macrophage M1 polarization and recruitment of microglia after MCAO stroke in rats.

Brain, Behavior, and Immunity xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Brain, Behavior, and Immunity journal homepage: www.elsevier.com/locate/ybrbi

Recombinant tissue plasminogen activator promotes, and progesterone attenuates, microglia/macrophage M1 polarization and recruitment of microglia after MCAO stroke in rats Soonmi Won a, Jae-Kyung Lee b, Donald G. Stein a,⇑ a b

Department of Emergency Medicine, Emory University, Atlanta, GA 30322, USA Department of Physiology, Emory University, Atlanta, GA 30322, USA

a r t i c l e

i n f o

Article history: Received 20 February 2015 Received in revised form 20 May 2015 Accepted 10 June 2015 Available online xxxx Keywords: MIP-1a M1/M2 polarization Microglia Macrophage Neuroinflammation Progesterone Recovery Stroke tPA

a b s t r a c t Background: Tissue plasminogen activator (tPA) is one of the few approved treatments for stroke, but its effects on the phenotype of microglia/macrophages are poorly understood. One of its side effects is an increase in the inflammatory response leading to neuronal cell damage and death in the ischemic cascade after stroke. Injury-induced activated microglia/macrophages can have dual functions as pro-inflammatory (M1) and anti-inflammatory (M2) factors in brain injury and repair. Recent studies show that progesterone (PROG) is a potent anti-inflammatory agent which affects microglia/macrophage expression after brain injury. Purpose: We examined the interaction of tPA-induced expression of microglia/macrophage phenotypes and PROG’s anti-inflammatory effects. Results: tPA treatment increased the recruitment of microglia/macrophages, the polarity of M1 reactions, the expression of MIP-1a in neurons and capillaries, and the expression of MMP-3 compared to vehicle, and PROG modulated these effects. Conclusions: PROG treatment attenuates tPA-induced inflammatory alterations in brain capillaries and microglia/macrophages both in vivo and in vitro and thus may be a useful adjunct therapy when tPA is given for stroke. Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction Decades of study on ischemia-induced cell death have slowly revealed a complex cascade of cytotoxic mechanisms including oxidative stress, intracellular calcium poisoning, excitotoxicity via glutamate receptor activity, and cytokine-induced necrosis, apoptosis and inflammation (Moretti et al., 2014). Neuroinflammation via activation of proinflammatory genes such as nuclear factor kappa B (NF-kB) and interleukin 1 (IL-1) is recognized as a key contributor to ischemic injury and poor functional outcomes. This gene activation induces the release of effector molecules which then provoke an increase in the expression of adhesion molecules, proinflammatory cytokines, and chemokines, followed by recruitment to the injury site of resident microglia, peripheral macrophages and other immune cells. Macrophages further accelerate the inflammatory response of brain by causing the activation of resident immune cells, leading to blood–brain barrier (BBB) disruption, neuronal cell death, and hemorrhagic transformation (Riazi et al., 2010). Studies on macrophages and other immune cells have ⇑ Corresponding author at: 1365 B Clifton Rd NE, Suite 5100, Atlanta, GA 30322, USA. Tel.: +1 404 712 2540; fax: +1 404 778 2630. E-mail address: [email protected] (D.G. Stein).

helped to confirm the deleterious role of leukocytes and innate immune cells in experimental stroke (Kim et al., 2014). In the United States, the only currently FDA-approved treatment for stroke is thrombolytic therapy using recombinant human tissue plasminogen activator (tPA). However, tPA is given to only about 3–5% of stroke patients due to its narrow therapeutic time window of 3.5–4.5 h and its potentially toxic side effects, which include an increased risk of hemorrhagic conversion. Hemor rhagic conversion is characterized by increased bleeding into the brain leading to further neuronal loss, inflammation, and increased cerebral edema. A recent clinical study has shown that the time window for tPA administration cannot be safely extended without loss of effectiveness (Saver et al., 2013). Although there is some evidence that tPA can itself protect neural tissue by promoting dendritic spine recovery and mediating adaptation to metabolic stress as well as dissolving blood clots (I.M.S. Study Investigators, 2004; Wu et al., 2013, 2014; Yepes et al., 2009), it has also been reported that endogenous tPA secreted from injured neurons can act as a cytokine to activate and induce the proliferation of microglia at the site of injury (Siao et al., 2003). This reaction could be detrimental to functional and morphological recovery after stroke.

http://dx.doi.org/10.1016/j.bbi.2015.06.007 0889-1591/Ó 2015 Elsevier Inc. All rights reserved.

