Vet Res Commun (2014) 38:129–137 DOI 10.1007/s11259-014-9596-z
ORIGINAL ARTICLE
Longitudinal field studies of Avian Metapneumovirus and Turkey Hemorrhagic Enteritis Virus in turkeys suffering from colibacillosis associated mortality Davide Giovanardi & Caterina Lupini & Patrizia Pesente & Giulia Rossi & Giovanni Ortali & Elena Catelli
Accepted: 6 February 2014 / Published online: 4 March 2014 # Springer Science+Business Media Dordrecht 2014
Abstract The aim of this study was to evaluate if the exposure to Avian metapneumovirus (aMPV) and/or to Turkey hemorrhagic enteritis virus (THEV) was significant for the induction of episodes of colibacillosis in aMPV and THEV vaccinated turkeys. Colibacillosis-associated mortality was recorded and longitudinal virological studies performed in three consecutive turkey flocks reared in the same farm. aMPV and THEV diagnostic swabs and blood samples were made once a week up to 14 weeks of age. Swabs were processed by molecular techniques for viruses detection and antibody titres were evaluated. Field subtype B aMPVs were detected in all flocks at different ages of life always associated with respiratory signs and increase of colibacillosis-associated mortality. THEV has been consistently detected in all flocks since the 9th week of age. Vaccination with a single dose of the THEV commercial inactivated vaccine available in Italy seems does not protect the birds from the infection. Sequence comparison of the hexon protein of one of the THEV strains detected, and strains isolated worldwide, revealed high similarity between them. These results are consistent with the notion that the hexon protein, being the major antigenic component of the virus, is highly conserved between the strains. Results showed that field aMPV infection is directly correlated to colibacillosis-associated mortality. Less clear appears the role of THEV because the endemicity of aMPV makes D. Giovanardi : P. Pesente : G. Rossi Tre Valli Laboratory, Viale A. Veronesi, 5, 37132 San Michele Extra Verona, Italy C. Lupini (*) : E. Catelli Department of Veterinary Medical Sciences, University of Bologna, Via Tolara di Sopra, 50, 40064 Ozzano dell’ Emilia Bologna, Italy e-mail: [email protected] G. Ortali Agricola Tre Valli, Via Valpantena 18/G, 37138 Quinto di Valpantena Verona, Italy
difficult to evaluate its role in predisposing colibacillosis in absence of aMPV. It would be interesting to further investigate this issue through experimental trials in secure isolation conditions. Keywords Avian metapneumovirus . Turkey hemorrhagic enteritis virus . Colibacillosis . Turkeys
Introduction Colibacillosis is the most common bacterial disease of poultry, responsible for significant economic losses. The most common clinical form is the colisepticaemia. This condition is characterized by respiratory disease, which is usually followed by a systemic infection with characteristic fibrinous lesions (airsacculitis, perihepatitis, and pericarditis) and fatal septicemia (Barnes et al. 2008). Recently, Clark (2011) in the USA turkey industry annual report, issued by the United States Animal Health Association (USAHA), ranked colibacillosis as the third current disease issue facing the turkey industry. Avian metapneumovirus (aMPV) is an RNA virus belonging to the genus Metapneumovirus in the Paramyxoviridae family of which four subtypes (A, B, C and D) have been recognized. It is able to cause in turkeys a respiratory disease termed Turkey rhinotracheitis (TRT). It can also affect chickens and other avian species including guinea fowls and pheasants (Catelli et al. 1998; Catelli et al. 2001; Cecchinato et al. 2012). aMPV induced damage to the respiratory epithelium, with associated reduction of mucociliary transport, might allow bacteria to pass the epithelium barrier and possibly allow their entry into deeper regions of the respiratory tract. Co-infection of aMPV with bacterial pathogens, generally results on prolonged clinical disease and more severe gross and microscopic lesions. Experimental studies have demonstrated a predisposing or exacerbating effect of aMPV
130
on Escherichia coli infection in turkeys (Van de Zande et al. 2001; Turpin et al. 2002). Hemorrhagic enteritis (HE) is an acute and immunosuppressive viral disease which affects turkeys of 4 weeks of age or older, clinically characterized by depression, bloody droppings and death. The most relevant macroscopic lesions are splenomegaly and gastrointestinal hemorrhages (Pierson and Fitzgerald, 2008). It is caused by a DNA virus of the species Turkey Adenovirus A, genus Siadenovirus, family Adenoviridae, commonly named Turkey hemorrhagic enteritis virus (THEV). The mechanism of THEV immunosuppression is not fully understood but it is demonstrated that the virus infects B-lymphocytes and macrophages inducing necrosis as well as apoptosis (Rautenschlein and Sharma 2000). THEV strains, able to cause in field and experimental conditions the clinical signs previously described, have been defined as virulent THEV (THEV-V), while THEV strains, able to replicate efficiently in turkeys and to cause splenomegaly and transient immunosuppression, but resulting nor in mortality nor in intraintestinal bleeding lesions, have been defined avirulent THEV (THEV-A) (Saunders et al. 1993; Pierson and Fitzgerald 2008; Beach et al. 2009a, b). THEV infection can exacerbate colibacillosis under experimental (Larsen et al. 1985; Newberry et al. 1993; Van den Hurk et al. 1994; Pierson et al. 1996a; Koncicki et al. 2012) and field conditions (Sponenberg et al. 1985; Pierson et al. 1996b; Palya et al. 2007). Although aMPV vaccination is widely applied in turkey farms, reversion to virulence of live vaccines and evolution of field virus able to avoid vaccine induced immunity (Catelli et al. 2006; Brown et al. 2011; Cecchinato et al. 2010), allows aMPV to still circulate in Italian turkey farms (Cecchinato et al. 2013a) and to cause TRT field outbreaks. Similarly, most Italian turkeys are vaccinated for THEV by a commercial inactivated vaccine, but THEV is still circulating (Ceruti et al. 2007; Alessandri et al. 2008) although HE clinical hemorrhagic disease, reported for the first time in our country by Mandelli et al. (1977), is not frequently observed anymore. Circulation in Italy of immunosuppressive THEV-A strains has been suspected. Mortality due to colisepticaemia is frequent in meat turkeys, often it is observed repeatedly in the same farm (Giovanardi et al. 2013), as result of the interaction between multiple environmental and infectious factors. Between the latters, aMPV and THEV are thought might play a prevalent role, although with different mechanisms. The aim of this study was to evaluate if the exposure to aMPV and/or THEV was significant for the induction of continuous episodes of colibacillosis in aMPV and THEV vaccinated commercial meat turkeys. Colibacillosisassociated mortality was recorded, and longitudinal virological studies performed in three consecutive flocks reared in the same farm. aMPV and THEV detections were sequenced in order to characterize the strains.
Vet Res Commun (2014) 38:129–137
Material and methods Before starting the field study, a pilot trial was performed in experimental condition, in order to obtain a picture of the serological profiles elicited in commercial turkeys by aMPV and THEV vaccinations. The serological profiles obtained, were later used to interpret the serology in the field longitudinal studies. Pilot study Poults Thirty 1 day-old BUT big 8 commercial poults were used. Breeders vaccination plan included both aMPV and THEV vaccines. Food and water were provided ad libitum. Birds were kept in animal facilities where high biosecurity levels were enforced. Vaccines and experimental design At the arrival, the birds were divided in three experimental groups (A, B, C). Each group was composed by five males and five females. The vaccination plans were scheduled as reported in Table 1. For aMPV, a subtype B live vaccine (strain VC03) was applied by coarse spray at one day-old to all groups. An inactivated vaccine for THEV (Domermuth strain), which in the commercial formulation is associated to Newcastle Disease Virus (Ulster 2C strain), was administered subcutaneously either two times, according to the producer recommendation, or only one time according to the company vaccination plan for meat turkeys. Blood samples were collected from all groups at 1, 3, 4, 5, 6, 7, 8, 10, 11, 12 weeks of age for serological tests. At 12 weeks of age all birds were humanely euthanatized and disposed. ELISA for THEV Sera were tested for antibodies against THEV by a commercial ELISA kit (SYMBIOTICS ProFLOK® Hemorrhagic Enteritis Virus ELISA kit, SYMBIOTICS CORPORATION, Kansas City, MO, USA). The test was run according to the manufacturer’s instructions. Sera samples with optical densities (O.D.) higher than 300, were considered positive. The Table 1 Pilot trial: vaccination plans applied to the experimental groups
Vaccine applied
Group A Group B Group C
Day 1
Day 29
Day 54
aMPV aMPV aMPV
THEV THEV /
THEV / /
Vet Res Commun (2014) 38:129–137
mean antibody titres were compared using the Student’s t-test, where a p-value 70 were considered significant.
