Current Genetics

Curr Genet (1992) 21:417-422

9 Springer-Verlag 1992

Loss of transfer RNA genes from the plastid 16S-23S ribosomal RNA gene spacer in a parasitic plant Charles E Wimpee, Rodney Morgan, and Russell L. Wrobel* Department of Biological Sciences, University of Wisconsin, Milwaukee, P.O. Box 413, Milwaukee, WI 53201, USA Received September 9, 1991

Summary. The plastid 16S-23S intergenic spacer region in Conopholis americana, a totally heterotrophic angiosperm in the family Orobanchaceae, has undergone large deletions, including the entire tRNA "e gene and all but small remnants of the tRNA Al" gene. The length of the region is less than 20% of that of other land plants which have been investigated, making it the smallest 16S23S intergenic spacer reported thus far for any land plant. The remaining sequences in the spacer are 90.1% identical to tobacco, indicating that, while the region is well conserved at the sequence level, it is evolving rapidly by deletion. Experiments using the polymerase chain reaction and hybridization to D N A gel blots have failed to reveal either of the two missing tRNA genes elsewhere in the Conophotis cell. Key words: Conopholis americana - Organelle evolution Plastid genome - Achlorophyllous plants

Introduction The arrangement of genes in the rRNA operon ofplastids is an ancient one, predating the evolution of plastids as organelles. The gene order 16S-tRNAIIe-tRNAA]a-23S-5S is clearly the ancestral arrangement, and can be found in the rRNA operons of several eubacteria, including Escherichia coli (Young etal. 1979), Bacillus subtilis (Loughney et al. 1982), and Anacystis nidulans (Williamson and Doolittle 1983). With some variations, a similar gene order is recognizable in plastid genomes from organisms as diverse as land plants (Koch et al. 1981; Takaiwa and Sugiura 1982; Ohyama et al. 1986; Massenet et al. 1987; de Lanversin etal. 1987), chlorophyte algae (Rochaix and Malnoe 1978), charophyte algae (Manhart * Present address: Department of Botany, North Carolina State University, Raleigh, NC 27695, USA Offprint requests to: C. E Wimpee

and Palmer 1990), chromophyte algae (Markowitz et al. 1988; Delaney and Cattolico 1989), rhodophyte algae (Maid and Zetsche 1991) and Euglena (Graf et al. 1980), as well as the cyanelles of Cyanophora paradoxa (Janssen etal. 1987). Even the apparently extreme departures from the ancestral gene order found in the plastids of certain chlorophytes (Yamada and Shimaji 1986, 1987; Manhart et al. 1989, 1990) can be explained by relatively simple rearrangements. In every case reported thus far, even those in which regions of the rRNA operon have undergone inversion (Yamada and Shimaji 1986, 1987) or transposition (Manhart et al. 1990), the positions of the tRNA II~ and tRNA gin genes relative to the 16S and 23S genes are invariant. In the plastids of land plants and certain charophytes, these two tRNA genes differ from their eubacterial, chromophyte, and rhodophyte counterparts by the presence of a large intron in each (Koch et al. 1981; Takaiwa and Sugiura 1982; Ohyama etal. 1986; Massenet et al. 1987; de Lanversin et al. 1987; Manhart and Palmer 1990). The presence of the introns accounts for the greater length of the 16S-23S spacer (1.6-2.4 kilobases) in these plastids, as compared to eubacteria, chromophytes, and rhodophytes, where the spacer is typically about 300-600 base pairs. Conopholis americana is a completely heterotrophic land plant in the family Orobanchaceae (Percival 1931). Like the related parasite Epifagus virginiana (dePamphilis and Palmer, 1990), the plastid genome of Conopholis has undergone large deletions, including essential photosynthesis genes, but retains full-length 16S and 23S rRNA genes which are transcribed and processed (Wimpee et al. 1991). We have recently determined the nucleotide sequence for the entire plastid rRNA gene cluster of Conopholis (Wimpee et al. 1992) and found that, in addition to a relatively high degree of sequence divergence in rRNA genes, Conopholis has a drastically abbreviated 16S-23S spacer region. In the present paper, we report that the tRNA lie and tRNA g]a genes are not only missing from the abbreviated 16S-23S spacer, but can not be detected elsewhere in the C. americana cell.