Please cite this article in press as: Won, S., et al. Recombinant tissue plasminogen activator promotes, and progesterone attenuates, microglia/macrophage M1 polarization and recruitment of microglia after MCAO stroke in rats. Brain Behav. Immun. (2015), http://dx.doi.org/10.1016/j.bbi.2015.06.007

2

S. Won et al. / Brain, Behavior, and Immunity xxx (2015) xxx–xxx

Several groups have previously shown that tPA binds to cells with tPA receptors such as plasminogen activator inhibitor-1 (PAI-1) and low-density lipoprotein receptor-related protein/ a2-macroglobulin receptor (LRP) within the blood vessel wall (Orth et al., 1994). The role of the tPA–LRP–PAI-1 complex in the coordination of migration in macrophages and in internalization and degradation in vasculature has now been established (Orth et al., 1994; Grobmyer et al., 1993; Cao et al., 2006), but the effects and mechanisms of exogenous tPA on microglia activation/migration are not completely known and its side effects can be a problem for stroke patients. An increasing number of studies now show that microglia/macrophages are highly plastic cells with diverse phenotypes that can be beneficial or detrimental in response to specific microenvironmental signals following brain injury. The polarization of resident microglia and peripheral macrophages and other immune cells has been described as a functional dichotomy: classical (M1) and alternative (M2) activation (Murray and Wynn, 2011; Lawrence and Natoli, 2011). Classical M1 activation is induced by lipopolysaccharide/interferon-c (LPS/IFN-c) or Th1 cytokines associated with the production of proinflammatory molecules such as IL-12, IL-23, tumor necrosis factor-a (TNF-a), chemokines, and inducible nitric oxide synthase (iNOS), all of which can be damaging to neurons (Hu et al., 2012). Alternative activation (M2 polarization) is induced by Th2 cytokines IL-4, IL-13, or IL-10. These M2 microglia/macrophages express different molecules associated with the expression of scavenger receptors and proangiogenic factors such as mannose receptor, dectin-1, and arginase, which are involved in neuroprotective effects (Ponomarev et al., 2007; David and Kroner, 2011). The dual roles of polarized microglia/macrophages are seen in several CNS disorders including stroke, multiple sclerosis, spinal cord injury, and traumatic brain injury (Hu et al., 2012; Mikita et al., 2011; Kigerl et al., 2009; Wang et al., 2013). However, the specific actions of these polarized microglia/macrophages in the pathology of stroke after tPA treatment have not been explored. There is now substantial preclinical literature showing that the steroid hormone progesterone (PROG) has neuroprotective effects. It can reduce inflammation, BBB permeability and edema in a variety of acute brain injury models including traumatic brain injury, ischemic stroke, and subarachnoid hemorrhage (Young et al., 2012; Cekic et al., 2012; Ishrat et al., 2012). We recently reported that treatment with PROG inhibits delayed tPA-induced BBB disruption and cerebral hemorrhage after transient middle cerebral artery occlusion (MCAO) via regulation of vascular endothelial growth factor (VEGF)/matrix metallproteinase-9 (MMP-9) (Won et al., 2014). In the present study, we analyzed endothelial cell activation and chemokine expression in bEnd.3 cells after hypoxia followed by tPA treatment. We also studied the recruitment and M1/M2 polarization of microglia/macrophages and MMP-3 expression after transient MCAO or hypoxia using BV2 microglial cells exposed to tPA treatment. Based on previous literature and our own observations, we examined the idea that after ischemic injury, cross-talk between brain endothelial cells and microglial/macrophage cells given tPA treatment will worsen stroke-induced BBB disruption and that PROG administration will ameliorate this condition.

2. Materials and methods 2.1. Animals Male Sprague-Dawley rats (n = 39), approximately 3 months old (300–350 g) at the time of surgery, were obtained from Charles River (Wilmington, MA, USA) and used as subjects. All animals

