Pathologie Biologie 63 (2015) 11–16
Available online at
ScienceDirect www.sciencedirect.com
Original article
LPS induces pro-inflammatory response in mastitis mice and mammary epithelial cells: Possible involvement of NF-kB signaling and OPN Chez les souris, le LPS induit une re´ponse pro-inflammatoire dans le cas de mammites et de cellules e´pithe´liales mammaires : possible implication de la signalisation NF-kB et OPN H.-B. Xiao a,*, C.-R. Wang a, Z.-K. Liu a, J.-Y. Wang b a b
College of veterinary medicine, Hunan agricultural university, Changsha 410128, Furong district, China Huai Hua vocational and technical college, department of animal science and technology, Huaihua 418000, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 18 June 2014 Accepted 13 October 2014 Available online 4 November 2014
Background. – Lipopolysaccharide (LPS) has pro-inflammatory properties. This study was conducted to determine whether the LPS induced pro-inflammatory response in a model of mastitis and in mouse mammary epithelial cells (MEC). Methods. – To investigate the effects of LPS in vivo, 50 mL of a solution of LPS (20 ng/mL) were infused into the mammary glands of mice. To study the effects of LPS in vitro, MEC were exposed to LPS (20 mg/ mL) for 24 h. Activation of nuclear factor kB (NF-kB) and myeloperoxidase (MPO) were studied. Production of pro-inflammatory cytokines (interleukin-6 [IL-6], tumor necrosis factor-alpha [TNFalpha], interleukin-1 beta [IL-1beta]) and expression of osteopontin (OPN) were also evaluated. Results. – After LPS administration, route of NF-kB signaling is activated and the activity of MPO is increased. Furthermore, LPS increases the expression of OPN and production of TNF-alpha, IL-6 and IL1beta. Conclusions. – Present results demonstrate that LPS induces a pro-inflammatory response in a murine model of mastitis and suggest the involvement of the NF-kB pathway and OPN. ß 2014 Elsevier Masson SAS. All rights reserved.
Keywords: Osteopontin Nuclear factor kappa B Mastitis mice Mammary epithelial cells
R E´ S U M E´
Mots cle´s : Oste´opontine NF-kB Mammite Cellules e´pithe´liales mammaires
Contexte. – Le lipopolysaccharide (LPS) a des proprie´te´s pro-inflammatoires. Cette e´tude a e´te´ mene´e afin de de´terminer si le LPS induit une re´ponse pro-inflammatoire in vivo dans un mode`le de mammite chez la souris et in vitro dans des cellules e´pithe´liales mammaires. Me´thodes. – Pour e´tudier les effets du LPS in vivo, 50 mL de solution de LPS (20 ng/mL) ont e´te´ infuse´s dans les glandes mammaires de souris. Pour e´tudier les effets du LPS in vitro, les cellules e´pithe´liales mammaires en culture primaire (MEC) ont e´te´ expose´es a` du LPS (20 mg/mL) pendant 24 h. L’activation du facteur nucle´aire kB (NF-kB) et la mye´loperoxydase (MPO) ont e´te´ e´tudie´es. Les niveaux de production des cytokines pro-inflammatoires, oste´opontine (OPN), interleukine-6 (IL-6), tumor necrosis factor-alpha (TNF-alpha) et interleukine-1beˆta (IL-1 beˆta) ont e´galement e´te´ e´value´s. Re´sultats. – Apre`s administration de LPS, la voie de signalisation NF-kB est active´e et l’activite´ de la mye´loperoxydase (MPO) augmente´e. De plus, le LPS augmente l’expression de l’OPN et la production de TNF-alpha, d’IL-6, et d’IL-1beˆta.
* Corresponding author. E-mail address: [email protected] (H.-B. Xiao). http://dx.doi.org/10.1016/j.patbio.2014.10.005 0369-8114/ß 2014 Elsevier Masson SAS. All rights reserved.
12
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
Conclusions. – Les re´sultats pre´sents de´montrent que le LPS induit une re´ponse pro-inflammatoire dans un mode`le de mammite murin et sugge`rent l’implication de la voie NF-kB et de l’OPN. ß 2014 Elsevier Masson SAS. Tous droits re´serve´s.
1. Background Mastitis is an infection of the mammary gland. It results in breast swelling, pain, warmth and redness. Mastitis occurs in lactating women, dairy cattle, sheep, goat, sow, queen, and mare. Since milk from the affected udders of dairy cattle, sheep, goat, and other milk producing females may enter the food supply; a health risk may be posed on public health [1–4]. Due to decreased milk yield and quality, impaired milk quality and elevated costs for herd management labor and veterinary care, it causes $ 2 billion of annual losses in America. Even if unrelated to public health, it is also of economic importance in the sow, queen, and mare [5]. Previous study reports the link between DNA polymorphisms of osteopontin (OPN) and the susceptibility to mastitis in dairy cows [6]; however, the mechanism responsible for OPN involving in mastitis is not yet fully defined. OPN, also known as cytokine Eta-1, bone sialoprotein 1, or secreted phosphoprotein 1, as a sibling glycoprotein, OPN regulates and propagates inflammatory responses in different cells. As a pleiotropic T-helper 1 cytokine, OPN contributes to cell adhesion, chemotaxis, apoptosis, migration, invasion, and anchorage-independent growth of tumor cells. Studies in vitro, animal testing and clinical trials show that OPN plays an important role in acute and chronic inflammatory diseases [7,8]. Some data suggests that mastitis is an inflammation disease [9]. Previous study demonstrates that nuclear factor-kappaB (NF-kB) regulates OPN transcription in endotoxin-stimulated murine macrophages [10]. OPN expression correlates with NF-kB activation in clear cell renal cell carcinoma [11]. Therefore, we hypothesized that NF-kB–OPN pathway may be involved in mastitis. As the prototypical endotoxin, lipopolysaccharide (LPS) promotes the secretion of pro-inflammatory cytokines in many cell types. Previous investigation has reported that LPS administration can create mouse mastitis model [9]. Mammary epithelial cells (MEC) are highly relevant sentinel and effectors’ cells of udder immunity. These cells line the alveoli of the milk parenchyma. In response to a pathogenic stimulus, they may secrete large amounts of cytokines and chemokines for leukocyte recruitment and activation [12]. OPN is an oxidant stress sensitive cytokine [13]. In the present study, therefore, we tested whether there is a correlation between NF-kB signaling pathway and overexpression of pro-inflammatory cytokines in response to LPS in a mastitis mouse and mammary epithelial cells (MEC). 2. Methods 2.1. Reagents