418

Materials and methods Nucleic acid isolation. DNA was isolated from Conopholis fruit tissue using the procedure of Doyle and Doyle (1987). Plasmid DNA was isolated using the procedure of Birnboim and Doly (1979). Single-stranded DNA was isolated from bacteriophage M13 clones using procedures described by Ausubel et al. (1987). Primer synthes& and DNA amplification. Primers were synthesized on an automated DNA synthesizer using phosphoramidite chemistry. Primers were purified by elution from polyacrylamide gels (Ausubel et al. 1987). DNA was amplified by 30 cycles of the polymerase chain reaction (Saiki et al. 1985, 1988) under the following conditions: denaturation for 1.25 min at 94 ~ primer annealing for 2 min at 37 ~ and primer extension for 2 rain at 72 ~ using 2.5 units of Taq Polymerase in a 100 til volume, and buffer conditions described in the Perkin Elmer Cetus (Norwalk, CT, USA) GeneAmp kit. Gel electrophoresis, blotting, and hybridization. DNA was fractionated on horizontal agarose gels in TAE buffer (Maniatis et al. 1982) and was transferred to nitrocellulose using a vacuum blotting apparatus. Double-stranded probes were prepared by random priming (Feinberg and Vogelstein 1983), and single-stranded oligonucleotide probes were prepared by end-labelling (Richardson 1981). Hybridizations were performed in 5 x SSC, 50% formamide, 10% dextran sulfate at 42~ Post-hybridization washes were done in 1 x SSC, 0.1% SDS at 50~

Results

A 7.1 kb BamHI fragment of Conopholis plastid D N A containing the rRNA genes was cloned and mapped (Wimpee et al. 1991), and the entire rRNA gene cluster was sequenced (Wimpee et al. 1992). A map of the gene cluster is shown in Fig. 1 compared with a diagram of the same gene cluster from Nicotiana tabacum (tobacco) plasrids. The most striking feature of the Conopholis map is the extraordinarily short spacer region between the 16S and 23S genes. While the tobacco spacer has a length of

Kilobases

0 I

I I

B

E

I~s N. tabecum

I

2 I

E

3 I

4 I

HH

"'"-..

5 I

H z3s

6 I

H

E

8 I

B

4.~s ~s

~k'-,',,\\\qH~',.'-,,,",~ 16S

7 I

tRNAIle tRNAAl~

1-0-0 23S

4.5S 5S

Fig. 1. A restriction map of the cloned 7.1 kb fragment of the C. americana plastid genome containing the rRNA gene duster. B, BamHI; E, EcoRI; H, HindIII. For comparison, a diagram of the Nicotiana tabacum (tobacco) plastid rRNA gene cluster is shown below that of Conopholis