were housed in an AAALAC-approved Research Animal Facility with a temperature-, humidity-, and light-controlled environment, and placed under a 12-h reverse light–dark cycle. Public Health Service Policy on Humane Care and Use of Laboratory Animals, the Guide for the Care and Use of Laboratory Animals, and all other applicable regulations, policies, and procedures, were followed and approved by Emory University Institutional Animal Use and Care Committee (protocol #DAR-2001411). The experiments are reported here in accordance with the ARRIVE guidelines. The rats were quarantined for 7 days before the experiment and housed in individual cages in a room maintained at 21–25 °C, 45–50% humidity, and free access to pellet chow and water. At the completion of the study, and for the purpose of histology, all animals were anesthetized with 5% isoflurane and euthanized by guillotine after transcardiac perfusion at 24 h after stroke surgery. 2.2. Transient focal ischemia The rats were anesthetized with isoflurane (5% for surgical induction, 2–2.5% for maintenance) in NO2:O2 (70%:30%) during the surgery. Body temperature was monitored continuously with a rectal probe and maintained at 37.5 ± 0.5 °C using a heating lamp. We used our standard laboratory procedures as follows: for monitoring MCAO and reperfusion, cerebral blood flow was assessed by laser Doppler flowmetry using a probe fixed to the skull above the territory of the right MCA (core cortex: 2 mm posterior and 6 mm lateral to bregma). The rats were placed in a modified stereotaxic frame equipped with a facemask. A midline incision was made at the ventral surface of the neck and a 6–0 silk suture was used to separate and ligate the right common carotid arteries. Next, a microvascular clip was used to temporarily occlude the internal carotid and pterygopalatine arteries while a 4–0 silicon-coated monofilament (0.35–0.40 mm long) (Doccol Co., Albuquerque, NM, USA) was inserted through the cut in the external carotid artery and into the internal carotid artery. This filament was pushed an estimated 20 mm distal to the carotid bifurcation to a point at which the laser Doppler-cerebral blood flow signal abruptly decreased, indicating low cortical blood flow. The filament was left in place for 4 h 30 min and then withdrawn gently back into the common carotid artery to allow reperfusion. Rats subjected to MCAO with less than 40% of baseline laser Doppler flowmetry were randomly assigned to receive drug treatments. Sham animals were anesthetized, an incision was made and the fascia cleared to expose the bregma at the top of the head. Next, a midline neck incision was made and the common carotid and internal carotid arteries were isolated and exposed. Last, the incision was sutured closed. Twenty-four hours after the ischemic injury and drug treatments, the animals were euthanized for the collection of brain tissue samples. 2.3. Experimental groups and in vivo drug treatment We calculated the starting sample sizes to be at least 6 animals/group to reject the null hypothesis (H0) at p < 0.05 with a power of 0.80 to observe at least a 50% difference between treatment and sham-operated controls. Animals underwent tMCAO or sham surgery and were assigned, in no particular order to one of four treatment groups: sham (CTRL), MCAO + vehicle (saline), MCAO + tPA alone, MCAO + tPA + PROG. PROG (8 mg/kg in 22.5% w/v 2-hydroxyropyl-b-cyclodextran solution) was given intraperitoneally 2 h post-occlusion for faster absorption followed by a subcutaneous injection for slower and sustained absorption at 6 h post-occlusion. Previous studies have shown 8 mg/kg to be the optimally effective PROG dose in a stroke model (Ishrat et al., 2009, 2010). Physiologic saline with tPA (Genentech, San Francisco, CA, USA) was administered (10% bolus, 90% continuous



infusion within 30 min) to the rats via femoral vein beginning 10 min before reperfusion at 5 mg/kg, a dose shown to have optimal fibrinolytic activity with lower mortality (Saver et al., 2013; Zhu et al., 2010) (see Table 1). 2.4. Cell and tissue processing for immunoblotting Peri-infarct cortical tissue was processed for protein analysis. Tissues were first homogenized in T-per (Pierce, Rockford, IL, USA) containing protease inhibitor cocktail (P8340, Sigma). Homogenates were centrifuged for 15 min at 13,000g. Forty micrograms of total protein was separated on 8–12% gel and transferred onto polyvinylidene difluoride (Millipore, Billerica, MA, USA) membranes at 300 mA for 2 h. bEnd.3 cells and BV2 cells were subjected to hypoxia/reoxygenation and then lysed on ice in 100 lL of RIPA buffer. Total cell lysates were boiled and then electrophoresed in 12% SDS–PAGE acrylamide gels, transferred onto polyvinylidene difluoride membranes, and incubated for 1 h in Tris-buffered saline with 0.1% Tween 20 (TBST) containing 5% bovine serum albumin (BSA). Membranes were then incubated overnight at 4 °C with primary antibodies against Iba-1 (Wako, Osaka, Japan; 1:1000), CD68 (Abcam, Cambridge, MA, USA; 1:1000), ICAM-1, MMP-9, and MMP-3 (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:1000), washed in TBS–T, and incubated for 1 h at room temperature with corresponding peroxidase-conjugated secondary antibodies (KPL, Gaithersburg, MD, USA; 1:5000). All blots were stripped and re-incubated with b-actin antibodies (Sigma; 1:5000) as a loading control. The peroxidase reaction was developed with an ECL-plus detection kit (Amersham BioSciences, Piscataway, NJ, USA). Intensity of the bands was measured using Image Gauge 4.0 (FUJI Film, Tokyo, Japan). 2.5. Immunostaining in hypoxia/reperfusion-treated BV2 cells and in brain tissue 2.5.1. Euthanasia After rats were deeply anesthetized with 5% isoflurane, they were subjected to transcardiac perfusion with phosphate-buffered saline (PBS; pH 7.4), and formalin, and their brains were removed and fixed in formalin and immersed in 30% sucrose for 3–4 days at 4 °C. Frozen brains were coronally sectioned at slice thickness of 25 lm on a Cryostat (Leica Microsystems GmbH, Wetzlar, Germany). Forebrain coronal sections were selected from +4.0 mm to 4.0 mm relative to the bregma for histology. Every 6th section was saved for histological analysis. 2.5.2. Immunocytochemistry For immunostaining, BV2 cells were grown to confluence on uncoated coverslips. Cells and brain tissues were washed 3 times with PBS, fixed in 3% paraformaldehyde for 10 min, permeabilized with 0.25% Triton X-100 in PBS for 10 min, and blocked with 10%