was sanitized with 70% ethyl alcohol. In order to precisely inject the solution into the lactophore, the distal ends of the teats (1 to 2 mm) were aseptically removed with fine scissors. An amount of 50 mL of LPS solution (20 ng/mL) was infused into two abdominal mammary glands (R4 and L4) in the mastitis murine under anesthesia with pentobarbital (80 mg/kg IP). In the control group, saline (50 mL) was given through a 34-gauge needle according to methods described previously [9]. At 12 h after LPS infusion, the mice were killed by CO2 inhalation and mammary tissues were dissected and isolated for analysis of inflammatory cytokines concentrations, myeloperoxidase (MPO) activity, NF-kB DNA-binding activity and OPN expression. 2.3. MEC culture Primary cultured mouse MEC were cultured in RPMI 1640 medium containing 10% fetal bovine serum, 10 ng/mL epidermal growth factor, 5 mg/mL insulin, 4 mmol/L glutamine, and 50 mg/mL gentamicin. MEC were randomly divided into 2 groups: control group; LPS group. For LPS, MEC were exposed to LPS (20 mg/mL) for 24 h [14]. 2.4. Expressions of OPN mRNA Real-time PCR was performed to quantify OPN mRNA expressions. Briefly, total RNA was isolated from mammary tissue or mammary epithelial cell using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and reverse-transcribed. The following primer pairs were used (all shown 50 –30 ): GAPDH (forward), ACTCCACTCACGGCAAATTC (reverse), TCTCCATGGTGGTGAAGACA; OPN (forward), GATGATGATGACGATGGAGACC (reverse), CGACTGTAGGGACGATTGGAG [15]; PCR was carried out under the following conditions: 50 8C for 2 min, 95 8C for 10 min, and 40 cycles of 95 8C for 15 s, and 60 8C for 1 min. 2.5. Expressions of OPN protein Samples were taken from mammary tissue and homogenized in the lysis buffer using an electric homogenizer. Homogenates were centrifuged at 10 000 g for 10 min at 4 8C, and the supernatant was isolated. Mammary epithelial cells were lysed in SDS sample buffer. The proteins were separated by 12.5% SDS-PAGE and electrophoretically transferred to PVDF membranes. The western blot analyses of OPN protein expressions were performed as described previously methods [16]. 2.6. Measurement of NF-kB DNA-binding activity The NF-kB DNA-binding activity was measured by electrophoretic mobility shift assays (EMSA) using a previously described method [17]. A double-stranded oligonucleotide including 50 -AGTTGAGGGGACTTTCCCAGGC-30 (NF-kB DNA–binding consensus sequence); 50 -AGTTGAGGCGACTTTCCCAGGC-30 (mutant doublestranded oligonucleotide) were used to study NF-kB DNA–binding activity. 2.7. Analysis of concentrations of inflammatory cytokines For inflammatory cytokines assays, mammary gland tissue was homogenized on ice in 1 mL of sterile 0.025% Triton X-100/PBS. The levels of interleukin-1 beta (IL1beta), interleukin-6 (IL-6) and tumour necrosis factor-alpha (TNF-alpha) in the homogenates of mammary glands or in the medium of MEC were quantified by using R&D Systems Quantikine Elisa Kits according to the manufacturer’s instructions [18].
LPS from Escherichia coli 055:B5 was obtained from Sigma Chemical Corporation (USA). Antibody was purchased from Santa Cruz Biotechnology (USA). Other reagents were bought from Sinopharm Chemical Reagent (Shanghai, China).
2.8. Evaluation of MPO Activity
2.2. Experimental protocol
MPO activity reflects the parenchymal infiltration of neutrophils and macrophages. Activities of MPO in the homogenates of mammary tissue and MEC were evaluated according to the manufacturer’s recommendations using a previously described method [19].
C57BL/6 J mice aged seven weeks were obtained from department of laboratory animal science, Hunan agricultural university. Eight-week-old female was mated. All animals were supplied with normal mouse chow and water ad libitum and were kept under the same conditions. Forty mice were divided randomly into two groups (n = 20): C57BL/6 J control, mastitis murine. LPS solution (20 mg/mL) and saline were made in a trypan blue solution (prepared in 0.81% sodium chloride and 0.06% potassium phosphate; T-8154). On days 7 to 11 of lactation, the abdominal surface
2.9. Histopathological examination For histopathological examination, mammary gland was fixed with 10% formalin, dehydrated in graded alcohol and embedded in paraffin and then stained by hematoxylin and eosin (H&E).
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
13
2.10. Statistical analysis
3.3. Concentrations of inflammatory cytokines
All values are given as means SD. Differences between groups were assessed using Anova and Student’s t-test for unpaired data. P < 0.05 was considered significant.
Mastitis mice showed an elevated levels of TNF-alpha, IL-1beta, and IL-6 in the homogenates of mice mammary tissues compared with control mice (P < .05 and P < .01; Table 1); LPS (10 mg/mL) treatment caused in an increase in TNF-alpha, IL-1beta, and IL-6 concentrations in the conditioned medium of MEC (P < .05 and P < .01; Table 2).
3. Results 3.1. Expressions of OPN in mammary tissue and MEC LPS-injected mice showed an increase in the mRNA and protein expressions of OPN in mammary gland compared with that of control group (P < .05 or P < .01) (Fig. 1). In MEC, OPN expression was significantly activated by LPS treatment (P < 0.05 or P < 0.01; Fig. 2). 3.2. Activity of NF-kB LPS-treated mastitis mice showed an increase in the activity of NF-kB in the mammary tissue; LPS (10 mg/mL) treatment for 24 h significantly increased the activity of NF-kB in MEC (Fig. 3).
Fig. 1. OPN expression in mammary gland of mice after treatment with LPS (A) OPN mRNA expression; (B) OPN protein expression. + LPS: 50 mL LPS solution (20 ng/ mL). The data were expressed as mean SD, n = 10. Compared with control, ** P < 0.01. OPN: osteopontin; LPS: lipopolysaccharide.
3.4. Activity of MPO MPO generation was higher in the LPS-injected mice than in control mice. An amount of 20 mg/mL LPS treatment promoted the elevation of MPO activity in MEC (P < .01; Fig. 4). 3.5. Histopathological changes of mammary gland tissues Histopathological changes were not observed in the mammary gland controls (Fig. 5a). There was obviously pathological change in the LPS group (Fig. 5b).