2,080 base pairs (Takaiwa and Sugiura 1982), the length of the Conopholis spacer is only 398 base pairs. The nucleotide sequence of the Conopholis spacer was aligned with that of tobacco (Fig. 2). The sequence of the Conopholis spacer is very similar to the tobacco spacer, but has suffered extensive deletions, including the entire tRNA ne gene, and all but 49 nucleotides of the tRNA Ala gene. Those remnants of the tRNA Ala gene consist of four short stretches of 13, 10, 12, and 14 base pairs, respectively, the first three of which correspond to regions of the intron, and the fourth (with 2 mismatches) to a small region of the second exon. The locations of the conserved regions of the Conopholisspacer relative to that of tobacco are shown in Fig. 3. The obvious lack of the tRNA genes in the cloned rRNA gene cluster of Conopholis raised the question of whether a full-length spacer existed elsewhere in the genome, or whether one or both of the tRNA genes had been translocated intact to another position. To investigate this, a "forward" primer corresponding to positions 1443-1462 of the 16S gene and a "reverse" primer corresponding to positions 22-42 of the 23S gene were synthesized in order to amplify the spacer region from Conopholis and tobacco via the polymerase chain reaction (PCR). These regions of the 16S and 23S genes are identical in Conopholisand tobacco (Wimpee et al. 1992). In addition, primers corresponding to each exon of the two tRNA genes were synthesized, based on sequences from tobacco (Takaiwa and Sugiura 1982) and maize (Koch et al. 1981). The 5' exons were synthesized as "forward" primers, and the 3' exons were synthesized as "reverse" primers. The sequences of all of the oligonucleotide primers used in this study are shown in Table 1. The positions of the 16S and 23S primers predicted amplification products of 2,165 bp and 485 bp from tobacco and Conopholis, respectively. Figure 4 B and C show that the amplification products were of the predicted size, indicating that no full-length copy of the 16S-23S spacer was detected elsewhere in Conopholis. Using the tRNA gene primers, full-length tRNA n~ and tRNA Ala genes (778 and 781 bp, respectively) were amplified from tobacco (Fig. 4D and F), but no amplification products were detected in Conopholis (Fig. 4 E and G). The results of the PCR experiments did not rule out the possibility that fragments of the spacer, no longer bracketed by the PCR primers used, may have been translocated to positions elsewhere in the plastid genome or to another cellular compartment. This possibility was investigated by labelling the tobacco amplification products and using them to probe total cellular D N A from

Table 1. Oligonucleotide primers used in this study

Primer

Direction

Sequence

16S 23S tRNA ne 5' exon tRNA ne 3' exon tRNA Ma 5' exon tRNA A~a3' exon

Forward Reverse Forward Reverse Forward Reverse

5'-TAACAAGGTAGCCGTACTGG-3' 5'-CTGGGTGCCTAGGTATCCACC-3' 5'-GGGCTATTAGCTCAGTGGTAGAGCGCGCCCCTG-3' 5'-TGGGCCATCCTGGACTTGAACCAGAGACCTCGCCCG-3' 5'-GGGGATATAGCTCAGTTGGTAGAGCGCCGCTCTTGC-3' 5'-TGGAGATAAGCGGACTCGAACCGCTGACATCCGCC-3'

4t9 C . a . AAAGGGAGAGCIAATGCTTGTTGGGTATTTTGGTTTGACACTGCTTCA

.......

N.t.

CACCCCC . . . . . . . .

IC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

AAAAAAAAAA . . . . .

GCTACATCTIAGTTAAACTTGGAGATGGAATTTGTCTTTCGTIICTCGAC

G.AGGGA. . . . .

G..,G ....................

G.CT . . . . . .

C . a . GATGAAGIAAAACCAAGCTCATTAGCTTATTATCCTAGGTCGGAACAAGTT--TAGAT-CCCCTTATTTTTTTTTT

....................................

N.t.

ACGTCCCCATGTTCCCCCCGTGTGGCGACATGGGGC.A

.G . . . . . . . .

G. . . . - . . . . . .

G. . . . . . . . . . . . . . . . . . . . . . . . . . . .

GA..,GAC . . . . . .

- .... - .....

108

C. . . . . . . . .

120

GCA/LAAAA .....

G

188 232

trnl exon I C.a. AAAATGAGC ......................................................... i ................................... " t ............... N.t. G•.•-•..AGGGA•GGGGTTTCTCT•G•TTT••GCATAGCGGGC•C••AGT•GGAGGCTCGCACGAqGGGcTATTAGC••AGT•GTAGAGCGCGCCc•TGATAAFTG•GTCGT•G•GCCT

198 351

C . a . - ....................................................................................................................... N.t, GGGCTG•GAGGGC•TCT•AGC•ACATGGATAGTTCAATGTGCTCATcGGCGCCTGA•c•TGAGATGTGGATCATCCAAGG•ACATTAG•ATGGCGTA•TC•T•CTGTTCGAA•CGGGGTT

471

C,a.-

......................................................................................................................