Table 1 Markers tested in this experiment. Samples

Markers tested

In vivo

– – – –

Microglia/macrophage recruitment Microglia/macrophage M1/M2 polarity MIP-1a expression MMP-3 expression

In vitro

– – – – –

BV2 microglial cell transmigration M1/M2 polarity using BV microglia Brain endothelial cell activation (ICAM-1, MCP-1, MIP-1a) MMP-3/9 expression in BV2 microglia

3

BSA and 0.1% Triton X-100 in PBS for 1 h. After washing with PBS, the monolayers were incubated with a primary antibody for Iba-1 (Wako; 1:200), CD68 (Abcam; 1:200), and MMP-3 (Santa Cruz; 1:400) overnight at 4 °C. The cell monolayers were then washed 3 times with PBS and incubated with Alexa Fluor 488 anti-rabbit and orange anti-mouse (Molecular Probes, Eugene, OR, USA) for 1 h. After washing in PBS, the coverslips were mounted on glass slides with Vectashield with 40 ,6-diamidi no-2-phenylindole (DAPI).

2.6. Cell culture and materials 2.6.1. bEnd.3 endothelial cells and BV2 microglial cell lines An immortalized mouse brain endothelial cell line (bEnd.3) and a BV2 microglia cell line were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in Dulbecco’s modified Eagle medium (DMEM; ATCC) supplemented with 10% fetal bovine serum (ATCC). Cell cultures were incubated at 37 °C in a 5/95% mixture of CO2 and atmospheric air, and the medium was replaced every 3 days (see below for measurement details).

2.6.2. Primary microglia cultures from adult rat brain Primary microglia cells were isolated from adult rat brains (n = 3) as described in Lee and Tansey (2013). Briefly, rat brains were isolated and minced after perfusion. The minced tissues were digested using dissociating enzyme solution containing papain (1 mg/mL)–dispase (1.2 U/mL)–DNase (20 U/mL) for 20 min at 37 °C followed by neutralization with serum containing medium (DMEM/F12 supplemented with 10% heat-inactivated fetal bovine serum, 1% penicillin–streptomycin, 1% glucose, and 1% L-glutamine (Sigma-Aldrich, St Louis, MO, USA)). Microglia were separated by collecting the 30%:37% Percoll layer interface of a 30%:37%:70% Percoll gradient. Cells were cleansed of Percoll with 1 Hank’s Balanced Salt Solution and re-suspended in DMEM/F12 supplemented with 10% heat-inactivated fetal bovine serum.

2.7. In vitro drug treatment Cells were treated with 10 or 20 lmol/L of PROG (Sigma) for 24 h before hypoxia/reperfusion. In all cases, the treatment with tPA or PROG + tPA (20 lg/mL) was continued throughout the hypoxia/reperfusion period. PROG was dissolved in DMSO (Sigma) and further dilutions (0.1%) were made with culture medium.

2.8. Normoxia and hypoxia/reperfusion study Normoxic cells were transferred into a serum-free medium of glucose-containing (4.5 g/L) phenol red-free DMEM. To mimic ischemic conditions in vitro, bEnd.3 cells were exposed to 2-h hypoxia with or without the administration of tPA. We used a tPA dose of 20 lg/mL, based on the finding that such a concentration can be detected in blood (Godfrey et al., 1998). In brief, confluent bEnd.3 cells were subjected to an ischemic injury by transferring cultures to glucose-free medium (DMEM without glucose) pre-equilibrated with 95% N2/5% CO2. Cells were then incubated in a humidified airtight chamber equipped with an air lock and flushed with 95% N2/5% CO2. The oxygen concentration was 60.1% as monitored by an oxygen analyzer (Biospherix, Redfield, NY, USA). Reoxygenation was initiated by adding glucose-containing (4.5 g/L) phenol red-free DMEM for 3 h at 37 °C in 95% air and 5% CO2.