Fig. 2. OPN expression in MEC after treatment with LPS (A) OPN mRNA expression; (B) OPN protein expression. + LPS: LPS 20 mg/mL. The data were expressed as mean SD, n = 3–4. Compared with control, **P < 0.01. OPN: osteopontin; LPS: lipopolysaccharide; MEC: mouse mammary epithelial cells.
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
14
Fig. 3. NF-kB activity after treatment with LPS (A) NF-kB activity in mammary gland of mice. The data were expressed as mean SD, n = 10. B. NF-kB activity in MEC of mice. Data are means SD, n = 3–4. Compared with control, **P < 0.01. LPS: lipopolysaccharide; NF-kB: nuclear factor kB; MEC: mouse mammary epithelial cells.
Table 1 Effect of LPS on pro-inflammatory cytokines concentrations in the homogenates of mice mammary tissues.
TNFa (pg/mL) IL-1b (pg/mL) IL-6 (pg/mL)
Control
LPS
711.8 22.32 332.9 16.55 92.93 8.55
2141.86 41.22** 1132.8 26.17** 386.6 10.26**
Values are mean SD, n = 10; LPS: lipopolysaccharide; TNFa: tumor necrosis factor alpha; IL-1b: interleukin-1b; IL-6: interleukin-6. ** P < 0.01, compared with control.
Table 2 Effect of LPS on pro-inflammatory cytokines levels in the conditioned medium of MEC.
TNFa (ng/mL) IL-1b (pg/mL) IL-6 (pg/mL)
Control
LPS
0.71 0.09 51.86 2.91 3.03 0.48
1.12 0.26** 76.59 6.67** 85.51 9.26**
Values are mean SD, n = 3–4; LPS: lipopolysaccharide; TNFa: tumor necrosis factor alpha; IL-1b: interleukin-1b; IL-6: interleukin-6; MEC: mouse mammary epithelial cells. ** P < 0.01, compared with control.
4. Discussion In terms of pro-inflammatory properties, LPS is one of the most powerful bacterial virulence factors. LPS from lots of bacterial species induces acute inflammatory responses in mammals which are typical of the host reaction to tissue infection or injury [20]. By administering small doses of intravenous LPS to human volunteers, a wide kind of inflammatory mediators are released which appear to contribute to these responses. These include the release of proinflammatory cytokines (e.g. TNF-alpha, IL-1beta, IL-6, and IL-8), activation of the fibrinolytic system, kallikrein-kinin generation
Fig. 4. MPO activity after infusion with LPS. A. MPO activity in mammary gland of mice. The data were expressed as mean SD, n = 10. B. NF-kB activity in MEC of mice. Data are means SD, n = 3–4. Compared with control, **P < 0.01. LPS: lipopolysaccharide; MPO: myeloperoxidase; MEC: mammary epithelial cells.
and phospholipase A2 release. Phagocytic leukocyte is primed for increased inflammatory responses following LPS treatment. Counter-regulatory response is initiated in parallel and may serve to limit some of the end-organ responses by mediator of inflammation [21]. When bacteria from the baby’s mouth enter a milk duct through a crack in the nipple, mastitis occurs during breastfeeding. Streptococcal bacteria result in a superficial small area of inflammation [22]. Staphylococcal bacteria lead to a deeper walled-off infection or abscess [22]. The area of mastitis may be red, painful and abnormally warm along with the following symptoms: breast engorgement, tenderness and swelling, body aches, fever and chills, fatigue. In the dairy industry, mastitis is an often and costly disease. Moreover, mastitis weakens animal welfare, and food-borne diseases may influence human health [12]. It is well known that mastitis is the inflammation of breast tissue. Here we reported that LPS stimulated the NF-kB pathway, the activity of MPO and the expression and/or production of OPN, IL-6, TNF-alpha and IL-1beta in vivo using mastitis mice and in vitro using primary mammary epithelial cells. There is increasing evidence to suggest that OPN may be a key factor contributing to inflammation. In vivo, plasma levels of OPN are elevated in ApoE/ mice [7]. 2,4,6-Trinitrobenzenesulfonic acid-treated wild type mice develop
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
15
Fig. 5. Histopathology of mammary tissue after treatment with LPS (100). A. Mammary tissue of control group. B. Mammary tissue of LPS group.
severe colitis but OPN-deficient mice inhibit inflammatory cells infiltration and an increase in matrix collagen deposits, and granuloma formation [23]. Knockdown of OPN reduces the inflammatory response in a murine model [24]. Clinically, OPN level is associated with inflammation in patients with ulcerative colitis [25], atherosclerosis [8], Crohn’s disease [26], aortic abdominal aneurysms [27]. Overall, we propose that OPN contributes to increased mastitis and represents a novel target to antagonize these pathologies. The present result also showed that the expression of OPN were up-regulated concomitantly with an increase in NF-kB activity in vivo and in vitro. In the bovine mammary gland epithelial cells, Staphylococcus aureus also induces IL-1beta expression through the activation of NF-kB transcription factors [28]. It is not surprising that NF-kB is active in many inflammatory diseases because NF-kB controls many genes involved in inflammation. Therefore, we observed a correlation between NF-kB signaling pathway and over-expression of pro-inflammatory cytokines in response to LPS. However the role of NF-kB and OPN in the over-expression of the pro-inflammatory cytokines IL-6, TNF-alpha and IL-1beta is only a hypothesis. Further work is needed before a definitive conclusion on this matter can be drawn. In conclusion, our present study demonstrates that LPS induces a pro-inflammatory response in a murine model of mastitis and suggests the involvement of the NF-kB pathway and OPN.
Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgment Project supported by Hunan Provincial Natural Science Foundation of China (14JJ2079). References [1] Barbosa-Cesnik C, Schwartz K, Foxman B. Lactation mastitis. JAMA 2003;289:1609–12. [2] Barlow J. Mastitis therapy and antimicrobial susceptibility: a multispecies review with a focus on antibiotic treatment of mastitis in dairy cattle. J Mammary Gland Biol Neoplasia 2011;16:383–407. [3] Chu C, Yu C, Lee Y, Su Y. Genetically divergent methicillin-resistant Staphylococcus aureus and sec-dependent mastitis of dairy goats in Taiwan. BMC Vet Res 2012;8:39. [4] Sanciu G, Marogna G, Paglietti B, Cappuccinelli P, Leori G, Rappelli P. Outbreak of mastitis in sheep caused by multi-drug resistant Enterococcus faecalis in Sardinia, Italy. Epidemiol Infect 2013;141:582–4.