THEV detection and characterization Viral DNA from cloacal swabs and spleen samples was extracted with PureLink Genomic DNA kit (Life Technologies, Monza, Italy) as described by the supplier. Amplification was done with Taq PCR Master Mix (Qiagen, Hilden, Germany) in 20 μl reaction mix containing 2 μl DNA (20 ng/μl) and 0,2 μM primers specifically designed (forward “GGC ATG GGC AAC TAT CCT AA” and reverse “TAG GAA CAC TGC CAA AAC CC”). The primers were in positions 1,117 and 1,234 bp on the hexon gene. The hexon gene encodes for the homologous protein, which is the major antigenic component in the virus and in the infected cell. PCR reaction conditions were: 2 min denaturation at 95 °C, 35 cycles of 30 s at 94 °C, 30 s at 55 °C, 30 s at 72 °C and finally a cycle at 72 °C for 10 min. Specific PCR products of 117 bp were separated by electrophoresis on 2 % agarose gel and were the stained with Syber Safe DNA gel.
132
Vet Res Commun (2014) 38:129–137 1800 1600 1400 1200 0.D.
A selected positive sample was further characterized by sequencing partial of the hexon gene (1,627) following the method described by Hess et al. (1999). The PCR product was purified and processed for sequencing as previously described. The nucleotide sequences were edited and assembled using Bioedit software then aligned against, and compared with analogous GenBank logged THEV hexon gene sequences using Clustal W.
1000 800
Groups A,B,C
600 400 200 12
11
8
10
7
6
4
5
1
3
0
Bacteriology
WEEKS OF AGE
Bacteriology for E. coli was performed from carcasses with macroscopic lesions referable to colisepticaemia. Viscera or exudates were cultured individually onto 3 % sheep blood agar (OXOID, Basingstoke, UK) and eosine methylene blue agar (OXOID) then incubated aerobically at 37 °C, for 18 to 24 h. Identification of suspect E. coli colonies (at least two colonies per plate) was based on biochemical features using the commercial kit RapID E 20 (bioMerièux, Craponne, France). ELISA for aMPVand THEV ELISA tests for aMPV and THEV were performed as previously described.
Results The ELISA titres observed after THEV and aMPV experimental vaccinations are reported in Figs. 1 and 2. Maternal THEV antibodies were detected decreasingly up to three weeks of age. Surprisingly, neither single nor dual THEV vaccination elicited a detectable antibody response. The differences between groups vaccinated once, twice or not vaccinated, were 1800 1600
Fig. 2 Pilot study: mean antibody titres for aMPV. Live aMPV vaccination was implemented at one-day of age to all groups
not significant (p>0.05). Similarly, ELISA maternal antibodies for aMPV were detected only at one week of age.
Longitudinal studies Results of longitudinal studies 1, 2 and 3 are reported in Fig. 3. aMPV of subtype B was detected in all flocks at different ages. In the longitudinal studies 2 and 3, the restriction endonuclease digestion of the aMPV PCR products revealed the vaccine-origin of the strains detected between 3 and 5 weeks, while the later detections, made after the ninth week of age, were always field strains. In flock 1 only one field detection was made, early in the life. Field aMPV detections were always associated with respiratory clinical signs, increase in the weekly mortality rate with lesions of colisepticaemia and E. coli isolation, and were followed by an increase in specific antibody titres. THEV has been consistently detected from cloacal swabs by PCR in all flocks starting from 9 weeks of age, up to the end of the survey. At post-mortem examination, deceased or culled birds during this period, never showed hemorrhagic enteritis but often mottled spleens, which resulted positive for THEV at PCR. The detections were followed by a variable increase in antibody titres.
1400
0.D.
1200
Sequence analysis
1000
Group A
800
Gruop B
600
aMPV
Group C
400 200 12
11
10
7
8
6
5
4
3
1
0
WEEKS OF AGE
Fig. 1 Pilot study: mean antibody titres for HEV. Group A, twice vaccinated for HEV; group B, once vaccinated for HEV; group C, not vaccinated for HEV. No statistically significant difference (p>0.05) was observed between the groups
aMPV field strains from flock 1 and 3 (respectively named IT/ Ty/1077/09 and IT/Ty/1213/09) were isolated on TOCs and sequenced in G and F genes. The phylogenetic analysis carried out on G gene sequences revealed that those strains clusterized with Italian strains isolated after 2001 (Fig. 4), this was supported by a high bootstrap value. The trees showed the same topology when constructed with nucleotide or amino acid sequences. Similar
Vet Res Commun (2014) 38:129–137 Fig. 3 Longitudinal studies 1(a), 2 (b) and 3(c): aMPV and THEV PCR detections, mean antibody ELISA titers, weekly mortality rates and appearance of respiratory clinical signs are reported
133
a
*
AMPV field detection THEV detection
* respiratory signs
b
*
*
* AMPV vaccine detection AMPV field detection THEV detection
* respiratory signs
c
*
* AMPV vaccine detection AMPV fieldd etection THEV detection * respiratory signs
results were observed when the phylogenetic analysis was carried out on F gene (data not shown). THEV A selected THEV strain, detected during longitudinal study 3 and named THEV/IT/Ty/1037/09, was sequenced in a portion of the hexon gene (GenBank accession number: KJ372213). The nucleotide sequence of partial hexon gene of the strain THEV/IT/Ty/1037/09, aligned and compared with analogous GenBank logged THEV hexon gene sequences, revealed same differences (Fig. 5). Three unique mutations characterized the Italian strain (nucleotide position 1,347: C→T;
nucleotide position 1,967: T→A; nucleotide position 2,298: G→A). At the amino acid level, however, all examined strains were the same since none of the observed mutations affect the sense of codons (they were all silent changes).