4


2.9. Reverse transcription or real-time PCR Total RNA was extracted from cells or tissue with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Reverse transcription was done with High-Capacity cDNA Reverse Transcription kits (Applied Biosystems, Foster City, CA, USA). PCR amplification using specific primer sets was carried out at an annealing temperature of 55–60 °C for 20–30 cycles. For the analysis of the PCR products, 10 lL of each PCR product was electrophoresed on a 1% agarose gel and detected under UV light. GAPDH was used as an internal control. For measuring gene expression in vitro, real-time PCR was done with an ABI 7500 Fast Real-Time system (Applied Biosystems). Nucleotide sequences of the primers were based on published cDNA sequences (Table 2).

2.10. Cell migration assays in vitro Cell migration was detected using an in vitro Boyden chamber assay and a co-cultivation assay. Microglia were suspended in standard medium, and 3 104 cells were seeded to the upper well of each Transwell insert (Corning Life Sciences, Tewksbury MA; 8.0-lm pore size), which bore an uncoated filter with 8-lm diameter holes. The lower well contained only medium. Microglia were incubated for 24 h (37 °C, 5% CO2) and then treated with either tPA or tPA + PROG under hypoxia. The cell-bearing filters were fixed in 4% paraformaldehyde for 10 min, rinsed with PBS, and the microglia remaining on the upper side of each filter were removed with a Q-tip. The cells migrating to the underside were stained with DAPI and counted at 20 magnification with an Olympus IX71 microscope (Olympus, Tokyo, Japan). For the co-cultivation assay, bEnd.3 cells and BV2 microglia were seeded and confluent-grown on glass slides in a petri dish. For 3-h hypoxia, the cells were given either tPA or tPA + PROG under hypoxia. The glass slides with cells on them were then placed in a petri dish for 16 h. After removing the glass cover slide, the cells were fixed in 4% paraformaldehyde for 10 min and rinsed with PBS. The migrated cells were counted

Table 2 PCR primers used in the study. Biomarker

Forward primer (50 ? 30 )

Reverse transcriptase PCR for rat iNOS Forward Reverse IL-1b Forward Reverse TNF-a Forward Reverse IL-10 Forward Reverse Arginase-1 Forward Reverse GAPDH Forward Reverse

GCAGAATGTGACCATCATGG ACAACCTTGGTGTTGAAGGC TGATGTTCCCATTAGACAGC GAGGTGCTGATGTACCAGTT GTAGCCCACGTCGTAGCAAA CCCTTCTCCAGCTGGGAGAC TGCCTTCAGTCAAGTGAAGACT AAACTCATTCATGGCCTTGTA CCAAGCCAAAGCCCATAGAGATTA CCCGTGCAGATTCCCAGAGC AATGGGGTGATGCTGGTGCTG A TGGGGGCTGAGTTGGGATGG

Real-time PCR for mouse TNF-a Forward Reverse iNOS Forward Reverse IL-23 Forward Reverse Arginase-1 Forward Reverse Ym1 Forward Reverse Fizz1 Forward Reverse GAPDH Forward Reverse

ATGGCCTCCCTCTCAGTTC TTGGTGGTTTGCTACGACGTG GCCACCAACAATGGCAACA CGTACCGGATGAGCTGTGAATT CGACTGTTGCCTCTCGTACA AGGAGGTTCACAGCCCTTTT CGCCTTTCTCAAAAGGACAG CCAGCTCTTCATTGGCTTTC GGGCATACCTTTATCCTGAG CCACTGAAGTCATCCATGTC TCCCAGTGAATACTGATGAGA CCACTCTGGATCTCCCAAGA ACCACAGTCCATGCCATCAC CACCACCCTGTTGCTGTAGCC

