room temperature, and the sections were fixed in 4% paraformaldehyde in 0.1 M NaPB for 20 min. After washing with PBS, the sections were treated with 10 ~.g/ml proteinase K in 50 mM Tris-HCl, 5 mM EDTA (pH 8.0) for Z5 rain at room temperature. They were postfixed in the same fixative as described above, acetylated with acetic anhydride in 0.1 M triethanolamine, rinsed with PBS, dehydrated in an ascending alcohol series (30%, 50%, 70%, 8S%, 95%, 100%, 100%), and air-dried. The 3sS-labeled RNA probes (antisense or sense) in hybridization buffer were placed on the sections and covered with siliconized coverslips. The hybridization was performed in a humid chamber overnight at 55°C. Hybridization buffer consists of 50% deionized formamide, 0.3 M NaCl, 20 mM Tris-HCI, 5 mM EDTA, 10 mM NaPB, 10% dextran sulfate, l x Denhardt's solution (0.2% polyvinylpyrrolidone, 0.2% Ficoll, 0.2% bovine serum albumin), 0.2% Sarcosyl, 500 pg/ml yeast tRNA, and 200 t~g/ml herring sperm DNA (pH 8.0). The probe concentration was 5 x 10s cpm/ 75 pl per slide. After hybridization, the slides were immersed in 5x SSC at 55°C, and the coverslips were allowed to fall off. The sections were incubated at 65°C in 50% deionized formamide, 2x SSC for 30 rain. After rinsing with RNAase buffer (0.5 M NaCI, 10 mM Tris-HCl, 5 mM EDTA[pH 8.0]) four times for 10 miri each

Neuron

280

at 37°C, the sections were treated with 1 ~tg/ml RNAase A in RNAase buffer for 30 rain at 37°C. After an additional wash in RNAase buffer, the slides were incubated at 65°C in 50% formamide, 2x SSC for 30 min, rinsed with 2x SSC and 0.1x SSC for 15 rain each at room temperature, dehydrated in an ascending alcohol series, and air-dried. To determine the exposure period for emulsion autoradiography, X-ray film was exposed to the uncoated sections for 2 days. The slides were coated with Kodak NTB-2 emulsion that was diluted 1:1 with distilled water. Most of the slides in this study were exposed for 1-2 weeks, developed in Kodak D-19, stained with toluidine blue, and coverslipped. The sections were observed under the light microscope with dark-or bright-field con e densers.

Specificity Control We employed both rat and human FGF-R probes (Figure 1A) during in situ hybridization analysis with identical results. The results presented in this report were obtained from the experiments using the rat probe. We examined the specificity of the hybridization signal in the following ways, Sections treated with RNAase prior to hybridization revealed only a background level of hybridization signal (data not shown). Throughout this study, consecutive sections were hybridized with either antisense or sense probes. We observed significant labeling only in those sections hybridized with the antisense probe. No specific signal was detected in sections hybridized with the sense probe. Figure 2 displays representative sections from the hippocampus (B) that was hybridized with antisense probe and adjacent sections hybridized with sense probe (A).

Acknowledgments We thank Ms. Jenny Colombo and Ms. Patricia A. Osborne for their technical assistance, Ms. P. A. Osborne for her skillful illustration, Mr. Mark A. Watson for helpful comments on the manuscript, and Dr. Andrew P. McMahon for his advices on in situ hybridization histochemistry. This work was supported by the Monsanto Co., grant NS 24679 from the National Institutes of Health, grant POI CA49712 from National Cancer Institute, and grant RG 1779B2 from National Multiple Sclerosis Foundation. A. W. is supported by funds provided by an anonymous donor to the Pharmacology Department of Washington University School of Medicine. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received May 8, 1990; revised June 15, 1990. References