Discussion Colibacillosis mortality was observed during all longitudinal studies at various ages, always in association with aMPV and/ or THEV. At week 4, in the first flock, a field aMPV subtype B virus, in absence of THEV, triggered off the highest weekly
134
Vet Res Commun (2014) 38:129–137
Fig. 4 Phylogenetic tree based on the alignment of nucleotide sequences of G genes of subtype B aMPVs; strains isolated in this study are reported in bold. Reference strains were (Genbank accession number are reported in parentheses): aMPV/B/Russia/ chicken/22/2010 (JN651921.1), aMPV/B/Russia/chicken/12/2010 (JN651920.1), aMPV/B/Russia/ chicken/14/2009 (JN651919.1), aMPV/B/Russia/chicken/10/2008 (JN651917.1), aMPV/B/Russia/ chicken/07/2008 (JN651916.1), aMPV/B/Russia/chicken/02/2007 (JN651915.1), aMPV/B/Ukraine/ chicken/05/2009 (JN651918.1), Hungary 657/4/89 (L34033); Italy 2119 (L34031); Spain 872S (L34034) and Israel 1708/02 (AY728268). Only bootstrap values >70 are reported
84
IT/Ty/1348-01/07
95
IT/Ty/1077-02/09
IT/Ty/129-18/04 98
IT/Ty/205-16/04
IT/Ck/34a/02 99
IT/Ty/2a/01
78
IT/Ck/33a/02 IT/Ty/1213/09 aMPV/B/Russia/chicken/10/2008
77
aMPV/B/Russia/chicken/07/2008 aMPV/B/Russia/chicken/02/2007 79
IT/Ty/Vr240/87 Italy 16/91 It 2119 NL/6726/90
94
France 38/86 91
France 147 Hungary 657/4/89
89
Spain 149 B type vaccine spain 872S Israel 1708/02 UK 8-94 70
UK 11/94 aMPV/B/Russia/chicken/12/2010 aMPV/B/Ukraine/chicken/05/2009
100
aMPV/B/Russia/chicken/14/2009
93 99
aMPV/B/Russia/chicken/22/2010
0.005
colisepticaemia mortality observed in the study. the early aMPV isolation in vaccinated birds, followed by a marked serological response, confirms that live commercial aMPV vaccines can sometime result in an incomplete protection (Banet-Noach et al. 2009). It is widely believed, and experimentally observed in turkeys, that co-infection with aMPV and E. coli can lead to an increased morbidity and a higher incidence of colisepticaemia gross lesions (Van de Zande et al. 2001). Our results support this notion and were comparable to those observed in the field by Van de Zande et al. (1998), during severe respiratory outbreaks from which aMPV and E. coli were isolated. Field aMPV detections were also made later, from week 9 to 11, in both flocks 2 and 3, after early vaccine detections. Later field aMPV subtype B detections have been already reported in Italy after homologous live vaccination (Catelli et al. 2010). These were related to elusion of the vaccine induced immunity due to field aMPV evolution concurrent
with mass live vaccine introduction (Cecchinato et al. 2010). Phylogenetic analysis of belated aMPV subtype B detections showed their similarity with Italian strains isolated after 2001 by Cecchinato et al. (2010), and their genetic distance from the vaccine. A concurrent immunosuppressive role of THEV circulation in birds at this age cannot be excluded. THEV was detected during the present survey in all flocks sampled since the 9th week of age up to the end of the study, in absence of intestinal bleeding lesions. Vaccination with a single dose of the commercial inactivated vaccine available in Italy seems do not protect the birds from the infection. Both in the pilot, or in the field study, humoral antibody response was never detected after vaccination while a rise in titres was consistently present after field virus infection. The lack of a detectable humoral immunity after vaccination with the inactivated vaccine, either administered to birds once or twice during the productive life, seems to be indicative of a poor protection after field challenge. However, the
Vet Res Commun (2014) 38:129–137 Fig. 5 Nucleotide sequence of partial THEV hexon gene of the strain THEV/IT/Ty/1037/09 (Genbank accession number: KJ372213) detected in longitudinal study 2, aligned with the homologous sequences of the following reference strains (Genbank accession number are reported in parentheses): Israel strain (AF074946); Cardona strain (AF075681); Avirulent Virginia (AY849321.1); Domermuth vaccine (DQ789974.1); Hungary isolate DV55.2000 (DQ789975.1); Hungary isolate DV70.2000.10 (DQ789973.1); Hungary isolate DV70.2000.14 (DQ789972.1). THEV/IT/Ty/1037/09 is shown in full and other residues are only specified where different to this sequence
135
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
780 800 820 840 860 880 900 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| AGATACTAGAATAGTTGCTTATGACTCTACTGATAAAATAGCAACTAGAATGGGTAACAGAATTAATTATATTGGATTTAGAGATAATTTTATAGGTTTGATGTATTATGATAATGGTGCACATAGTGGT .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
910 930 950 970 990 1010 1030 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| TCTTTGGCTACAGAAACAGGAGATATAAATTTGGTAGAACAATTGCAAGATAGAAATACAGAAATTAGTTATCAATATATGTTAGCGGATTTGATGAGTAGGAATCATTATTATAGTCAGTGGAATCAAG .................................................................................................................................. .................................................................................................................................C ........C......................................................................................................................... -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1040 1060 1080 1100 1120 1140 1160 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CTGTAGATGATTATGATTTAAATGTTAGAGTACTTACAAATATTGGTTATGAAGAGGGTCCTCCAGGTTACTGTTATCCAAGCACAGGCATGGGCAACTATCCTAATACTGTCATGTCGGTTGGGACATT .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1170 1190 1210 1230 1250 1270 1290 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| AGTGGATAATAATGGTACAACTGCTACAACAACGTCAAATACTGTAGCTGTGATGGGTTTTGGCAGTGTTCCTACTATGGAAATTAACGTTCAAGCTTATTTGCAAAAATGTTGGATGTATGCTAACATT .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1300 1320 1340 1360 1380 1400 1420 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GCAGAATATTTACCTGATAAGTATAAAAAAGCTATTCAAGGTACTAGTGAAACTGACCCAACAACTTATAGTTATATGAATAGTAGGCTTCCTAATGTGAATATGGCTGATCTCTTTACACATATTGGCG ........................................................T......................................................................... ........................................................T......................................................................... ........................................................T......................................................................... -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1430 1450 1470 1490 1510 1530 1550 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GGCGTTATAGTTTGGATGTAATGGATAATGTTAATCCTTTTAATCATCATAGAAATAGAGGTTTGCAATATAGAAGTCAAATTTTGGGTAATGGTAGAAATGTCCGTTTTCATATTCAGGTACCTCAGAA .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1560 1580 1600 1620 1640 1660 1680 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ATTTTTTGCTATTAAGAATCTATTGTTACTTCCTGGAACTTATAGTTATGAATGGTGGTTCAGGAAAGATCCAAACTTAGTGCTACAGTCTACGTTGGGAAATGATTTAAGAAAAGATGGAGCAAGCATT .................................................................................A................................................ .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1690 1710 1730 1750 1770 1790 1810 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CAGTTTAGCAGTATTAGTCTTTATGCGAGTTTTTTTCCTATGGATCACGCTACTTGTAGTGAGCTTATTTTAATGCTTAGAAATGATCAAAATGATCAAACTTTTATGGATTATATGGGTGCAAAGAATA ...................................................................................C.............................................. .....AGCAGT........................................................................C.............................................. ...................................................................................C.............................................. ------------------------------------------------...................................C.............................................. -----------------------------------------------------...C...........C............................................................. ------------------------------------------..............C......................................................................... -----------------------------------------------------..............................C..............................................
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1820 1840 1860 1880 1900 1920 1940 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ATTTGTATTTAGTTCCTGCTAATCAAACTAATGTTCAGATTGAAATACCTTCTAGAGCTTGGACAGCATTTAGAGGCTGGAGTTTTAACCGAATTAAAACTGCTGAGACACCAGCTGTGTGGTCTACTTA .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. ..................................................................................................................................
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1950 1970 1990 2010 2030 2050 2070 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| TGATCTTAATTTTAAATATTCTGGCTCTATACCTTATCTAGATGGTACATTTTATCTTTCTCACACTTTTAACTCTATGTCTATTTTGTTTGATTCAGCAATAACATGGCCAGGTAATGATAGAATGTTA ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A......................................................................................................
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
2080 2100 2120 2140 2160 2180 2200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GTTCCGAATTTTTTTGAAATAAAAAGAGAGATAGATACGGAGGGATACACTACTAGTCAGTCTAATATGACTAAAGATTGGTATTTGATtCAAATGCTGCAAATTATAACCAGGGGTATCACGGTTATAG .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. ..................................................................................................................................
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
2210 2230 2250 2270 2290 2310 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|.... TTTTCCAGCAGATAAAGTATACAGACAGTATGATTTTATGTCAAATTTTGATTCTATGTCTGTTCAAGTACCCCGGTCAGGTCTGGCATTTTTGTTTGATGAAAATTATAACTTGATAGTAAAT .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A..........................
efficacy of live vaccination is largely documented (Pierson and Fitzgerald 2008) but unfortunately those live vaccines, widely used in USA and in some European countries, are not available in Italy. The absence of overt clinical signs of THEV infection observed in our survey, could be due, besides the partial vaccinal protection, to low pathogenicity of circulating strains (A-THEV). Full-length genome sequencing of virulent and avirulent THEV strains allowed to identify mutations in specific genes,
which could be responsible for virus virulence (Beach et al. 2009b). Identification of those mutations, by sequencing wide portions of THEV genome, along with assessment of virus virulence in secure experimental conditions, would be needed in order to precisely define the pathogenicity of the strains detected in the present study. Sequence comparison of the hexon protein of one of those strains revealed high similarity (100 %) with THEV strains isolated worldwide. These results are consistent with the notion that the hexon protein, being the
136
major antigenic component of the virus, is highly conserved between the strains (Beach et al. 2009b). This is the first sequence analysis available for a THEV strain isolated in Italy. The control of colibacillosis is closely related to the minimization of predisposing factors (Barnes et al. 2008). Our results clearly show that field aMPV infection is directly correlated to colisepticaemia mortality. Although largely reported in the literature (Larsen et al. 1985; Sponemberg et al. 1985; Newberry et al. 1993; Van De Hurk et al. 1994; Pierson et al. 1996a; Pierson et al. 1996b; Palya et al. 2007; Koncicki et al. 2012), less clear appears, in our study, the role of THEV because the endemicity of aMPV makes difficult to evaluate its role in predisposing colibacillosis in absence of aMPV. Moreover, experimental data about a possible role of THEV in exacerbating respiratory disease due to aMPV are not available. It would be interesting to further investigate those issues through experimental trials in secure isolation conditions.