in phase contrast images and were then stained with the primary antibody of Iba-1. 2.11. Statistical analysis Based on a delta-value of 1.25, we calculated the sample sizes and power needed to achieve >80% power to detect an estimated effect size of 50% difference between treatment and placebo controls. The number of rats per group at these criteria was determined to be at least 6. The parameters were analyzed using one-way analysis of variance (ANOVA) followed by the Tukey post hoc test. All data are presented as mean ± s.e.m. All tests were considered statistically significant at p values 6 0.05. Confidence intervals are provided to show that there is 95% certainty that the means reported will fall within the intervals designated in the obtained results. This is a better visual presentation of effect size (see Cumming, 2012, Chapter 4, for more details on these procedures). 3. Results 3.1. tPA increases microglia/macrophage infiltration We previously showed that tPA treatment at 4.5 h after stroke induced cerebral hemorrhage with BBB disruption (Won et al., 2014). Here, we sought to characterize the effects of tPA on inflammation at 4.5 h after stroke. First, to examine whether tPA treatment can induce changes in the recruitment of immune cells after MCAO, and whether PROG treatment can attenuate that effect, we subjected Iba-1 and CD 68-positive microglia/macrophages to immunostaining and Western blot assays. As revealed by DAB immunostaining, the Iba-1 and CD68-positive microglia/macrophages in the MCAO group showed an increased number of amoeboid-shaped cells with thick processes indicative of activated cells in perivascular regions and in brain parenchyma compared with controls. This response was higher after MCAO + tPA treatment (Fig. 1A). PROG inhibited the tPA-induced recruitment of Iba-1-positive and CD68-positive microglia/macrophages after MCAO (Fig. 1A). Western blot analysis also showed that tPA treatment produced a significant increase in Iba-1 (p < 0.05, 95% CI 1.893 to 0.8610) and CD68 protein (p < 0.05, 95% CI 76.34 to 2.441) expression which was suppressed by PROG treatment (p < 0.05, 95% CI 0.2854–1.128 for Iba-1, 95% CI 0.2854–1.128 and for CD68, 4.798–68.08) (Fig. 1B– D). Together, these data suggest that tPA treatment after MCAO activates resident brain microglia and increases recruitment of peripheral macrophages to the injury area compared to MCAO alone. PROG significantly attenuates this inflammatory response. 3.2. tPA induces microglia/macrophage migration after hypoxia/ reoxygenation Microglial cell migration is one of the main components of brain responses to injury and inflammation (Block and Hong, 2005). To verify whether tPA induces microglial cell migration after hypoxia/reoxygenation and whether treatment with PROG can attenuate this effect, we performed two cell migration assays. In the transwell system, the migration of BV-2 microglial cells across a membrane was increased after hypoxia (0.1% O2) and then reoxygenation, and further increased by tPA treatment compared to controls (p < 0.0001, 95% CI = 40.67 to 22.00, Fig. 2A and C). PROG treatment produced a significant reduction in this effect (p < 0.0001, 95% CI = 22.66–41.34, Fig. 2A and C). Similar effects were observed in the co-cultivation assay using both bEnd.3 cerebral endothelial cells and BV-2 microglial cells