[5] Sordillo LM, Streicher KL. Mammary gland immunity and mastitis susceptibility. J Mammary Gland Biol Neoplasia 2002;7:135–46. [6] Alain K, Karrow NA, Thibault C, St-Pierre J, Lessard M, Bissonnette N. Osteopontin: an early innate immune marker of Escherichia coli mastitis harbors genetic polymorphisms with possible links with resistance to mastitis. BMC Genomics 2009;10:444. [7] Xiao HB, Lu XY, Sun ZL, Zhang HB. Kaempferol regulates OPN-CD44 pathway to inhibit the atherogenesis of apolipoprotein E deficient mice. Toxicol Appl Pharmacol 2011;257:405–11. [8] Zagura M, Kals J, Serg M, Kampus P, Zilmer M, Jakobson M, et al. Structural and biochemical characteristics of arterial stiffness in patients with atherosclerosis and in healthy subjects. Hypertens Res 2012;35:1032–7. [9] Zheng J, Watson AD, Kerr DE. Genome-wide expression analysis of lipopolysaccharide-induced mastitis in a mouse model. Infect Immun 2006;74: 1907–1915. [10] Zhao W, Wang L, Zhang M, Wang P, Zhang L, Yuan C, et al. NF-kB- and AP-1mediated DNA looping regulates osteopontin transcription in endotoxinstimulated murine macrophages. J Immunol 2011;186:3173–9. [11] Matusˇan-Ilijasˇ K, Damante G, Fabbro D, Dorpevic´ G, Hadzˇisejdic´ I, Grahovac M, et al. Osteopontin expression correlates with nuclear factor-kB activation and apoptosis downregulation in clear cell renal cell carcinoma. Pathol Res Pract 2011;207:104–10. [12] Gu¨nther J, Esch K, Poschadel N, Petzl W, Zerbe H, Mitterhuemer S, et al. Comparative kinetics of Escherichia coli and Staphylococcus aureus-specific activation of key immune pathways in mammary epithelial cells demonstrates that S. aureus elicits a delayed response dominated by interleukin-6 (IL-6) but not by IL-1A or tumor necrosis factor alpha. Infect Immun 2011;79:695–707. [13] Urtasun R, Lopategi A, George J, Leung TM, Lu Y, Wang X, et al. Osteopontin, an oxidant stress sensitive cytokine, up-regulates collagen-I via integrin a(V)b(3) engagement and PI3 K/pAkt/NFkB signaling. Hepatology 2012;55: 594–608. [14] Miao J, Zheng L, Zhang J, Ma Z, Zhu W, Zou S. The effect of taurine on the tolllike receptors/nuclear factor kappa B (TLRs/NF-kB) signaling pathway in Streptococcus uberis-induced mastitis in rats. Int Immunopharmacol 2011;11:1740–6. [15] Vetrone SA, Montecino-Rodriguez E, Kudryashova E, Kramerova I, Hoffman EP, Liu SD, et al. Osteopontin promotes fibrosis in dystrophic mouse muscle by modulating immune cell subsets and intramuscular TGF-beta. J Clin Invest 2009;119:1583–94. [16] Sahai A, Malladi P, Melin-Aldana H, Green RM, Whitington PF. Upregulation of osteopontin expression is involved in the development of nonalcoholic steatohepatitis in a dietary murine model. Am J Physiol Gastrointest Liver Physiol 2004;287:G264–73. [17] Wu T, Chen Y, Chiang SK, Tso MO. NF-kappaB activation in light-induced retinal degeneration in a mouse model. Invest Ophthalmol Vis Sci 2002;43: 2834–2840. [18] Elazar S, Gonen E, Livneh-Kol A, Rosenshine I, Shpigel NY. Neutrophil recruitment in endotoxin-induced murine mastitis is strictly dependent on mammary alveolar macrophages. Vet Res 2010;41:10. [19] Li D, Fu Y, Zhang W, Su G, Liu B, Guo M, et al. Salidroside attenuates inflammatory responses by suppressing nuclear factor-kB and mitogen activated protein kinases activation in lipopolysaccharide-induced mastitis in mice. Inflamm Res 2013;62:9–15. [20] Blais DR, Vascotto SG, Griffith M, Altosaar I. LBP and CD14 secreted in tears by the lacrimal glands modulate the LPS response of corneal epithelial cells. Invest Ophthalmol Vis Sci 2005;46:4235–44. [21] Martich GD, Boujoukos AJ, Suffredini AF. Response of man to endotoxin. Immunobiology 1993;187:403–16. [22] Nagahata H, Kawai H, Higuchi H, Kawai K, Yayou K, Chang CJ. Altered leukocyte responsiveness in dairy cows with naturally occurring chronic Staphylococcus aureus mastitis. J Vet Med Sci 2011;73:885–94.
16
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
[23] Oz HS, Zhong J, de Villiers WJ. Osteopontin ablation attenuates progression of colitis in TNBS model. Dig Dis Sci 2012;57:1554–61. [24] Andrews S, Ford D, Martin P. Knockdown of osteopontin reduces the inflammatory response and subsequent size of postsurgical adhesions in a murine model. Am J Pathol 2012;181:1165–72. [25] Mishima R, Takeshima F, Sawai T, Ohba K, Ohnita K, Isomoto H, et al. High plasma osteopontin levels in patients with inflammatory bowel disease. J Clin Gastroenterol 2007;41:167–72.
[26] Agnholt J, Kelsen J, Schack L, Hvas CL, Dahlerup JF, Sørensen ES. Osteopontin, a protein with cytokine-like properties, is associated with inflammation in Crohn’s disease. Scand J Immunol 2007;65:453–60. [27] Kadoglou NP, Papadakis I, Moulakakis KG, Ikonomidis I, Alepaki M, Moustardas P, et al. Arterial stiffness and novel biomarkers in patients with abdominal aortic aneurysms. Regul Pept 2012;179:50–4. [28] Kim KW, Im J, Jeon JH, Lee HG, Yun CH, Han SH. Staphylococcus aureus induces IL-1b expression through the activation of MAP kinases and AP-1, CRE and NFkB transcription factors in the bovine mammary gland epithelial cells. Comp Immunol Microbiol Infect Dis 2011;34:347–54.