Anderson, K. J., Dam, D., Lee, S., and Cotman, C. W. (1988). Basic fibroblast growth factor prevents death of lesioned cholinergic neurons in vivo. Nature 332, 360-361. Appel, S. H. (1986). A unifying hypothesis for the cause of amyotrophic lateral sclerosis, Parkinsonism, and Alzheimer disease. Ann. Neurol. 10, 499-505. Baird, A., Esch, F., Mormede, P., Ueno, N., Ling, N., Bohlen, P., Ying, S. Y., Wehrenberg, W., and Guillemin, R. (1986). Molecular characterization of fibroblast growth factor: distribution and biological activities in various tissues. Rec. Prog. Horm. Res. 42, 143-205. Bj~rklund, A., and Lindvall, O. (1984). Dopamine-containing systems in the CNS. In Handbook of Chemical Neuroanatomy, Vol. 2: Classical Transmitters in the CNS, Part I, A. Bjorklund and T. Hokfelt, eds. (Amsterdam: Elsevier Science Publishers B. V.), pp. 55-122. Blottner, D., Weatermann, R., Grothe, C., Bohlen, P., and Unsicker, K. (1989). Baisic fibroblast growth factor in the adrenal

gland. Possible trophic role for preganglionic neurons. Eur. J. Neurosci. 1, 471-478. Bondareff, W., Mountjoy, C. Q., and Roth, M. (1982). Loss of neurons of origin of the adrenergic projection to cerebral cortex (nucleus locus ceruleus) in senile dementia. Neurology 32,164-168. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate~phenol-chloroform extraction. Anal. Biochem. 162, 156-159. Collinridge, G. I., Kehl, S. J., and Maclennan, H. (1983). Excitatory amino acids in synaptic transmission in the Schaffer colateralcommissural pathway of the rat hippocampus. J. Physiol. 334, 34-46. Delli Bovi, P., Curatola, A. M., Kern, F. G., Greco, A., Ittmann, M., and Basilico, C. (1987). An oncogene isolated by transfection of Kaposi's sarcoma DNA encodes a growth factor that is a member of the FGF family. Cell 50, 729-73Z Dickson, C., Smith, R., Brooks, S., and Peters, G. (1984). Tumorigenesis by mouse mammary tumor virus: proviral activation of a cellular gene in the common integration region int-2. Cell 37, 529-536. Ferrari, G., Minnozi, M.-C., Toffano, G., Leon, A., and Skaper, S. D. (1989). Baisic fibroblast growth factor promotes the survival and development of mesencephalic neurons in culture. Dev. Biol. 134, 140-14Z Finch, P. W., Rubin, J. S., Miki, T., Ron, D., and Aaronson, S. A. (1989). Human KGF is FGF-related with properties of a paracrine effector of epithelial cell growth. Science 245, 752-755. Fonnum, F. (1984). Glutamate: a neurotransmitter in mammalian brain. J. Neurochem. 42, 1-11. Gensburger, C., Labourdette, G., and Sensenbrenner, M. (1987). Brain basic fibroblast growth factor stimulates the proliferation of rat neuronal precursor cells in vitro. FEBS Lett. 217, 1-5. Gospodarowicz, D. (1974). Localization of a fibroblast growth factor and its effect alone and with hydrocortisone on 31"3 cell growth. Nature 249, 123-127. Gospodarowicz, D., Ferrara, N., Schweigerer, L., and Neufeld, G. (1987). Structural characterization and biological functions of fibroblast growth factor. Endocrinol. Rev. 8, 95-114. Hatten, M.E., Lynch, M., Rydel, R.E., Sanchez, J., JosephSilverstein, J., Moscatelli, D., and Rifkin, D. B. (1988). In vitro neurite extension by granule neurons is dependent upon astroglialderived fibroblast growth factor. Dev. Biol. 125, 280-289. Hobson, J.A. (1990). Sleep and dreaming. J. Neurosci. 10, 371-382. Hobson, J. A., Goldberg, M., Vivaldi, E., and Riew, D. (1983). Enhancement of desynchronized sleep signs after pontine microinjection of the muscarinic agonist bethanechol. Brain Res. 275, 127-136. Koh, S., Oyler, G. A., and Higgins, G. A. (1989). Localization of nerve growth factor receptor messenger RNA and protein in the adult rat brain. Exp. Neurol. 106, 209-221. Lee, F'. L., Johnson, D. E., Cousens, L.S., Fried, V. A., and Williams, L. T., (1989). Purification and complementary DNA cloning of a receptor for basic fibroblast growth factor. Science 245, 57-60. Marics, I., Adelaide, J., Raybaud, F., Mattei, M., Coulier, F., Planche, J., de Lapeyriere, O., and Birnbaum, D. (1989). Characterization of the HST-related FGF.6gene, a new member of fibroblast growth factor gene family. Oncogene 4, 335-340. Mattson, M. P., Murrain, M., Guthrie, P. B., and Kater, S. B. (1989). Fibroblast growth factor and glutamate: opposing roles in the generation and degeneration of hippocampal neuroarchitecture. J. Neurosci. 9, 3728-3740. Mawdsley, C. (1975). Parkinson's disease. In Recent Advance in Clinical Neurology, Vol. 1, W. B. Matthews, ed. (Edinburgh: Churchill Livingstone), pp. 118-162. Moore, R.Y., and Card, J. P. (1984). Noradrenaline-containing neuron systems. In Handbook of Chemical Neuroanatomy, Vol. 2: Classical Transmitters in the CNS, Part I, A. Bjorklund and T.