N.t. TGAAA•CAAACTCCTCCTCAGGAGGATAGATGGGG•GATTCGGGTGAGATCCAATGTAGATCCAACTTT•GATT•A•TCGTGGGATCCGGGCGGTCCGGGGGGAC•A•CACGGCTCC•CT

591

C , a . - ....................................................................................................................... N,t. CTTCTCGAGAATC•ATA•ATC••TTATCAGTGTA•GGACAGCTATCTCTCGAGCACAGGTTTAGCAATGGGAAAATAAAATGGAGCAC•TAA•AA•GCATCTT•ACAGAC•AAGAACTAC

711

C , a , - ....................................................................................................................... N.t. GAGA•CGCCCCTTT•ATT•TGGGGTGA•GGAGGGATCGTA••ATTCGAGCCGTTTTTTTCTTGA•T•GAAATGGGAGCAG•TTTGAAAAAGGAT•TTAGAGTGTCTAGG•TTGGGCCAGG

831

C . a . - ....................................................................................................................... N.t. AGGGTCTCTTAACGC•TT•TTTTTT•TTCTCAT•GGAGTTATTTCACAAAGA•TTGCCAGGGTAAGGAAGAAGGGGGGAACAAG•A•A•TTGGAGAGCG•A•TA•AACGGAGAGTTGTAT trnl exon 2 C , a , - ......................................................................................... -r-............................. N.t. GCTG~GTTCGGGAAGGATGAATCGCTCC~GAAAAGGAATCTATTGATT~TCT~AATTGGTTGGAc~GTAGGTGCGATGATTTACTTC~CGGGCGAGGT~TcTGGTTCAAGT~CAGGAT trnAexon I N.t. GGCCC GCTGCGCCAGGGAAAAGAATAGAAGAAGCATCTGACTACTTCATGCATGCTCCACTTGGCTCG

GGGATAIAGCTCAGTTGGTAGAGCTCCGCTCTTGC

C.a.

- ......................................................................

GTTCTTAAGGCTAAA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

N,t.

GATTACGGGI~GGATGTCIAATTGTCCAGGCGGTAATGATAGTATCTTGTACCTGAACCGGTGGCTCACITT

951

1071

TTGGGTCGTTGC 1191 213

. . . . -...--...TGGGGAAGAGGACCGAAACGTGCCACTGAAAGACT

1308

C,a.- ....................................................................................................................... N , t . CTA~T~A~ACAAAGATGGG~TGT~AAGAAcG~AGA~GAGGTAG~ATGGG~AGTTGGTCAGATCTA~TATG~AT~GTA~AT~AC~GTAGTT~GA~TCGG~GG~T~TC~AGG~TT~CTC

1428

C,a,- ........................................................................................................................ N , t . ATcTGAGATcTcTGGGGAA~AGGATcAAGTT~GcC~TT~cGAACAGCTTGATGcA~TATCTCCCTTcAAcCcTT~A~C~AAATG~cAAAAGAAAAGGAAG~AAAATC~ATGGACCGA

1548

C.a.- ....................................................................................................................... f l . t , ccCCATCATCTC•ACcccGTAGGAAcTAcGAGATcAcccCAAGGAA•GcCTT•GGCAT•cA•GGGTcAcGGACcGAcCA•AGAACc•TGTTCAATAAGTGGAAC•cATTAGCTGTCCGCT

1668

C.a.N,t.