5

migrated cells are not cerebral endothelial cells but are specifically microglia and that PROG treatment produced a significant reduction in microglial migration induced by hypoxia/reoxygenation combined with tPA (p < 0.01, 95% CI = 9.221–40.78, Fig. 2B and D). 3.3. tPA induces the gene expression of MIP-1a and cerebral endothelial cell activation after hypoxia/reoxygenation Immune cell trafficking is regulated by chemokines and cytokines, and by members of the integrin, immunoglobulin and adhesion molecule families (Luster et al., 2005; Weber and Koenen, 2006). We investigated the gene expression level of monocyte chemoattractant protein-1 (MCP-1) and MIP-1a in bEnd.3 cells after hypoxia with tPA treatment. MCP-1 mRNA levels did not change following hypoxia or hypoxia with tPA treatment, but showed a significant downregulation by tPA + PROG treatment compared to tPA alone (p < 0.05, 95% CI = 0.06576–1.008, Fig. 3A and B). MIP-1a appeared under hypoxia and was further upregulated by tPA treatment under hypoxia (p < 0.05, 95% CI = 6.369 to 0.5034, Fig. 3A and C). Treatment with tPA + PROG downregulated MIP-1a expression compared to tPA alone (p < 0.01, 95% CI = 1.051–6.644, Fig. 3A and C). To determine whether tPA treatment after hypoxia leads to the activation of endothelial cells leading to infiltration of peripheral immune cells, we measured the expression of ICAM-1 with Western blots. The protein expression of ICAM-1 was significantly increased after tPA treatment compared to hypoxia alone and to controls (p < 0.05, 95% CI = 3.036 to 0.4041). tPA + PROG treatment produced a significant attenuation in ICAM-1 in bEnd.3 cells (p < 0.05, 95% CI = 0.2898–2.597, Fig. 3D and E). Furthermore, MIP-1a expression was increased in Glut-1-positive brain capillaries and neurons after MCAO alone or after MCAO + tPA treatment (Fig. 3F). Consistent with our in vitro results, the expression of MIP-1a was significantly higher in the tPA-treated group after MCAO than with MCAO alone (p < 0.0001, 95% CI = 6.223 to 2.788). These increases in MIP-1a were almost completely inhibited by PROG treatment (p < 0.0001, 95% CI = 2.530–5.335, Fig. 3G). 3.4. The mRNA expression of M1/M2 markers after stroke and tPA treatment To examine the effect of tPA treatment after stroke on M1/M2 microglia/macrophage polarity, we used traditional RT-PCR for M1/M2 markers. The expression of M1 markers iNOS, IL-1b, and TNF-a was significantly increased after stroke + tPA treatment compared to MCAO alone (p < 0.0001, 95% CI = 12.59 to 3.102; p < 0.05, 95% CI = 2.589 to 0.2288; and p < 0.0001, 95% CI = 17.02 to 5.287, respectively, Fig. 4A–C). These increases were significantly attenuated by PROG + tPA after stroke compared to tPA treatment alone (p < 0.01, 95% CI = 1.466–9.119; p < 0.0001, 95% CI = 0.6717–2.574; and p < 0.05, 95% CI = 0.1649–9.742, respectively, Fig. 4A–C). The M2 markers IL-10 and arginase-1 were not significantly different across all groups (Fig. 4D and E). Fig. 1. Effect of recombinant human tissue plasminogen activator (tPA) and tPA plus progesterone (P4) on microglia and macrophages after middle cerebral artery occlusion (MCAO). (A) Representative photographs of microglial cells/macrophages (Iba-1 and CD68) in the ischemic hemispheres of control (CTRL), MCAO, MCAO + tPA, and MCAO + tPA + P4-treated groups at 24 h reperfusion after MCAO. (B–D) Representative Western blots. The expression of microglia and macrophages (Iba-1 (C), CD68 (D)) was significantly higher in the MCAO + tPA than in the MCAO group. Results are expressed as means ± s.e.m.; n = 6–7, *p < 0.05.

(p < 0.01, Fig. 2B and D). We also used immunostaining of Iba-1, a microglia-specific marker, to determine whether the migrated cells are microglia or some other cell type. The result shows that the

3.5. The mRNA expression of M1/M2 markers after hypoxia + tPA treatment in BV2 microglia Using the gene expression profile of M1 and M2 markers in vivo to confirm the effect of tPA on M1 vs M2 polarization in brain microglia, we characterized the gene expression profile of microglia treated with tPA under hypoxia. RT-PCR analysis was performed for individual M1- and M2-related genes in primary microglia isolated from adult brain and BV-2 cells. We observed significantly increased expression of the M1 genes TNF-a, IL-1b, and iNOS with tPA treatment under hypoxia compared to hypoxia alone or to control (p < 0.001, 95% CI = 6.134 to 3.028, 95%


6


Fig. 2. Effect of progesterone (P4) on microglia migration after hypoxia/reoxygenation with recombinant human tissue plasminogen activator (tPA) in BV2 and bEnd.3 cells. (A and C) Representative photographs of the transmigrated DAPI-labeled microglia for each condition in a Trans well chamber. (B) Representative photographs of the transmigrated microglia in co-cultivation of BV2 microglia and bEnd.3 cerebral endothelial cells. (D) Transmigrated microglia in phase image of co-cultivation. Results are expressed as means ± s.e.m.; n = 3, *p < 0.05.

CI = 4.355 to 3.274, and 95% CI = 4.583 to 1.665, respectively), which was decreased by PROG treatment (p < 0.001, 95% CI = 6.134 to 3.028, 95% CI = 0.5467–1.628; and p < 0.01, 95% CI = 0.4873–3.405, Fig. 5A(a–c)). The expression of M2 genes IL-10 and Arg-1 were not altered after hypoxia. However, in primary microglia isolated from adult brain, PROG treatment increased expression of these genes compared with tPA alone under hypoxia (p < 0.001, 95% CI = 2.993 to 1.304; p < 0.05, 95% CI = 1.940 to 0.02546, respectively, Fig. 5A(d and e)). The increased expression of the M1 genes iNOS and TNF-a was also significantly higher with tPA treatment under hypoxia compared to

hypoxia alone or to controls (p < 0.001, 95% CI = 1.403 to 0.4038; and p < 0.01, 95% CI = 4.993 to 0.8527, respectively, Fig. 5B(a and c)). In contrast, there was no significant increase of IL-23 mRNA in any of the groups (Fig. 5B(a–f)). The level of M2-related mRNA (ARG1, Ym1, and FIZZ1) was not changed after hypoxia with/without tPA treatment (Fig. 5B(d–f)). There was a significant effect of PROG treatment on the suppression of the tPA-induced, increased mRNA expression of M1 markers TNF-a and iNOS compared with tPA alone (p < 0.05, 95% CI = 0.1431–1.191; and p < 0.05, 95% CI = 0.04723–4.187, respectively, Fig. 5B(a and c)). PROG increased the expression of