In Situ Localization of FGF-R mRNA in Adult Rat CNS 281

Hokfelt, eds. (Amsterdam: Elsevier Science Publishers B. V.), pp. 123-156. Morrison, R. S., Sharma, A., De Vellis, J., and Bradshaw, R.A. (1986). Basic fibroblast growth factor supports the survival of cerebral cortical neurons in primary culture. Proc. Natl. Acad. Sci. USA 83, 7537-7541. Neufeld, G., and Gospodarowicz, D. (1986). Basic and acidic fibroblast growth factors interact with the same cell surface receptors. J. Biol. Chem. 261, 5631-5637. Reid, H. H., Wilks, A. F., and Bernard, O. (1990). Two forms of the basic fibroblast growth factor receptor-like mRNA are expressed in the developing mouse brain. Proc. Natl. Acad. Sci. USA 87, 1569-1600. Rexed, B. (1952). The cytoarchitectonic organization of the spinal cord in the rat. J. Comp. Neurol. 96, 415-495. Ruta, T., Howk, R., Ricca, G., Drohan, W., Zabelshansky, M., Laureys, G., Barton, D. E., Francke, U., Schlessinger, J., and Givol, D. (1988). A novel protein tyrosine kinase gene whose expression is modulated during endothelial cell differentiation. Oncogene 3, 9-15. Rydel, R. E., and Greene, L. A. (1987). Acidic and basic fibroblast growth factors promote stable neurite outgrowth and neuronal differentiation in cultures of PC12 cells. J. Neurosci. 7, 36393653. Safran, A., Avivi, A., Orr-Urtereger, A., Neufeld, G., Lonai, P., Givol, D., and Yarden, Y. (1990). The murine fig gene encodes a receptor for fibroblast growth factor. Oncogene 5, 635-645. Sakanaka, M., Shiosaka, S., Takatsu ki, K., and Tohyama, M. (1983). Evidence for the existence of a substance P-containing pathway from the nucleus laterodorsalis tegmenti (Castardi) to the medial frontal cortex. Brain Res. 259, 123-12@ Schubert, D., Ling, N., and Baird, A. (1987). Multiple influences of a heparin-binding growth factor on neuronal development. J. Cell Biol. 104, 635-643. Smith, R. G., and Appel, S. H. (1983). Extracts of skeletal muscle increase neurite outgrowth and cholinergic activity of fetal rat spinal motor neurons. Science 219, 1079-1081. Smith, R. G., McManaman, J. L., and Appel, S. FI. (1985). Trophic effects of skeletal muscle extract on ventral spinal cord neurons in vitro; separation of a protein with morphologic activity from proteins with cholinergic activity, J. Cell Biol. 101, 1608-1621. Smythies, J. R. (1970). Brain Mechanisms and Behaviour (New York: Academic Press, Inc.). Spranger, M., Lindholm, D., Brandtlow, C., Heumann, R., Gnahn, H., Naher-Noe, M., and Thoenen, H. (1990). Regulation of nerve growth factor (NGF) synthesis in the rat central nervous system: comparison between the effects of interleukin-1 and various growth factors in astrocyte cultures and in vivo. Eur. J. Neurosci. 2, 69-7@ Steinbusch, Ft. W. M., and Nieuwenhuys, R., (1983). The raphe nuclei of the rat brainstem: a cytoarchitectonic and immunohistochemical study. In Chemical Neuroanatomy, P. C. Emson, ed. (New York: Raven Press), pp. 131-208. Togari, A., Baker, D., Dickens, G., and Guroff, G. (1983). The neurite-promoting effect of fibroblast growth factor on PC12 cells. Biochem. Biophys. Res. Commun. 114, 1189-1193. Togari, A., Dickens, G., Kuzuya, H., and Guroff, G. (1985). The effect of fibroblast growth factor on PC12 cells. J. Neurosci. 5, 307-31@ Torres-Aleman, I., Naftolin, F., and Robbins, R. J. (1990). Trophic effects of basic fibroblast growth factor on fetal rat hypothalamic cells: interactions with insulin-like growth factor I. Dev. Brain Res. 52, 253-25Z Unsicker, K., Reichert-Preibsch, H., Schmidt, R., Pettmann, B., Labourdette, G., and Sensenbrenner, M. (1987). Astroglial and fibroblast growth factors have neurotrophic functions for cultured peripheral and central nervous system neurons. Proc. Natl. Acad. Sci. USA 84, 5459-5463. Vincent, S. R., Satoh, K., Armstrong, D. M., and Eibiger, I-I. C.