References Alessandri E, Della Valentina M, Vinco LJ (2008) Enterite Emorragica nel tacchino: Esperienze di campo. Atti della Società Italiana di Patologia Aviare 2008 In “Tavola Rotonda: Virosi emergenti e reemergenti nell’allevamento avicolo”. Italy: Teramo May 16, 2008. 25–34 Banet-Noach C, Simanov I, Laham-Karam N, Perk S, Bacharach E (2009) Longitudinal survey of avian metapneumoviruses in poultry in Israel: infiltration of field strains into vaccinated flocks. Avian Dis 53:184–189 Barnes JH, Nolan LK, Vaillancourt JP (2008) Colibacillosis. In: Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE (eds) Diseases of poultry, 12th edn. Blackwell Publishing, Ames, pp 691–737 Beach NM, Duncan RB, Larsen CT, Meng XJ, Sriranganathan N, Pierson FW (2009a) Persistent infection of turkeys with an avirulent strain of turkey hemorrhagic enteritis virus. Avian Dis 53:370–375 Beach NM, Duncan RB, Larsen CT, Meng XJ, Sriranganathan N, Pierson FW (2009b) Comparison of 12 turkey hemorrhagic enteritis virus isolates allows prediction of genetic factors affecting virulence. J Gen Virol 90:1978–1985 Brown PA, Lupini C, Catelli E, Clubbe J, Ricchizzi E, Naylor CJ (2011) A single polymerase (L) mutation in avian metapneumovirus increased virulence and partially maintained virus viability at an elevated temperature. J Gen Virol 92:346–54 Catelli E, Cook JKA, Chesher J, Orbell SJ, Woods MA, Baxendale W, Huggins MB (1998) The use of virus isolation, histopathology and immunoperoxidase techniques to study the dissemination of a chicken isolate of avian pneumovirus in chickens. Avian Pathol 27:632– 640 Catelli E, Terregino C, De Marco MA, Delogu M, Guberti V (2001) Serological evidence of avian pneumovirus infection in reared and free-living pheasants. Vet Rec 149:56–58 Catelli E, Cecchinato M, Delogu M, De Matteo P, Ortali G, Franciosi C, De Marco A, Naylor CJ (2004) Avian pneumovirus infection in turkey and broiler farms in Italy: a virological, molecular and serological field survey. Ital J Anim Sci 3:287–292
Vet Res Commun (2014) 38:129–137 Catelli E, Cecchinato M, Savage CE, Jones RC, Naylor CJ (2006) Demonstration of loss of attenuation and extended field persistence of a live avian metapneumovirus vaccine. Vaccine 24:6476–6482 Catelli E, Lupini C, Cecchinato M, Ricchizzi E, Brown P, Naylor CJ (2010) Field avian Metapneumovirus evolution avoiding vaccine induced immunity. Vaccine 28:916–921 Cecchinato M, Catelli E, Lupini C, Ricchizzi E, Clubbe J, Battilani M, Naylor CJ (2010) Avian metapneumovirus (aMPV) attachment protein involvement in probable virus evolution concurrent with mass live vaccine introduction. Vet Microbiol 146:24–34 Cecchinato M, Lupini C, Ricchizzi E, Falchieri M, Meini A, Jones RC, Catelli E (2012) Italian field survey reveals a high diffusion of avian metapneumovirus subtype B in layers and weaknesses in the vaccination strategy applied. Avian Dis 56:720–724 Cecchinato M, Drigo M, Lupini C, Martini M, Listorti V, Franzo G, Bonci M, Laconi A, Morandini E, Catelli E (2013a) Diffusione dell’infezione da metapneumovirus aviare in allevamenti di tacchini e broiler nel Nord Italia. Large Animal Rev 19:267–270 Cecchinato M, Lupini C, Munoz Pogoreltseva OS, Listorti V, Mondin A, Drigo M, Catelli E (2013b) Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B. Avian Pathol 42:283–289 Ceruti R, Della Valentina M, Gavazzi L, Venni A, Ferrazzi V, Grilli G (2007) Haemorrhagic enteritis seroconversion in turkey breeders: field observations. Ital J Anim Sci 6:321–325 Clark S (2011) Turkey Industry Annual Report -Current Health and Industry Issues Facing the Turkey Industry. Proc. 115th Annual Meeting Of The United States Animal Health Association, Buffalo, New York, September 29–October 5, 2011, pp. 433–438 Giovanardi D, Lupini C, Pesente P, Rossi G, Ortali G, Catelli E (2013) Characterization and antimicrobial resistance analysis of avian pathogenic Escherichia coli isolated from Italian turkey flocks. Poult Sci 92:2661–2667 Hess M, Raue R, Hafez HM (1999) PCR for specific detection of haemorrhagic enteritis virus of turkeys, an avian adenovirus. J Virol Methods 81:199–203 Koncicki A, Tykałowski B, Stenzel T, Smiałek M, Pestka D (2012) Effect of infection of turkeys with haemorrhagic enteritis adenovirus isolate on the selected parameters of cellular immunity and the course of colibacillosis. Pol J Vet Sci 15(2):215–220 Larsen CT, Domermuth CH, Sponenberg DP, Gross WB (1985) Colibacillosis of Turkeys exacerbated by hemorrhagic enteritis virus. Laboratory studies. Avian Dis 29(3):729–732 Listorti V, Lupini C, Cecchinato M, Pesente P, Rossi G, Naylor CJ, Catelli E (2014) Rapid detection of subtype B avian metapneumoviruses using RT-PCR restriction endonuclease digestion indicates field circulation of vaccine-derived viruses in older turkeys. Avian Pathol 43(1):51-56 Mandelli G, Rampin T, Guidobono CL, Gallazzi D (1977) Enterite emorragica da adenovirus nel tacchino. Clin Vet 100:437–447 Newberry LA, Skeeles JK, Kreider DL, Beasley JN, Story JD, McNew RW, Berridge BR (1993) Use of virulent hemorrhagic enteritis virus for the induction of colibacillosis in Turkeys. Avian Dis 37(1):1–5 Palya V, Nagy M, Glávits R, Ivanics E, Szalay D, Dán A, Süveges T, Markos B, Harrach B (2007) Investigation of field outbreaks of turkey Haemorrhagic enteritis in Hungary. Acta Vet Hung 55(1): 135–149 Pierson FW, Fitzgerald SD (2008) Hemorrhagic enteritis and related infections. In: Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE (eds) Diseases of poultry, 12th edn. Blackwell Publishing, Ames, pp 276–286 Pierson FW, Larsen CT, Domermuth CH (1996a) The production of colibacillosis in turkeys following sequential exposure to Newcastle disease virus or Bordetella avium, avirulent hemorrhagic enteritis virus, and Escherichia coli. Avian Dis 40:837–840
Vet Res Commun (2014) 38:129–137 Pierson FW, Barta VD, Boyd D, Thompson WS (1996b) Exposure to multiple infectious agents and the development of colibacillosis in turkeys. J Appl Poult Res 5:347–357 Rautenschlein S, Sharma JM (2000) Immunopathogenesis of haemorragic enteritis virus (HEV) in turkeys. Dev Comp Immunol 24:237–246 Saunders GK, Pierson FW, Van Den Hurk JV (1993) Haemorhagic enteritis virus infection in turkeys: a comparison of virulent and avirulent virus infections, and a proposed pathogenesis. Avian Pathol 22:47–58 Sponenberg DP, Domermuth CH, Larsen CT (1985) Field outbreaks of colibacillosis of turkeys associated with hemorrhagic enteritis virus. Avian Dis 29:838–842
137 Turpin EA, Perkins LE, Swayne DE (2002) Experimental infection of turkeys with avian pneumovirus and either Newcastle disease virus or Escherichia coli. Avian Dis 46:412–422 Van den Hurk J, Allan BJ, Riddell C, Watts T, Potter AA (1994) Effect of infection with hemorrhagic enteritis virus on susceptibility of turkeys to Escherichia coli. Avian Dis 38(4):708–716 Van de Zande S, Nauwynck H, Cavanagh D, Pensaert M (1998) Infections and reinfections with avian pneumovirus subtype A and B on Belgian turkey farms and relation to respiratory problems. J Vet Med B 45:621–626 Van de Zande S, Nauwynck H, Pensaert M (2001) The clinical, pathological and microbiological outcome of an Escherichia coli O2:K1 infection in avian pneumovirus infected turkeys. Vet Microbiol 81:353–365
ORIGINAL ARTICLE
Longitudinal field studies of Avian Metapneumovirus and Turkey Hemorrhagic Enteritis Virus in turkeys suffering from colibacillosis associated mortality Davide Giovanardi & Caterina Lupini & Patrizia Pesente & Giulia Rossi & Giovanni Ortali & Elena Catelli
Accepted: 6 February 2014 / Published online: 4 March 2014 # Springer Science+Business Media Dordrecht 2014