1788

.......................................................................................................................

cTcAG~TTGGGcAGTCAGGGTCG~AGAAGGGCAATGACTCATTcTTAGTTAGAATGGGATTCCAACTcAGCACCTTTTGAGTGAGATTTTGAGAAGA~TTGCTCTTTGGAGAGCA~AGTA t r n A exon 2

................................................................ C.a. N . t . CGATGAAAGTTGTAAGCTGTGTTCGGGGGGGAGTTATTGTCTATCGTTGGCCTCTATGGTAGAATC C . a . G. . . . . . . . . . . . . . .

GAGTCGGGGGG. . . . GGGC-GCGGTGGTTTAC---~GT---ATGTCAACAGTTC ]

.........

~- ...........................................................................

-ACCT.A.AG . . . . . . . . . . . .

CCT~.GCGG . . . . . .

G.G . . . .

ATCTA--ATGGACGTTGATAATATCCA

258 1907 284

l

N.t.

"AGI~CGCTIATCTcC/~CTcGTGAAcTTAGc~GATACAAA~CTTTAC~ATAG~AcCCAATTTTTcc~ATTCG~CG~TTCGATCTAT~ATTTT-~'ATTC

..............

G. . . . .

398

C . a . T••ATITA••AG•AccTTA•GAT••cATAGcGc•TTATATTATTATTATATAcTTATATTMTATTATATATATATATTAAAAATAAAAAAAAAATATAAGTAATAAGGGTGAGG N.t ...............................

--.

....

A.- ...........................................................

...G--.

2027

....

c ....

2078

Fig. 2. The nucleotide sequence of the 398 base pair C. amer~ana (C.a.) plastid 16S-23S spacer region aligned with the 2 078 base pair spacer of N. tabacum.(N.t.). Nucleotide identity is designated by a dot (.). Insertions/deletions are designated by a dash (-). Nucleotide positions are numbered from the beginning of the spacer region in each sequence. Exons of the tRNA n* (trnI) and tRNA A1~(trnA) genes are boxed

C ~zm##/CG/?~7

RNA zl'

t RNA AJ~

Fig. 3. Relative positions of blocks of nucleotid e sequence similarity in the 16S-23S spacer regions of C. americana and N. tabaeum, according to the alignment in Fig. 2. "Similarity" was defined as a stretch often nucleotides or more which show at least 75% identity between the two sequences. Open blocks represent intergenic regions, solid blocks represent exons, and crosshatched blocks represent introns. Lines between boxes represent regions which do not meet our criterion for similarity, either because of mismatch or insertion/deletion

Conopholis. As positive hybridization controls, tobacco and spinach total cellular D N A were also probed. Figure 5 A shows a control hybridization in which a cloned 23S r R N A gene from the lettuce plastid genome (Jansen and Palmer 1987) was hybridized to EcoRI di-

gests of total cellular D N A f r o m Conopholis, tobacco, and spinach. In all three plants, the 23S gene and the 16S-23S spacer region are on the same EcoRI fragment (Takaiwa and Sugiura 1982; Massenet et al. 1987; Wimpee et al. 1992). The resulting signals demonstrate that only fragments of the predicted sizes (4.6kb in Conopholis; 4.3 kb in tobacco; 4.6 kb in spinach) hybridized to the 23S probe, and that the a m o u n t ofplastid D N A in each total cellular D N A sample is approximately equal. In Fig. 5 B, the amplified tobacco 16S-23S spacer was hybridized to Conopholis, tobacco, and spinach. The autoradiogram was overexposed in order to obtain a sufficiently strong signal from Conopholis. In addition to the expected 4.6 kb EcoRI fragment in Conopholis, an additional weak signal was detected at 4.0 kb. In numerous other experiments (data not shown) the tobacco spacer consistently hybridized weakly to a specific fragment in Conopholis which does not m a p to the r R N A gene cluster. N o hybridization o f the amplified t R N A n~ gene to Conopholis was detected, even with the extreme overexposure shown in Fig. 5 C. The t R N A A~a gene, however, hybridized to a Conopholis fragment of the same size