Available online at
ScienceDirect www.sciencedirect.com
Original article
LPS induces pro-inflammatory response in mastitis mice and mammary epithelial cells: Possible involvement of NF-kB signaling and OPN Chez les souris, le LPS induit une re´ponse pro-inflammatoire dans le cas de mammites et de cellules e´pithe´liales mammaires : possible implication de la signalisation NF-kB et OPN H.-B. Xiao a,*, C.-R. Wang a, Z.-K. Liu a, J.-Y. Wang b a b
College of veterinary medicine, Hunan agricultural university, Changsha 410128, Furong district, China Huai Hua vocational and technical college, department of animal science and technology, Huaihua 418000, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 18 June 2014 Accepted 13 October 2014 Available online 4 November 2014
Background. – Lipopolysaccharide (LPS) has pro-inflammatory properties. This study was conducted to determine whether the LPS induced pro-inflammatory response in a model of mastitis and in mouse mammary epithelial cells (MEC). Methods. – To investigate the effects of LPS in vivo, 50 mL of a solution of LPS (20 ng/mL) were infused into the mammary glands of mice. To study the effects of LPS in vitro, MEC were exposed to LPS (20 mg/ mL) for 24 h. Activation of nuclear factor kB (NF-kB) and myeloperoxidase (MPO) were studied. Production of pro-inflammatory cytokines (interleukin-6 [IL-6], tumor necrosis factor-alpha [TNFalpha], interleukin-1 beta [IL-1beta]) and expression of osteopontin (OPN) were also evaluated. Results. – After LPS administration, route of NF-kB signaling is activated and the activity of MPO is increased. Furthermore, LPS increases the expression of OPN and production of TNF-alpha, IL-6 and IL1beta. Conclusions. – Present results demonstrate that LPS induces a pro-inflammatory response in a murine model of mastitis and suggest the involvement of the NF-kB pathway and OPN. ß 2014 Elsevier Masson SAS. All rights reserved.
Keywords: Osteopontin Nuclear factor kappa B Mastitis mice Mammary epithelial cells
R E´ S U M E´
Mots cle´s : Oste´opontine NF-kB Mammite Cellules e´pithe´liales mammaires
Contexte. – Le lipopolysaccharide (LPS) a des proprie´te´s pro-inflammatoires. Cette e´tude a e´te´ mene´e afin de de´terminer si le LPS induit une re´ponse pro-inflammatoire in vivo dans un mode`le de mammite chez la souris et in vitro dans des cellules e´pithe´liales mammaires. Me´thodes. – Pour e´tudier les effets du LPS in vivo, 50 mL de solution de LPS (20 ng/mL) ont e´te´ infuse´s dans les glandes mammaires de souris. Pour e´tudier les effets du LPS in vitro, les cellules e´pithe´liales mammaires en culture primaire (MEC) ont e´te´ expose´es a` du LPS (20 mg/mL) pendant 24 h. L’activation du facteur nucle´aire kB (NF-kB) et la mye´loperoxydase (MPO) ont e´te´ e´tudie´es. Les niveaux de production des cytokines pro-inflammatoires, oste´opontine (OPN), interleukine-6 (IL-6), tumor necrosis factor-alpha (TNF-alpha) et interleukine-1beˆta (IL-1 beˆta) ont e´galement e´te´ e´value´s. Re´sultats. – Apre`s administration de LPS, la voie de signalisation NF-kB est active´e et l’activite´ de la mye´loperoxydase (MPO) augmente´e. De plus, le LPS augmente l’expression de l’OPN et la production de TNF-alpha, d’IL-6, et d’IL-1beˆta.
* Corresponding author. E-mail address: [email protected] (H.-B. Xiao). http://dx.doi.org/10.1016/j.patbio.2014.10.005 0369-8114/ß 2014 Elsevier Masson SAS. All rights reserved.
12
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
Conclusions. – Les re´sultats pre´sents de´montrent que le LPS induit une re´ponse pro-inflammatoire dans un mode`le de mammite murin et sugge`rent l’implication de la voie NF-kB et de l’OPN. ß 2014 Elsevier Masson SAS. Tous droits re´serve´s.
1. Background Mastitis is an infection of the mammary gland. It results in breast swelling, pain, warmth and redness. Mastitis occurs in lactating women, dairy cattle, sheep, goat, sow, queen, and mare. Since milk from the affected udders of dairy cattle, sheep, goat, and other milk producing females may enter the food supply; a health risk may be posed on public health [1–4]. Due to decreased milk yield and quality, impaired milk quality and elevated costs for herd management labor and veterinary care, it causes $ 2 billion of annual losses in America. Even if unrelated to public health, it is also of economic importance in the sow, queen, and mare [5]. Previous study reports the link between DNA polymorphisms of osteopontin (OPN) and the susceptibility to mastitis in dairy cows [6]; however, the mechanism responsible for OPN involving in mastitis is not yet fully defined. OPN, also known as cytokine Eta-1, bone sialoprotein 1, or secreted phosphoprotein 1, as a sibling glycoprotein, OPN regulates and propagates inflammatory responses in different cells. As a pleiotropic T-helper 1 cytokine, OPN contributes to cell adhesion, chemotaxis, apoptosis, migration, invasion, and anchorage-independent growth of tumor cells. Studies in vitro, animal testing and clinical trials show that OPN plays an important role in acute and chronic inflammatory diseases [7,8]. Some data suggests that mastitis is an inflammation disease [9]. Previous study demonstrates that nuclear factor-kappaB (NF-kB) regulates OPN transcription in endotoxin-stimulated murine macrophages [10]. OPN expression correlates with NF-kB activation in clear cell renal cell carcinoma [11]. Therefore, we hypothesized that NF-kB–OPN pathway may be involved in mastitis. As the prototypical endotoxin, lipopolysaccharide (LPS) promotes the secretion of pro-inflammatory cytokines in many cell types. Previous investigation has reported that LPS administration can create mouse mastitis model [9]. Mammary epithelial cells (MEC) are highly relevant sentinel and effectors’ cells of udder immunity. These cells line the alveoli of the milk parenchyma. In response to a pathogenic stimulus, they may secrete large amounts of cytokines and chemokines for leukocyte recruitment and activation [12]. OPN is an oxidant stress sensitive cytokine [13]. In the present study, therefore, we tested whether there is a correlation between NF-kB signaling pathway and overexpression of pro-inflammatory cytokines in response to LPS in a mastitis mouse and mammary epithelial cells (MEC). 2. Methods 2.1. Reagents