Abstract The aim of this study was to evaluate if the exposure to Avian metapneumovirus (aMPV) and/or to Turkey hemorrhagic enteritis virus (THEV) was significant for the induction of episodes of colibacillosis in aMPV and THEV vaccinated turkeys. Colibacillosis-associated mortality was recorded and longitudinal virological studies performed in three consecutive turkey flocks reared in the same farm. aMPV and THEV diagnostic swabs and blood samples were made once a week up to 14 weeks of age. Swabs were processed by molecular techniques for viruses detection and antibody titres were evaluated. Field subtype B aMPVs were detected in all flocks at different ages of life always associated with respiratory signs and increase of colibacillosis-associated mortality. THEV has been consistently detected in all flocks since the 9th week of age. Vaccination with a single dose of the THEV commercial inactivated vaccine available in Italy seems does not protect the birds from the infection. Sequence comparison of the hexon protein of one of the THEV strains detected, and strains isolated worldwide, revealed high similarity between them. These results are consistent with the notion that the hexon protein, being the major antigenic component of the virus, is highly conserved between the strains. Results showed that field aMPV infection is directly correlated to colibacillosis-associated mortality. Less clear appears the role of THEV because the endemicity of aMPV makes D. Giovanardi : P. Pesente : G. Rossi Tre Valli Laboratory, Viale A. Veronesi, 5, 37132 San Michele Extra Verona, Italy C. Lupini (*) : E. Catelli Department of Veterinary Medical Sciences, University of Bologna, Via Tolara di Sopra, 50, 40064 Ozzano dell’ Emilia Bologna, Italy e-mail: [email protected] G. Ortali Agricola Tre Valli, Via Valpantena 18/G, 37138 Quinto di Valpantena Verona, Italy
difficult to evaluate its role in predisposing colibacillosis in absence of aMPV. It would be interesting to further investigate this issue through experimental trials in secure isolation conditions. Keywords Avian metapneumovirus . Turkey hemorrhagic enteritis virus . Colibacillosis . Turkeys
Introduction Colibacillosis is the most common bacterial disease of poultry, responsible for significant economic losses. The most common clinical form is the colisepticaemia. This condition is characterized by respiratory disease, which is usually followed by a systemic infection with characteristic fibrinous lesions (airsacculitis, perihepatitis, and pericarditis) and fatal septicemia (Barnes et al. 2008). Recently, Clark (2011) in the USA turkey industry annual report, issued by the United States Animal Health Association (USAHA), ranked colibacillosis as the third current disease issue facing the turkey industry. Avian metapneumovirus (aMPV) is an RNA virus belonging to the genus Metapneumovirus in the Paramyxoviridae family of which four subtypes (A, B, C and D) have been recognized. It is able to cause in turkeys a respiratory disease termed Turkey rhinotracheitis (TRT). It can also affect chickens and other avian species including guinea fowls and pheasants (Catelli et al. 1998; Catelli et al. 2001; Cecchinato et al. 2012). aMPV induced damage to the respiratory epithelium, with associated reduction of mucociliary transport, might allow bacteria to pass the epithelium barrier and possibly allow their entry into deeper regions of the respiratory tract. Co-infection of aMPV with bacterial pathogens, generally results on prolonged clinical disease and more severe gross and microscopic lesions. Experimental studies have demonstrated a predisposing or exacerbating effect of aMPV
130
on Escherichia coli infection in turkeys (Van de Zande et al. 2001; Turpin et al. 2002). Hemorrhagic enteritis (HE) is an acute and immunosuppressive viral disease which affects turkeys of 4 weeks of age or older, clinically characterized by depression, bloody droppings and death. The most relevant macroscopic lesions are splenomegaly and gastrointestinal hemorrhages (Pierson and Fitzgerald, 2008). It is caused by a DNA virus of the species Turkey Adenovirus A, genus Siadenovirus, family Adenoviridae, commonly named Turkey hemorrhagic enteritis virus (THEV). The mechanism of THEV immunosuppression is not fully understood but it is demonstrated that the virus infects B-lymphocytes and macrophages inducing necrosis as well as apoptosis (Rautenschlein and Sharma 2000). THEV strains, able to cause in field and experimental conditions the clinical signs previously described, have been defined as virulent THEV (THEV-V), while THEV strains, able to replicate efficiently in turkeys and to cause splenomegaly and transient immunosuppression, but resulting nor in mortality nor in intraintestinal bleeding lesions, have been defined avirulent THEV (THEV-A) (Saunders et al. 1993; Pierson and Fitzgerald 2008; Beach et al. 2009a, b). THEV infection can exacerbate colibacillosis under experimental (Larsen et al. 1985; Newberry et al. 1993; Van den Hurk et al. 1994; Pierson et al. 1996a; Koncicki et al. 2012) and field conditions (Sponenberg et al. 1985; Pierson et al. 1996b; Palya et al. 2007). Although aMPV vaccination is widely applied in turkey farms, reversion to virulence of live vaccines and evolution of field virus able to avoid vaccine induced immunity (Catelli et al. 2006; Brown et al. 2011; Cecchinato et al. 2010), allows aMPV to still circulate in Italian turkey farms (Cecchinato et al. 2013a) and to cause TRT field outbreaks. Similarly, most Italian turkeys are vaccinated for THEV by a commercial inactivated vaccine, but THEV is still circulating (Ceruti et al. 2007; Alessandri et al. 2008) although HE clinical hemorrhagic disease, reported for the first time in our country by Mandelli et al. (1977), is not frequently observed anymore. Circulation in Italy of immunosuppressive THEV-A strains has been suspected. Mortality due to colisepticaemia is frequent in meat turkeys, often it is observed repeatedly in the same farm (Giovanardi et al. 2013), as result of the interaction between multiple environmental and infectious factors. Between the latters, aMPV and THEV are thought might play a prevalent role, although with different mechanisms. The aim of this study was to evaluate if the exposure to aMPV and/or THEV was significant for the induction of continuous episodes of colibacillosis in aMPV and THEV vaccinated commercial meat turkeys. Colibacillosisassociated mortality was recorded, and longitudinal virological studies performed in three consecutive flocks reared in the same farm. aMPV and THEV detections were sequenced in order to characterize the strains.
Vet Res Commun (2014) 38:129–137
Material and methods Before starting the field study, a pilot trial was performed in experimental condition, in order to obtain a picture of the serological profiles elicited in commercial turkeys by aMPV and THEV vaccinations. The serological profiles obtained, were later used to interpret the serology in the field longitudinal studies. Pilot study Poults Thirty 1 day-old BUT big 8 commercial poults were used. Breeders vaccination plan included both aMPV and THEV vaccines. Food and water were provided ad libitum. Birds were kept in animal facilities where high biosecurity levels were enforced. Vaccines and experimental design At the arrival, the birds were divided in three experimental groups (A, B, C). Each group was composed by five males and five females. The vaccination plans were scheduled as reported in Table 1. For aMPV, a subtype B live vaccine (strain VC03) was applied by coarse spray at one day-old to all groups. An inactivated vaccine for THEV (Domermuth strain), which in the commercial formulation is associated to Newcastle Disease Virus (Ulster 2C strain), was administered subcutaneously either two times, according to the producer recommendation, or only one time according to the company vaccination plan for meat turkeys. Blood samples were collected from all groups at 1, 3, 4, 5, 6, 7, 8, 10, 11, 12 weeks of age for serological tests. At 12 weeks of age all birds were humanely euthanatized and disposed. ELISA for THEV Sera were tested for antibodies against THEV by a commercial ELISA kit (SYMBIOTICS ProFLOK® Hemorrhagic Enteritis Virus ELISA kit, SYMBIOTICS CORPORATION, Kansas City, MO, USA). The test was run according to the manufacturer’s instructions. Sera samples with optical densities (O.D.) higher than 300, were considered positive. The Table 1 Pilot trial: vaccination plans applied to the experimental groups
Vaccine applied
Group A Group B Group C
Day 1
Day 29
Day 54
aMPV aMPV aMPV
THEV THEV /
THEV / /
Vet Res Commun (2014) 38:129–137
mean antibody titres were compared using the Student’s t-test, where a p-value 70 were considered significant.