420 (4.0 kb) as that which showed weak hybridization to the total spacer probe (Fig. 5 D). A barely detectable signal at 4.6 kb in the Conopholis lane in Fig. 5 D presumably results from those small regions of the t R N A A~agene that remain in the Conopholis spacer (see Fig. 3). The weak signal in Conopholis (in comparison to tobacco and spinach) obtained from the t R N A AI" gene probe makes it improbable that the gene has been translocated intact (i.e., with its intron) to another location. However, the possibility that an intronless plastid t R N A A~"gene existed

elsewhere in the Conopholis cell required investigation. The 5' and 3' exons of the t R N A Al" gene were end-labelled and hybridized separately to Conopholis, tobacco, and spinach. The 5' exon failed to hybridize to Conopholis, although it produced the expected strong signals in tobacco and spinach (Fig. 5 E). The 3' exon hybridized to a 4.0 kb fragment in Conopholis, as did the total t R N A AI" gene probe and the tobacco spacer probe. The signal, however, was much weaker in Conopholis than in tobacco or spinach. We conclude from these hybridizations that, although a fragment with sequence similarity to the 3' exon of the t R N A Ala gene exists in Conopholis, full-length t R N A Ala and t R N A ne genes cannot be detected.

Discussion

Fig. 4. PCR amplification products using primers corresponding to: positions 1 443-1 462 of the 16S gene and positions 22-42 of the 23S gene (lanes B and C), the 5' and 3' exons of the tRNA n~gene (lanes D and E), and the 5' and 3' exons of the tRNA Al"gene (lanes F and G). Lanes B, D, and F show amplification products from 100 nanograms of tobacco total cellular DNA after 40 cycles. Lanes C, E, and G show amplification products from 100 nanograms of Conopholis total cellular DNA after 40 cycles. Lane A shows sizes (in base pairs) for the relevant range of size markers

The colinear regions of the tobacco and Conopholis spacers are 90.1% identical. The same regions of tobacco and spinach (Massenet et al. 1987) are 85.4% identical. The observed sequence similarities are consistent with the closer evolutionary relationship between Conopholis and tobacco (subclass Asteridae) as compared with spinach (subclass Caryophillidae) (Cronquist 1968). These sequence similarities, however, were measured in regions representing only 19% of the total length of the tobacco spacer. The remaining regions are deleted in Conopholis. The enormity of these deletions in Conopholis is very unusual. In all angiosperms investigated thus far, the spacer is over 2 kb in length and, in those which have been sequenced, shows a high degree of sequence identity (Koch et al. 1981; Takaiwa and Sugiura 1982; Massenet

Fig. 5A-E Autoradiograms of DNA gel blots hybridized with: a lettuce 23S gene (panel A), the PCR-amplified tobacco 16S-23S spacer region (panel B), the amplified tobacco rRNAn~ gene (panel C), the amplified tobacco rRNA A~"gene (panel D), the 5' exon of

the t R N A Al~ gene (panel E), and the 3' exon of the t R N A AI~ gene (panel F). Each gel blot contains EeoRI digests of total cellular DNA from Conopholis (lane 1), tobacco (lane2), and spinach (lane 3). Sizes in kilobases (kb) are indicated for the markers

421 et al. 1987). The alignment between the Conopholis and tobacco spacers shows four large gaps of 37, 1 024, 580, and 91 bases, and four remnants of the t R N A Ala gene, three of which are separated by small gaps of three, four and three bases, respectively. This pattern suggests that the abbreviation of the Conopholisspacer is not the result of one massive deletion, but rather involved a number of events.