was sanitized with 70% ethyl alcohol. In order to precisely inject the solution into the lactophore, the distal ends of the teats (1 to 2 mm) were aseptically removed with fine scissors. An amount of 50 mL of LPS solution (20 ng/mL) was infused into two abdominal mammary glands (R4 and L4) in the mastitis murine under anesthesia with pentobarbital (80 mg/kg IP). In the control group, saline (50 mL) was given through a 34-gauge needle according to methods described previously [9]. At 12 h after LPS infusion, the mice were killed by CO2 inhalation and mammary tissues were dissected and isolated for analysis of inflammatory cytokines concentrations, myeloperoxidase (MPO) activity, NF-kB DNA-binding activity and OPN expression. 2.3. MEC culture Primary cultured mouse MEC were cultured in RPMI 1640 medium containing 10% fetal bovine serum, 10 ng/mL epidermal growth factor, 5 mg/mL insulin, 4 mmol/L glutamine, and 50 mg/mL gentamicin. MEC were randomly divided into 2 groups: control group; LPS group. For LPS, MEC were exposed to LPS (20 mg/mL) for 24 h [14]. 2.4. Expressions of OPN mRNA Real-time PCR was performed to quantify OPN mRNA expressions. Briefly, total RNA was isolated from mammary tissue or mammary epithelial cell using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and reverse-transcribed. The following primer pairs were used (all shown 50 –30 ): GAPDH (forward), ACTCCACTCACGGCAAATTC (reverse), TCTCCATGGTGGTGAAGACA; OPN (forward), GATGATGATGACGATGGAGACC (reverse), CGACTGTAGGGACGATTGGAG [15]; PCR was carried out under the following conditions: 50 8C for 2 min, 95 8C for 10 min, and 40 cycles of 95 8C for 15 s, and 60 8C for 1 min. 2.5. Expressions of OPN protein Samples were taken from mammary tissue and homogenized in the lysis buffer using an electric homogenizer. Homogenates were centrifuged at 10 000 g for 10 min at 4 8C, and the supernatant was isolated. Mammary epithelial cells were lysed in SDS sample buffer. The proteins were separated by 12.5% SDS-PAGE and electrophoretically transferred to PVDF membranes. The western blot analyses of OPN protein expressions were performed as described previously methods [16]. 2.6. Measurement of NF-kB DNA-binding activity The NF-kB DNA-binding activity was measured by electrophoretic mobility shift assays (EMSA) using a previously described method [17]. A double-stranded oligonucleotide including 50 -AGTTGAGGGGACTTTCCCAGGC-30 (NF-kB DNA–binding consensus sequence); 50 -AGTTGAGGCGACTTTCCCAGGC-30 (mutant doublestranded oligonucleotide) were used to study NF-kB DNA–binding activity. 2.7. Analysis of concentrations of inflammatory cytokines For inflammatory cytokines assays, mammary gland tissue was homogenized on ice in 1 mL of sterile 0.025% Triton X-100/PBS. The levels of interleukin-1 beta (IL1beta), interleukin-6 (IL-6) and tumour necrosis factor-alpha (TNF-alpha) in the homogenates of mammary glands or in the medium of MEC were quantified by using R&D Systems Quantikine Elisa Kits according to the manufacturer’s instructions [18].
LPS from Escherichia coli 055:B5 was obtained from Sigma Chemical Corporation (USA). Antibody was purchased from Santa Cruz Biotechnology (USA). Other reagents were bought from Sinopharm Chemical Reagent (Shanghai, China).
2.8. Evaluation of MPO Activity
2.2. Experimental protocol
MPO activity reflects the parenchymal infiltration of neutrophils and macrophages. Activities of MPO in the homogenates of mammary tissue and MEC were evaluated according to the manufacturer’s recommendations using a previously described method [19].
C57BL/6 J mice aged seven weeks were obtained from department of laboratory animal science, Hunan agricultural university. Eight-week-old female was mated. All animals were supplied with normal mouse chow and water ad libitum and were kept under the same conditions. Forty mice were divided randomly into two groups (n = 20): C57BL/6 J control, mastitis murine. LPS solution (20 mg/mL) and saline were made in a trypan blue solution (prepared in 0.81% sodium chloride and 0.06% potassium phosphate; T-8154). On days 7 to 11 of lactation, the abdominal surface
2.9. Histopathological examination For histopathological examination, mammary gland was fixed with 10% formalin, dehydrated in graded alcohol and embedded in paraffin and then stained by hematoxylin and eosin (H&E).
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
13
2.10. Statistical analysis
3.3. Concentrations of inflammatory cytokines
All values are given as means SD. Differences between groups were assessed using Anova and Student’s t-test for unpaired data. P < 0.05 was considered significant.
Mastitis mice showed an elevated levels of TNF-alpha, IL-1beta, and IL-6 in the homogenates of mice mammary tissues compared with control mice (P < .05 and P < .01; Table 1); LPS (10 mg/mL) treatment caused in an increase in TNF-alpha, IL-1beta, and IL-6 concentrations in the conditioned medium of MEC (P < .05 and P < .01; Table 2).
3. Results 3.1. Expressions of OPN in mammary tissue and MEC LPS-injected mice showed an increase in the mRNA and protein expressions of OPN in mammary gland compared with that of control group (P < .05 or P < .01) (Fig. 1). In MEC, OPN expression was significantly activated by LPS treatment (P < 0.05 or P < 0.01; Fig. 2). 3.2. Activity of NF-kB LPS-treated mastitis mice showed an increase in the activity of NF-kB in the mammary tissue; LPS (10 mg/mL) treatment for 24 h significantly increased the activity of NF-kB in MEC (Fig. 3).
Fig. 1. OPN expression in mammary gland of mice after treatment with LPS (A) OPN mRNA expression; (B) OPN protein expression. + LPS: 50 mL LPS solution (20 ng/ mL). The data were expressed as mean SD, n = 10. Compared with control, ** P < 0.01. OPN: osteopontin; LPS: lipopolysaccharide.
3.4. Activity of MPO MPO generation was higher in the LPS-injected mice than in control mice. An amount of 20 mg/mL LPS treatment promoted the elevation of MPO activity in MEC (P < .01; Fig. 4). 3.5. Histopathological changes of mammary gland tissues Histopathological changes were not observed in the mammary gland controls (Fig. 5a). There was obviously pathological change in the LPS group (Fig. 5b).