THEV detection and characterization Viral DNA from cloacal swabs and spleen samples was extracted with PureLink Genomic DNA kit (Life Technologies, Monza, Italy) as described by the supplier. Amplification was done with Taq PCR Master Mix (Qiagen, Hilden, Germany) in 20 μl reaction mix containing 2 μl DNA (20 ng/μl) and 0,2 μM primers specifically designed (forward “GGC ATG GGC AAC TAT CCT AA” and reverse “TAG GAA CAC TGC CAA AAC CC”). The primers were in positions 1,117 and 1,234 bp on the hexon gene. The hexon gene encodes for the homologous protein, which is the major antigenic component in the virus and in the infected cell. PCR reaction conditions were: 2 min denaturation at 95 °C, 35 cycles of 30 s at 94 °C, 30 s at 55 °C, 30 s at 72 °C and finally a cycle at 72 °C for 10 min. Specific PCR products of 117 bp were separated by electrophoresis on 2 % agarose gel and were the stained with Syber Safe DNA gel.
132
Vet Res Commun (2014) 38:129–137 1800 1600 1400 1200 0.D.
A selected positive sample was further characterized by sequencing partial of the hexon gene (1,627) following the method described by Hess et al. (1999). The PCR product was purified and processed for sequencing as previously described. The nucleotide sequences were edited and assembled using Bioedit software then aligned against, and compared with analogous GenBank logged THEV hexon gene sequences using Clustal W.
1000 800
Groups A,B,C
600 400 200 12
11
8
10
7
6
4
5
1
3
0
Bacteriology
WEEKS OF AGE
Bacteriology for E. coli was performed from carcasses with macroscopic lesions referable to colisepticaemia. Viscera or exudates were cultured individually onto 3 % sheep blood agar (OXOID, Basingstoke, UK) and eosine methylene blue agar (OXOID) then incubated aerobically at 37 °C, for 18 to 24 h. Identification of suspect E. coli colonies (at least two colonies per plate) was based on biochemical features using the commercial kit RapID E 20 (bioMerièux, Craponne, France). ELISA for aMPVand THEV ELISA tests for aMPV and THEV were performed as previously described.
Results The ELISA titres observed after THEV and aMPV experimental vaccinations are reported in Figs. 1 and 2. Maternal THEV antibodies were detected decreasingly up to three weeks of age. Surprisingly, neither single nor dual THEV vaccination elicited a detectable antibody response. The differences between groups vaccinated once, twice or not vaccinated, were 1800 1600
Fig. 2 Pilot study: mean antibody titres for aMPV. Live aMPV vaccination was implemented at one-day of age to all groups
not significant (p>0.05). Similarly, ELISA maternal antibodies for aMPV were detected only at one week of age.
Longitudinal studies Results of longitudinal studies 1, 2 and 3 are reported in Fig. 3. aMPV of subtype B was detected in all flocks at different ages. In the longitudinal studies 2 and 3, the restriction endonuclease digestion of the aMPV PCR products revealed the vaccine-origin of the strains detected between 3 and 5 weeks, while the later detections, made after the ninth week of age, were always field strains. In flock 1 only one field detection was made, early in the life. Field aMPV detections were always associated with respiratory clinical signs, increase in the weekly mortality rate with lesions of colisepticaemia and E. coli isolation, and were followed by an increase in specific antibody titres. THEV has been consistently detected from cloacal swabs by PCR in all flocks starting from 9 weeks of age, up to the end of the survey. At post-mortem examination, deceased or culled birds during this period, never showed hemorrhagic enteritis but often mottled spleens, which resulted positive for THEV at PCR. The detections were followed by a variable increase in antibody titres.
1400
0.D.
1200
Sequence analysis
1000
Group A
800
Gruop B
600
aMPV
Group C
400 200 12
11
10
7
8
6
5
4
3
1
0
WEEKS OF AGE
Fig. 1 Pilot study: mean antibody titres for HEV. Group A, twice vaccinated for HEV; group B, once vaccinated for HEV; group C, not vaccinated for HEV. No statistically significant difference (p>0.05) was observed between the groups
aMPV field strains from flock 1 and 3 (respectively named IT/ Ty/1077/09 and IT/Ty/1213/09) were isolated on TOCs and sequenced in G and F genes. The phylogenetic analysis carried out on G gene sequences revealed that those strains clusterized with Italian strains isolated after 2001 (Fig. 4), this was supported by a high bootstrap value. The trees showed the same topology when constructed with nucleotide or amino acid sequences. Similar
Vet Res Commun (2014) 38:129–137 Fig. 3 Longitudinal studies 1(a), 2 (b) and 3(c): aMPV and THEV PCR detections, mean antibody ELISA titers, weekly mortality rates and appearance of respiratory clinical signs are reported
133
a
*
AMPV field detection THEV detection
* respiratory signs
b
*
*
* AMPV vaccine detection AMPV field detection THEV detection
* respiratory signs
c
*
* AMPV vaccine detection AMPV fieldd etection THEV detection * respiratory signs
results were observed when the phylogenetic analysis was carried out on F gene (data not shown). THEV A selected THEV strain, detected during longitudinal study 3 and named THEV/IT/Ty/1037/09, was sequenced in a portion of the hexon gene (GenBank accession number: KJ372213). The nucleotide sequence of partial hexon gene of the strain THEV/IT/Ty/1037/09, aligned and compared with analogous GenBank logged THEV hexon gene sequences, revealed same differences (Fig. 5). Three unique mutations characterized the Italian strain (nucleotide position 1,347: C→T;
nucleotide position 1,967: T→A; nucleotide position 2,298: G→A). At the amino acid level, however, all examined strains were the same since none of the observed mutations affect the sense of codons (they were all silent changes).
Discussion Colibacillosis mortality was observed during all longitudinal studies at various ages, always in association with aMPV and/ or THEV. At week 4, in the first flock, a field aMPV subtype B virus, in absence of THEV, triggered off the highest weekly
134
Vet Res Commun (2014) 38:129–137
Fig. 4 Phylogenetic tree based on the alignment of nucleotide sequences of G genes of subtype B aMPVs; strains isolated in this study are reported in bold. Reference strains were (Genbank accession number are reported in parentheses): aMPV/B/Russia/ chicken/22/2010 (JN651921.1), aMPV/B/Russia/chicken/12/2010 (JN651920.1), aMPV/B/Russia/ chicken/14/2009 (JN651919.1), aMPV/B/Russia/chicken/10/2008 (JN651917.1), aMPV/B/Russia/ chicken/07/2008 (JN651916.1), aMPV/B/Russia/chicken/02/2007 (JN651915.1), aMPV/B/Ukraine/ chicken/05/2009 (JN651918.1), Hungary 657/4/89 (L34033); Italy 2119 (L34031); Spain 872S (L34034) and Israel 1708/02 (AY728268). Only bootstrap values >70 are reported
84
IT/Ty/1348-01/07
95
IT/Ty/1077-02/09
IT/Ty/129-18/04 98
IT/Ty/205-16/04
IT/Ck/34a/02 99
IT/Ty/2a/01
78
IT/Ck/33a/02 IT/Ty/1213/09 aMPV/B/Russia/chicken/10/2008
77
aMPV/B/Russia/chicken/07/2008 aMPV/B/Russia/chicken/02/2007 79
IT/Ty/Vr240/87 Italy 16/91 It 2119 NL/6726/90
94
France 38/86 91
France 147 Hungary 657/4/89
89
Spain 149 B type vaccine spain 872S Israel 1708/02 UK 8-94 70
UK 11/94 aMPV/B/Russia/chicken/12/2010 aMPV/B/Ukraine/chicken/05/2009
100
aMPV/B/Russia/chicken/14/2009
93 99
aMPV/B/Russia/chicken/22/2010
0.005
colisepticaemia mortality observed in the study. the early aMPV isolation in vaccinated birds, followed by a marked serological response, confirms that live commercial aMPV vaccines can sometime result in an incomplete protection (Banet-Noach et al. 2009). It is widely believed, and experimentally observed in turkeys, that co-infection with aMPV and E. coli can lead to an increased morbidity and a higher incidence of colisepticaemia gross lesions (Van de Zande et al. 2001). Our results support this notion and were comparable to those observed in the field by Van de Zande et al. (1998), during severe respiratory outbreaks from which aMPV and E. coli were isolated. Field aMPV detections were also made later, from week 9 to 11, in both flocks 2 and 3, after early vaccine detections. Later field aMPV subtype B detections have been already reported in Italy after homologous live vaccination (Catelli et al. 2010). These were related to elusion of the vaccine induced immunity due to field aMPV evolution concurrent
with mass live vaccine introduction (Cecchinato et al. 2010). Phylogenetic analysis of belated aMPV subtype B detections showed their similarity with Italian strains isolated after 2001 by Cecchinato et al. (2010), and their genetic distance from the vaccine. A concurrent immunosuppressive role of THEV circulation in birds at this age cannot be excluded. THEV was detected during the present survey in all flocks sampled since the 9th week of age up to the end of the study, in absence of intestinal bleeding lesions. Vaccination with a single dose of the commercial inactivated vaccine available in Italy seems do not protect the birds from the infection. Both in the pilot, or in the field study, humoral antibody response was never detected after vaccination while a rise in titres was consistently present after field virus infection. The lack of a detectable humoral immunity after vaccination with the inactivated vaccine, either administered to birds once or twice during the productive life, seems to be indicative of a poor protection after field challenge. However, the