The presence of 16S and 23S r R N A in Conopholis (Wimpee et al. 1991) demonstrates that, in spite of the loss of most of the spacer region, the processing of the r R N A precursor is apparently correct. Since the splicing out of the t R N A introns represents a separate processing event, the loss of these sequences from the spacer region of Conopholis should not affect the generation of mature 16S and 23S rRNAs from the primary transcript. Based on sequence comparison in the 16S-23S spacer region (not including t R N A introns) of soybean, tobacco, and maize, de Lanversin et al. (1987) proposed a total of 17 regions of potential base pairing, resulting in 13 possible stem-loop structures. Those investigators speculated that the potential secondary structures may play a role in processing of the r R N A precursor, although they pointed out that additional phylogenetic comparisons, as well as structure-probing experiments, are necessary to confirm this speculation. In a comparison of the Conopholis 16S-23S spacer sequence with the secondary structures proposed by de Lanversin et al. (1987), only seven of the suggested regions of base pairing are (imperfectly) conserved. The remaining regions are deleted in Conopholis. Our data are thus inconsistent with the proposal that these stem-loop structures play a role in the processing of the r R N A precursor. It is clear that the t R N A n~ and t R N A AI" genes normally found in the 16S-23S spacer are missing from the Conopholis spacer, and cannot be detected elsewhere in the cell. This finding raises serious questions about the capability of Conopholisplastids to carry out protein synthesis. The lack of a full complement of t R N A genes in the plastid genome o f Conopholis implies at least three possibilities: (1) plastid protein synthesis requires the import of cytoplasmic tRNAs, (2) plastid protein synthesis is restricted to proteins containing those amino acids for which functional tRNAs exist, or (3) Conopholisplastids do not carry out protein synthesis. Direct evidence favoring any one of these three possibilities is presently lacking. We have, for example, found no obvious lethal mutations in the plastid r R N A genes o f Conopholis, although the sequences are apparently evolving more rapidly than those of green plants (Wimpee et al. 1992). The more extensively characterized plastid genome of Epifagus has been shown to lack not only certain tRNAs (Taylor et al. 1991), but also genes encoding five ribosomal proteins (Morden et al. 1991; J. Palmer, personal communication). If functional ribosomes can be assembled in such plastids, it would mean that either those ribosomal proteins are not essential, or else that they, too, must be imported. The latter possibility would require acquisition of transit sequences. It should also be pointed out that, while the Epifagus plastid genome has lost numerous protein-coding genes, other have remained intact, sug-

gesting the possibility that they are functional (Morden et al. 1991; Wolfe et al. 1992). Plants like Conopholis and Epifagus offer a rare glimpse at the process by which large-scale genomic changes occur in organelles. Although, under normal circumstances, the plastid genome is the most slowly evolving genome in the plant cell (Palmer 1985, 1990; Sugiura 1989), the release from selective pressure brought about by the abandonment of photosynthesis has resulted in dramatic genomic changes in a short time frame [the Orobanchaceae are thought to be between 5 million and 50 million years old (Muller 1981)]. The loss of photosynthesis genes was predictable, but it seems surprising that genes involved in protein synthesis would also be affected, particularly if other plastid-synthesized proteins are required in land plants. Although we acknowledge that the plastids in these parasites may retain the ability to perform protein synthesis, we (for the present) suggest the possibility that the genes found in the plastids of Conopholis and Epifagus are the last remnants of a nonfunctional genome.