Fig. 2. OPN expression in MEC after treatment with LPS (A) OPN mRNA expression; (B) OPN protein expression. + LPS: LPS 20 mg/mL. The data were expressed as mean SD, n = 3–4. Compared with control, **P < 0.01. OPN: osteopontin; LPS: lipopolysaccharide; MEC: mouse mammary epithelial cells.
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
14
Fig. 3. NF-kB activity after treatment with LPS (A) NF-kB activity in mammary gland of mice. The data were expressed as mean SD, n = 10. B. NF-kB activity in MEC of mice. Data are means SD, n = 3–4. Compared with control, **P < 0.01. LPS: lipopolysaccharide; NF-kB: nuclear factor kB; MEC: mouse mammary epithelial cells.
Table 1 Effect of LPS on pro-inflammatory cytokines concentrations in the homogenates of mice mammary tissues.
TNFa (pg/mL) IL-1b (pg/mL) IL-6 (pg/mL)
Control
LPS
711.8 22.32 332.9 16.55 92.93 8.55
2141.86 41.22** 1132.8 26.17** 386.6 10.26**
Values are mean SD, n = 10; LPS: lipopolysaccharide; TNFa: tumor necrosis factor alpha; IL-1b: interleukin-1b; IL-6: interleukin-6. ** P < 0.01, compared with control.
Table 2 Effect of LPS on pro-inflammatory cytokines levels in the conditioned medium of MEC.
TNFa (ng/mL) IL-1b (pg/mL) IL-6 (pg/mL)
Control
LPS
0.71 0.09 51.86 2.91 3.03 0.48
1.12 0.26** 76.59 6.67** 85.51 9.26**
Values are mean SD, n = 3–4; LPS: lipopolysaccharide; TNFa: tumor necrosis factor alpha; IL-1b: interleukin-1b; IL-6: interleukin-6; MEC: mouse mammary epithelial cells. ** P < 0.01, compared with control.
4. Discussion In terms of pro-inflammatory properties, LPS is one of the most powerful bacterial virulence factors. LPS from lots of bacterial species induces acute inflammatory responses in mammals which are typical of the host reaction to tissue infection or injury [20]. By administering small doses of intravenous LPS to human volunteers, a wide kind of inflammatory mediators are released which appear to contribute to these responses. These include the release of proinflammatory cytokines (e.g. TNF-alpha, IL-1beta, IL-6, and IL-8), activation of the fibrinolytic system, kallikrein-kinin generation
Fig. 4. MPO activity after infusion with LPS. A. MPO activity in mammary gland of mice. The data were expressed as mean SD, n = 10. B. NF-kB activity in MEC of mice. Data are means SD, n = 3–4. Compared with control, **P < 0.01. LPS: lipopolysaccharide; MPO: myeloperoxidase; MEC: mammary epithelial cells.
and phospholipase A2 release. Phagocytic leukocyte is primed for increased inflammatory responses following LPS treatment. Counter-regulatory response is initiated in parallel and may serve to limit some of the end-organ responses by mediator of inflammation [21]. When bacteria from the baby’s mouth enter a milk duct through a crack in the nipple, mastitis occurs during breastfeeding. Streptococcal bacteria result in a superficial small area of inflammation [22]. Staphylococcal bacteria lead to a deeper walled-off infection or abscess [22]. The area of mastitis may be red, painful and abnormally warm along with the following symptoms: breast engorgement, tenderness and swelling, body aches, fever and chills, fatigue. In the dairy industry, mastitis is an often and costly disease. Moreover, mastitis weakens animal welfare, and food-borne diseases may influence human health [12]. It is well known that mastitis is the inflammation of breast tissue. Here we reported that LPS stimulated the NF-kB pathway, the activity of MPO and the expression and/or production of OPN, IL-6, TNF-alpha and IL-1beta in vivo using mastitis mice and in vitro using primary mammary epithelial cells. There is increasing evidence to suggest that OPN may be a key factor contributing to inflammation. In vivo, plasma levels of OPN are elevated in ApoE/ mice [7]. 2,4,6-Trinitrobenzenesulfonic acid-treated wild type mice develop
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
15
Fig. 5. Histopathology of mammary tissue after treatment with LPS (100). A. Mammary tissue of control group. B. Mammary tissue of LPS group.
severe colitis but OPN-deficient mice inhibit inflammatory cells infiltration and an increase in matrix collagen deposits, and granuloma formation [23]. Knockdown of OPN reduces the inflammatory response in a murine model [24]. Clinically, OPN level is associated with inflammation in patients with ulcerative colitis [25], atherosclerosis [8], Crohn’s disease [26], aortic abdominal aneurysms [27]. Overall, we propose that OPN contributes to increased mastitis and represents a novel target to antagonize these pathologies. The present result also showed that the expression of OPN were up-regulated concomitantly with an increase in NF-kB activity in vivo and in vitro. In the bovine mammary gland epithelial cells, Staphylococcus aureus also induces IL-1beta expression through the activation of NF-kB transcription factors [28]. It is not surprising that NF-kB is active in many inflammatory diseases because NF-kB controls many genes involved in inflammation. Therefore, we observed a correlation between NF-kB signaling pathway and over-expression of pro-inflammatory cytokines in response to LPS. However the role of NF-kB and OPN in the over-expression of the pro-inflammatory cytokines IL-6, TNF-alpha and IL-1beta is only a hypothesis. Further work is needed before a definitive conclusion on this matter can be drawn. In conclusion, our present study demonstrates that LPS induces a pro-inflammatory response in a murine model of mastitis and suggests the involvement of the NF-kB pathway and OPN.
Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgment Project supported by Hunan Provincial Natural Science Foundation of China (14JJ2079). References [1] Barbosa-Cesnik C, Schwartz K, Foxman B. Lactation mastitis. JAMA 2003;289:1609–12. [2] Barlow J. Mastitis therapy and antimicrobial susceptibility: a multispecies review with a focus on antibiotic treatment of mastitis in dairy cattle. J Mammary Gland Biol Neoplasia 2011;16:383–407. [3] Chu C, Yu C, Lee Y, Su Y. Genetically divergent methicillin-resistant Staphylococcus aureus and sec-dependent mastitis of dairy goats in Taiwan. BMC Vet Res 2012;8:39. [4] Sanciu G, Marogna G, Paglietti B, Cappuccinelli P, Leori G, Rappelli P. Outbreak of mastitis in sheep caused by multi-drug resistant Enterococcus faecalis in Sardinia, Italy. Epidemiol Infect 2013;141:582–4.