Vet Res Commun (2014) 38:129–137 Fig. 5 Nucleotide sequence of partial THEV hexon gene of the strain THEV/IT/Ty/1037/09 (Genbank accession number: KJ372213) detected in longitudinal study 2, aligned with the homologous sequences of the following reference strains (Genbank accession number are reported in parentheses): Israel strain (AF074946); Cardona strain (AF075681); Avirulent Virginia (AY849321.1); Domermuth vaccine (DQ789974.1); Hungary isolate DV55.2000 (DQ789975.1); Hungary isolate DV70.2000.10 (DQ789973.1); Hungary isolate DV70.2000.14 (DQ789972.1). THEV/IT/Ty/1037/09 is shown in full and other residues are only specified where different to this sequence
135
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
780 800 820 840 860 880 900 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| AGATACTAGAATAGTTGCTTATGACTCTACTGATAAAATAGCAACTAGAATGGGTAACAGAATTAATTATATTGGATTTAGAGATAATTTTATAGGTTTGATGTATTATGATAATGGTGCACATAGTGGT .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
910 930 950 970 990 1010 1030 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| TCTTTGGCTACAGAAACAGGAGATATAAATTTGGTAGAACAATTGCAAGATAGAAATACAGAAATTAGTTATCAATATATGTTAGCGGATTTGATGAGTAGGAATCATTATTATAGTCAGTGGAATCAAG .................................................................................................................................. .................................................................................................................................C ........C......................................................................................................................... -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1040 1060 1080 1100 1120 1140 1160 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CTGTAGATGATTATGATTTAAATGTTAGAGTACTTACAAATATTGGTTATGAAGAGGGTCCTCCAGGTTACTGTTATCCAAGCACAGGCATGGGCAACTATCCTAATACTGTCATGTCGGTTGGGACATT .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1170 1190 1210 1230 1250 1270 1290 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| AGTGGATAATAATGGTACAACTGCTACAACAACGTCAAATACTGTAGCTGTGATGGGTTTTGGCAGTGTTCCTACTATGGAAATTAACGTTCAAGCTTATTTGCAAAAATGTTGGATGTATGCTAACATT .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1300 1320 1340 1360 1380 1400 1420 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GCAGAATATTTACCTGATAAGTATAAAAAAGCTATTCAAGGTACTAGTGAAACTGACCCAACAACTTATAGTTATATGAATAGTAGGCTTCCTAATGTGAATATGGCTGATCTCTTTACACATATTGGCG ........................................................T......................................................................... ........................................................T......................................................................... ........................................................T......................................................................... -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1430 1450 1470 1490 1510 1530 1550 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GGCGTTATAGTTTGGATGTAATGGATAATGTTAATCCTTTTAATCATCATAGAAATAGAGGTTTGCAATATAGAAGTCAAATTTTGGGTAATGGTAGAAATGTCCGTTTTCATATTCAGGTACCTCAGAA .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1560 1580 1600 1620 1640 1660 1680 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ATTTTTTGCTATTAAGAATCTATTGTTACTTCCTGGAACTTATAGTTATGAATGGTGGTTCAGGAAAGATCCAAACTTAGTGCTACAGTCTACGTTGGGAAATGATTTAAGAAAAGATGGAGCAAGCATT .................................................................................A................................................ .................................................................................................................................. .................................................................................................................................. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1690 1710 1730 1750 1770 1790 1810 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CAGTTTAGCAGTATTAGTCTTTATGCGAGTTTTTTTCCTATGGATCACGCTACTTGTAGTGAGCTTATTTTAATGCTTAGAAATGATCAAAATGATCAAACTTTTATGGATTATATGGGTGCAAAGAATA ...................................................................................C.............................................. .....AGCAGT........................................................................C.............................................. ...................................................................................C.............................................. ------------------------------------------------...................................C.............................................. -----------------------------------------------------...C...........C............................................................. ------------------------------------------..............C......................................................................... -----------------------------------------------------..............................C..............................................
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1820 1840 1860 1880 1900 1920 1940 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ATTTGTATTTAGTTCCTGCTAATCAAACTAATGTTCAGATTGAAATACCTTCTAGAGCTTGGACAGCATTTAGAGGCTGGAGTTTTAACCGAATTAAAACTGCTGAGACACCAGCTGTGTGGTCTACTTA .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. ..................................................................................................................................
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
1950 1970 1990 2010 2030 2050 2070 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| TGATCTTAATTTTAAATATTCTGGCTCTATACCTTATCTAGATGGTACATTTTATCTTTCTCACACTTTTAACTCTATGTCTATTTTGTTTGATTCAGCAATAACATGGCCAGGTAATGATAGAATGTTA ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A...................................................................................................... ...........................A......................................................................................................
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
2080 2100 2120 2140 2160 2180 2200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GTTCCGAATTTTTTTGAAATAAAAAGAGAGATAGATACGGAGGGATACACTACTAGTCAGTCTAATATGACTAAAGATTGGTATTTGATtCAAATGCTGCAAATTATAACCAGGGGTATCACGGTTATAG .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. .................................................................................................................................. ..................................................................................................................................
THEV/IT/Ty/1037/09 Israel strain Cardona strain Avirulent Virginia strain Domermuth vaccine isolate DV55.2000 isolate DV70.2000.10 isolate DV70.2000.14
2210 2230 2250 2270 2290 2310 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|.... TTTTCCAGCAGATAAAGTATACAGACAGTATGATTTTATGTCAAATTTTGATTCTATGTCTGTTCAAGTACCCCGGTCAGGTCTGGCATTTTTGTTTGATGAAAATTATAACTTGATAGTAAAT .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A.......................... .................................................................................................A..........................
efficacy of live vaccination is largely documented (Pierson and Fitzgerald 2008) but unfortunately those live vaccines, widely used in USA and in some European countries, are not available in Italy. The absence of overt clinical signs of THEV infection observed in our survey, could be due, besides the partial vaccinal protection, to low pathogenicity of circulating strains (A-THEV). Full-length genome sequencing of virulent and avirulent THEV strains allowed to identify mutations in specific genes,
which could be responsible for virus virulence (Beach et al. 2009b). Identification of those mutations, by sequencing wide portions of THEV genome, along with assessment of virus virulence in secure experimental conditions, would be needed in order to precisely define the pathogenicity of the strains detected in the present study. Sequence comparison of the hexon protein of one of those strains revealed high similarity (100 %) with THEV strains isolated worldwide. These results are consistent with the notion that the hexon protein, being the
136
major antigenic component of the virus, is highly conserved between the strains (Beach et al. 2009b). This is the first sequence analysis available for a THEV strain isolated in Italy. The control of colibacillosis is closely related to the minimization of predisposing factors (Barnes et al. 2008). Our results clearly show that field aMPV infection is directly correlated to colisepticaemia mortality. Although largely reported in the literature (Larsen et al. 1985; Sponemberg et al. 1985; Newberry et al. 1993; Van De Hurk et al. 1994; Pierson et al. 1996a; Pierson et al. 1996b; Palya et al. 2007; Koncicki et al. 2012), less clear appears, in our study, the role of THEV because the endemicity of aMPV makes difficult to evaluate its role in predisposing colibacillosis in absence of aMPV. Moreover, experimental data about a possible role of THEV in exacerbating respiratory disease due to aMPV are not available. It would be interesting to further investigate those issues through experimental trials in secure isolation conditions.