Acknowledgements.The authors thank Denise Garvin for expert technical assistance, Barbara Wimpee for drawing the figures, and Dr. Mike Clegg, Dr. Harry Noller, and Dr. Jane Silverthorne for critical reading of the manuscript. This work was supported by grant to C.EW. from the Shaw Fund of the Milwaukee Foundation, and funds from National Science Foundation grant BSR-8817992. The nucleotide sequence data reported will appear in the GenBank, EMBL, and DDBJ Nucleotide Sequence Databases under the accession number X58864. References Ausubel FM, Brent R, Kingston RE, Moore DD, Smith JA, Seidman JG, Struhl K (1987) Current protocols in molecular biology. John Wiley and Sons, New York Birnboim HC, Doly J (1979) Nucleic Acids Res 7:1513-1523 Cronquist A (1968) The evolution and classification of flowering plants. Houghton Mifflin Company, Boston Delaney TP, Cattolico RA (1989 Curr Genet 15:221-229 dePamphilis CW, Palmer JD (1990) Nature 348:337-339 Doyle JJ ,Doyle JL (1987) Phytochem Bull 19:11-15 Feinberg A, Vogelstein B (1983) Anal Biochem 132:6-13 Graf L, Kossel H, Stutz E (1980) Nature 286:908-910 Jansen RK, Palmer JD (1987) Curr Genet 11:553-564 Janssen I, Mucke H, Loffelhardt W, Bohnert HJ (1987) Plant Mol Biol 9:479-484 Koch W, Edwards K, Kossel H (1981) Cell 25:203-213 Lanversin G de, Pillay DTN, Jacq B (1987) Plant Mol Biol 10:65-82 Loughney K, Lund E, Dahlberg JE (1982) Nucleic Acids Res 10:1607-1624 Maid U, Zetsche K (1991) Plant Mol Biol 16:537-546 Manhart JR, Palmer JD (1990) Nature 345:268-270 Manhart JR, Kelly K, Dudock BS, Palmer JD (1989) Mol Gen Genet 216:417-421 Manhart JR, Hoshaw RW, Palmer JD (1990) J Phycol 26:490-494 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York Markowicz Y, Mache R, Loiseaux-De Goer S (1988) Plant Mol Biol 10:465 - 469 Massenet O, Martinez P, Seyer P, Briat J-F (1987) Plant Mol Biol 10:53-63 Morden CW, Wolfe KH, dePamphilis CW, Palmer JD (1991) EMBO J 11:3281-3288

422 Muller J (1981) Bot Rev 47:1-142 Ohyama K, Fukuzawa H, Kohchi T, Shirai H, Sano T, Sano S, Umesono K, Shiki Y, Takeuchi M, Chang Z, Aota S, Inokuchi H, Ozeki H (1986) Nature 322:572-574 Palmer JD (1985) Annu Rev Genet 19:325-354 Palmer JD (1990) Trends Genet 6:115-120 Percival WC (1931) Am J Bot 18:817-837 Richardson CC (1981) Bacteriophage T4 polynucleotide kinase. In: Boyer PD (ed) The enzymes, vol. 14A. Academic Press, New York, pp 299-314 Rochaix JD, Malnoe PM (1978) Cell 15:661-670 Saiki R, Scharf S, Faloona F, Mullis K, Horn G, Erlich H, Anaheim N (1985) Science 230:1350-1354 Saiki R, Gelfand D, Stoffel S, Scharf S, Higuchi R, Horn G, Mullis K, Erlich H (1988) Science 239:487-491 Sugiura M (1989) Annu Rev Cell Biol 5:51-70

Takaiwa F, Sugiura M (1982) Nucleic Acids Res 10:2665-2676 Taylor GW, Wolfe KH, Morden CW, dePamphilis C, Palmer JD (1991) Curr Genet 20:515-518 Williamson SE, Doolittle WF (1983) Nucleic Acids Res 11:225-235 Wimpee CF, Wrobel RL, Garvin DK (1991) Plant Mol Biol 17: 161-166 Wimpee CF, Morgan R, Wrobel RL (1992) Plant Mol Biol 18: 275285 Wolfe KE, Morden CW, Palmer JD (1992) J Mol Biol 223: 95-104 Yamada T, Shimaji M (1986) Nucleic Acids Res 14:3827-3839 Yamada T, Shim@ M (1987) Mol Gen Genet 208:377-383 Young RA, Macklis R, Steitz JA (1979) J Biol Chem 254: 32643271 C o m m u n i c a t e d b y C.W. Birky, Jr.