(1983). Substance P in the ascending cholinergic reticular system. Nature 306, 691-699. Wagner, J. A., and D~more, P. A. (1986). Neurite outgrowth induced byan endothelial cell mitogen isolated from retina. J. Cell Biol. 103, 1363-136Z Walicke, P. A. (1988). Basic and acidic fibroblast growth factors have trophic effects on neurons from multiple CNS regions. J. Neurosci. 8, 2618-262Z Walicke, P. A., and Baird, A. (1988). Neurotrophic effects of basic and acidic fibroblast growth factors are not mediated through glial cells. Dev. Brain. Res. 40, 711-719. Walicke, P., Cowan, W. M., Ueno, N., Baird, A., and Guillemin, R. (1986). Fibroblast growth factor promotes survival of dissociated hippocampal neurons and enhance neurite extension. Proc. Natl. Acad. Sci. USA 83, 3012-301@ Walicke, P. A., Feige, J.-J., and Baird, A. (1989). Characterization of the neuronal receptor for basic fibroblast growth factor and comparison to receptors on mesenchymal cells. J. Biol. Chem. 264, 4120-412@ Wilkinson, D. G., Peters, G., Dickson, C., and McMahon, A. P. (1988). Expression of the EGF-related proto-oncogene int-2 during gastrulation and neurulation in the mouse. EMBO J. Z 691-695. Woolf, N. J., and Butcher, L. L. (1986). Cholinergic system in the rat brain. I1. Brain Res. Bull. 16, 603-63Z Yan, Q., and Johnson, E. M., Jr. (1988). An immunohistochemical study of the nerve growth factor receptor in developing rats. J. Neurosci. 8, 3481-3498. Zahn, X., Bates, B., Hu, X., and Goldfalb, M. (1988). The human FGF-5 oncogene encodes a novel protein related to fibroblast growth factors. Mol. Cell. Biol. 8, 3487-3495.