References Alessandri E, Della Valentina M, Vinco LJ (2008) Enterite Emorragica nel tacchino: Esperienze di campo. Atti della Società Italiana di Patologia Aviare 2008 In “Tavola Rotonda: Virosi emergenti e reemergenti nell’allevamento avicolo”. Italy: Teramo May 16, 2008. 25–34 Banet-Noach C, Simanov I, Laham-Karam N, Perk S, Bacharach E (2009) Longitudinal survey of avian metapneumoviruses in poultry in Israel: infiltration of field strains into vaccinated flocks. Avian Dis 53:184–189 Barnes JH, Nolan LK, Vaillancourt JP (2008) Colibacillosis. In: Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE (eds) Diseases of poultry, 12th edn. Blackwell Publishing, Ames, pp 691–737 Beach NM, Duncan RB, Larsen CT, Meng XJ, Sriranganathan N, Pierson FW (2009a) Persistent infection of turkeys with an avirulent strain of turkey hemorrhagic enteritis virus. Avian Dis 53:370–375 Beach NM, Duncan RB, Larsen CT, Meng XJ, Sriranganathan N, Pierson FW (2009b) Comparison of 12 turkey hemorrhagic enteritis virus isolates allows prediction of genetic factors affecting virulence. J Gen Virol 90:1978–1985 Brown PA, Lupini C, Catelli E, Clubbe J, Ricchizzi E, Naylor CJ (2011) A single polymerase (L) mutation in avian metapneumovirus increased virulence and partially maintained virus viability at an elevated temperature. J Gen Virol 92:346–54 Catelli E, Cook JKA, Chesher J, Orbell SJ, Woods MA, Baxendale W, Huggins MB (1998) The use of virus isolation, histopathology and immunoperoxidase techniques to study the dissemination of a chicken isolate of avian pneumovirus in chickens. Avian Pathol 27:632– 640 Catelli E, Terregino C, De Marco MA, Delogu M, Guberti V (2001) Serological evidence of avian pneumovirus infection in reared and free-living pheasants. Vet Rec 149:56–58 Catelli E, Cecchinato M, Delogu M, De Matteo P, Ortali G, Franciosi C, De Marco A, Naylor CJ (2004) Avian pneumovirus infection in turkey and broiler farms in Italy: a virological, molecular and serological field survey. Ital J Anim Sci 3:287–292
Vet Res Commun (2014) 38:129–137 Catelli E, Cecchinato M, Savage CE, Jones RC, Naylor CJ (2006) Demonstration of loss of attenuation and extended field persistence of a live avian metapneumovirus vaccine. Vaccine 24:6476–6482 Catelli E, Lupini C, Cecchinato M, Ricchizzi E, Brown P, Naylor CJ (2010) Field avian Metapneumovirus evolution avoiding vaccine induced immunity. Vaccine 28:916–921 Cecchinato M, Catelli E, Lupini C, Ricchizzi E, Clubbe J, Battilani M, Naylor CJ (2010) Avian metapneumovirus (aMPV) attachment protein involvement in probable virus evolution concurrent with mass live vaccine introduction. Vet Microbiol 146:24–34 Cecchinato M, Lupini C, Ricchizzi E, Falchieri M, Meini A, Jones RC, Catelli E (2012) Italian field survey reveals a high diffusion of avian metapneumovirus subtype B in layers and weaknesses in the vaccination strategy applied. Avian Dis 56:720–724 Cecchinato M, Drigo M, Lupini C, Martini M, Listorti V, Franzo G, Bonci M, Laconi A, Morandini E, Catelli E (2013a) Diffusione dell’infezione da metapneumovirus aviare in allevamenti di tacchini e broiler nel Nord Italia. Large Animal Rev 19:267–270 Cecchinato M, Lupini C, Munoz Pogoreltseva OS, Listorti V, Mondin A, Drigo M, Catelli E (2013b) Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B. Avian Pathol 42:283–289 Ceruti R, Della Valentina M, Gavazzi L, Venni A, Ferrazzi V, Grilli G (2007) Haemorrhagic enteritis seroconversion in turkey breeders: field observations. Ital J Anim Sci 6:321–325 Clark S (2011) Turkey Industry Annual Report -Current Health and Industry Issues Facing the Turkey Industry. Proc. 115th Annual Meeting Of The United States Animal Health Association, Buffalo, New York, September 29–October 5, 2011, pp. 433–438 Giovanardi D, Lupini C, Pesente P, Rossi G, Ortali G, Catelli E (2013) Characterization and antimicrobial resistance analysis of avian pathogenic Escherichia coli isolated from Italian turkey flocks. Poult Sci 92:2661–2667 Hess M, Raue R, Hafez HM (1999) PCR for specific detection of haemorrhagic enteritis virus of turkeys, an avian adenovirus. J Virol Methods 81:199–203 Koncicki A, Tykałowski B, Stenzel T, Smiałek M, Pestka D (2012) Effect of infection of turkeys with haemorrhagic enteritis adenovirus isolate on the selected parameters of cellular immunity and the course of colibacillosis. Pol J Vet Sci 15(2):215–220 Larsen CT, Domermuth CH, Sponenberg DP, Gross WB (1985) Colibacillosis of Turkeys exacerbated by hemorrhagic enteritis virus. Laboratory studies. Avian Dis 29(3):729–732 Listorti V, Lupini C, Cecchinato M, Pesente P, Rossi G, Naylor CJ, Catelli E (2014) Rapid detection of subtype B avian metapneumoviruses using RT-PCR restriction endonuclease digestion indicates field circulation of vaccine-derived viruses in older turkeys. Avian Pathol 43(1):51-56 Mandelli G, Rampin T, Guidobono CL, Gallazzi D (1977) Enterite emorragica da adenovirus nel tacchino. Clin Vet 100:437–447 Newberry LA, Skeeles JK, Kreider DL, Beasley JN, Story JD, McNew RW, Berridge BR (1993) Use of virulent hemorrhagic enteritis virus for the induction of colibacillosis in Turkeys. Avian Dis 37(1):1–5 Palya V, Nagy M, Glávits R, Ivanics E, Szalay D, Dán A, Süveges T, Markos B, Harrach B (2007) Investigation of field outbreaks of turkey Haemorrhagic enteritis in Hungary. Acta Vet Hung 55(1): 135–149 Pierson FW, Fitzgerald SD (2008) Hemorrhagic enteritis and related infections. In: Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE (eds) Diseases of poultry, 12th edn. Blackwell Publishing, Ames, pp 276–286 Pierson FW, Larsen CT, Domermuth CH (1996a) The production of colibacillosis in turkeys following sequential exposure to Newcastle disease virus or Bordetella avium, avirulent hemorrhagic enteritis virus, and Escherichia coli. Avian Dis 40:837–840
Vet Res Commun (2014) 38:129–137 Pierson FW, Barta VD, Boyd D, Thompson WS (1996b) Exposure to multiple infectious agents and the development of colibacillosis in turkeys. J Appl Poult Res 5:347–357 Rautenschlein S, Sharma JM (2000) Immunopathogenesis of haemorragic enteritis virus (HEV) in turkeys. Dev Comp Immunol 24:237–246 Saunders GK, Pierson FW, Van Den Hurk JV (1993) Haemorhagic enteritis virus infection in turkeys: a comparison of virulent and avirulent virus infections, and a proposed pathogenesis. Avian Pathol 22:47–58 Sponenberg DP, Domermuth CH, Larsen CT (1985) Field outbreaks of colibacillosis of turkeys associated with hemorrhagic enteritis virus. Avian Dis 29:838–842
137 Turpin EA, Perkins LE, Swayne DE (2002) Experimental infection of turkeys with avian pneumovirus and either Newcastle disease virus or Escherichia coli. Avian Dis 46:412–422 Van den Hurk J, Allan BJ, Riddell C, Watts T, Potter AA (1994) Effect of infection with hemorrhagic enteritis virus on susceptibility of turkeys to Escherichia coli. Avian Dis 38(4):708–716 Van de Zande S, Nauwynck H, Cavanagh D, Pensaert M (1998) Infections and reinfections with avian pneumovirus subtype A and B on Belgian turkey farms and relation to respiratory problems. J Vet Med B 45:621–626 Van de Zande S, Nauwynck H, Pensaert M (2001) The clinical, pathological and microbiological outcome of an Escherichia coli O2:K1 infection in avian pneumovirus infected turkeys. Vet Microbiol 81:353–365