[5] Sordillo LM, Streicher KL. Mammary gland immunity and mastitis susceptibility. J Mammary Gland Biol Neoplasia 2002;7:135–46. [6] Alain K, Karrow NA, Thibault C, St-Pierre J, Lessard M, Bissonnette N. Osteopontin: an early innate immune marker of Escherichia coli mastitis harbors genetic polymorphisms with possible links with resistance to mastitis. BMC Genomics 2009;10:444. [7] Xiao HB, Lu XY, Sun ZL, Zhang HB. Kaempferol regulates OPN-CD44 pathway to inhibit the atherogenesis of apolipoprotein E deficient mice. Toxicol Appl Pharmacol 2011;257:405–11. [8] Zagura M, Kals J, Serg M, Kampus P, Zilmer M, Jakobson M, et al. Structural and biochemical characteristics of arterial stiffness in patients with atherosclerosis and in healthy subjects. Hypertens Res 2012;35:1032–7. [9] Zheng J, Watson AD, Kerr DE. Genome-wide expression analysis of lipopolysaccharide-induced mastitis in a mouse model. Infect Immun 2006;74: 1907–1915. [10] Zhao W, Wang L, Zhang M, Wang P, Zhang L, Yuan C, et al. NF-kB- and AP-1mediated DNA looping regulates osteopontin transcription in endotoxinstimulated murine macrophages. J Immunol 2011;186:3173–9. [11] Matusˇan-Ilijasˇ K, Damante G, Fabbro D, Dorpevic´ G, Hadzˇisejdic´ I, Grahovac M, et al. Osteopontin expression correlates with nuclear factor-kB activation and apoptosis downregulation in clear cell renal cell carcinoma. Pathol Res Pract 2011;207:104–10. [12] Gu¨nther J, Esch K, Poschadel N, Petzl W, Zerbe H, Mitterhuemer S, et al. Comparative kinetics of Escherichia coli and Staphylococcus aureus-specific activation of key immune pathways in mammary epithelial cells demonstrates that S. aureus elicits a delayed response dominated by interleukin-6 (IL-6) but not by IL-1A or tumor necrosis factor alpha. Infect Immun 2011;79:695–707. [13] Urtasun R, Lopategi A, George J, Leung TM, Lu Y, Wang X, et al. Osteopontin, an oxidant stress sensitive cytokine, up-regulates collagen-I via integrin a(V)b(3) engagement and PI3 K/pAkt/NFkB signaling. Hepatology 2012;55: 594–608. [14] Miao J, Zheng L, Zhang J, Ma Z, Zhu W, Zou S. The effect of taurine on the tolllike receptors/nuclear factor kappa B (TLRs/NF-kB) signaling pathway in Streptococcus uberis-induced mastitis in rats. Int Immunopharmacol 2011;11:1740–6. [15] Vetrone SA, Montecino-Rodriguez E, Kudryashova E, Kramerova I, Hoffman EP, Liu SD, et al. Osteopontin promotes fibrosis in dystrophic mouse muscle by modulating immune cell subsets and intramuscular TGF-beta. J Clin Invest 2009;119:1583–94. [16] Sahai A, Malladi P, Melin-Aldana H, Green RM, Whitington PF. Upregulation of osteopontin expression is involved in the development of nonalcoholic steatohepatitis in a dietary murine model. Am J Physiol Gastrointest Liver Physiol 2004;287:G264–73. [17] Wu T, Chen Y, Chiang SK, Tso MO. NF-kappaB activation in light-induced retinal degeneration in a mouse model. Invest Ophthalmol Vis Sci 2002;43: 2834–2840. [18] Elazar S, Gonen E, Livneh-Kol A, Rosenshine I, Shpigel NY. Neutrophil recruitment in endotoxin-induced murine mastitis is strictly dependent on mammary alveolar macrophages. Vet Res 2010;41:10. [19] Li D, Fu Y, Zhang W, Su G, Liu B, Guo M, et al. Salidroside attenuates inflammatory responses by suppressing nuclear factor-kB and mitogen activated protein kinases activation in lipopolysaccharide-induced mastitis in mice. Inflamm Res 2013;62:9–15. [20] Blais DR, Vascotto SG, Griffith M, Altosaar I. LBP and CD14 secreted in tears by the lacrimal glands modulate the LPS response of corneal epithelial cells. Invest Ophthalmol Vis Sci 2005;46:4235–44. [21] Martich GD, Boujoukos AJ, Suffredini AF. Response of man to endotoxin. Immunobiology 1993;187:403–16. [22] Nagahata H, Kawai H, Higuchi H, Kawai K, Yayou K, Chang CJ. Altered leukocyte responsiveness in dairy cows with naturally occurring chronic Staphylococcus aureus mastitis. J Vet Med Sci 2011;73:885–94.
16
H.-B. Xiao et al. / Pathologie Biologie 63 (2015) 11–16
[23] Oz HS, Zhong J, de Villiers WJ. Osteopontin ablation attenuates progression of colitis in TNBS model. Dig Dis Sci 2012;57:1554–61. [24] Andrews S, Ford D, Martin P. Knockdown of osteopontin reduces the inflammatory response and subsequent size of postsurgical adhesions in a murine model. Am J Pathol 2012;181:1165–72. [25] Mishima R, Takeshima F, Sawai T, Ohba K, Ohnita K, Isomoto H, et al. High plasma osteopontin levels in patients with inflammatory bowel disease. J Clin Gastroenterol 2007;41:167–72.
[26] Agnholt J, Kelsen J, Schack L, Hvas CL, Dahlerup JF, Sørensen ES. Osteopontin, a protein with cytokine-like properties, is associated with inflammation in Crohn’s disease. Scand J Immunol 2007;65:453–60. [27] Kadoglou NP, Papadakis I, Moulakakis KG, Ikonomidis I, Alepaki M, Moustardas P, et al. Arterial stiffness and novel biomarkers in patients with abdominal aortic aneurysms. Regul Pept 2012;179:50–4. [28] Kim KW, Im J, Jeon JH, Lee HG, Yun CH, Han SH. Staphylococcus aureus induces IL-1b expression through the activation of MAP kinases and AP-1, CRE and NFkB transcription factors in the bovine mammary gland epithelial cells. Comp Immunol Microbiol Infect Dis 2011;34:347–54.