7

M2-related genes ARG1, Ym1, and FIZZ1 after hypoxia with tPA treatment (p < 0.05, 95% CI = 1.836 to 0.1433; p < 0.05, 95% CI = 2.383 to 0.3296; and p < 0.01, 95% CI = 2.621 to 0.3617, respectively, Fig. 5B(d–f)). 3.6. MMP-3 expression in microglia after stroke and tPA treatment We evaluated MMP-3 expression after ischemia using Western blot and immunofluorescence staining. MMP-3 expression was significantly higher in the tPA group compared to MCAO or sham groups at 24 h (p < 0.05, 95% CI = 1.545 to 0.07111, Fig. 6A and B). PROG treatment attenuated tPA-induced MMP-3 expression after stroke (p < 0.05, 95% CI = 0.02340–1.429, Fig. 6A and B). MMP-3 was expressed by brain endothelial cells after MCAO. In the tPA treatment group, MMP-3 expression was induced in brain endothelial cells and in microglia seen around brain endothelial cells in the penumbra of the infarcted areas. Double staining confirmed that the microglia in contact with brain endothelial cells were one of the cellular sources of MMP-3 after stroke + tPA treatment (Fig. 6C). This result was confirmed with BV2 microglia after hypoxia/reoxygenation with or without tPA treatment. Consistent with the in vivo results, the induction of MMP-3/9 was more prominent in tPA-treated hypoxia/reoxygenation cells than in control BV2 microglia (p < 0.01, 95% CI = 1.625 to 0.2466 for MMP-3 and p < 0.05, 95% CI = 0.5133 to 0.02638 for MMP-9). In contrast, the increases in MMP-3/9 were almost completely inhibited when cells were pretreated with PROG (p < 0.0001, 95% CI = 0.3858–1.561 for MMP-3 and p < 0.0001, 95% CI = 0.5863– 1.011 for MMP-9, Fig. 6D–F). 4. Discussion Despite the fact that it can increase the incidence of intracerebral hemorrhage (Lees et al., 2010), tPA is the only thrombolytic therapy shown to improve patient outcome in acute ischemic stroke, but its pathophysiological role in causing neuroinflammation is still not completely understood. Our study reveals the dynamic interaction between brain endothelial cells and microglia, the polarization status of microglia following tPA treatment for stroke, and the beneficial effects of PROG on these inflammatory components of tPA’s effects. Besides its thrombolytic actions, tPA can cause brain injury through its interaction with various receptors such as LRP (Zhang et al., 2007), the N-methyl-D-aspartate receptor (Nicole et al., 2001), or annexin II (Pineda et al., 2012). In addition, exogenous tPA after stroke exacerbates mortality and increases cerebral infarction, BBB disruption, and hemorrhage (Won et al., 2014). Several studies have examined the role of endogenous tPA on cerebral infarction and BBB damage after cerebral stroke with tPA KO mice (Wang et al., 1998; An et al., 2008; Nagai et al., 1999) and have found that morbidity is attenuated in these genetically modified animals. 4.1. Macrophages and microglia mediate the brain’s immune response Fig. 3. Effect of progesterone (P4) on chemokine MCP-1/MIP-1a and cerebral endothelial cell activation after hypoxia with recombinant human tissue plasminogen activator (tPA) in bEnd.3 cells. (A) mRNA levels of MCP-1 and MIP-1a genes determined by RT-PCR. GAPDH used as an internal control. (B and C) Densitometric quantitative data. (D and E) Immunoblot image and quantitative data showing the expression of ICAM-1 after 2 h hypoxia. Application of tPA (20 lg/mL) with hypoxia increased the expression of ICAM-1. P4 (20 lmol/L) prevented the increase of ICAM-1 expression. (F) Double immunofluorescence staining showing expression of MIP-1a after MCAO with tPA treatment. (G) Representative Western blots. The expression of MIP-1a was significantly higher in MCAO + tPA than in the MCAO group. Results are expressed as means ± s.e.m.; n = 6, *p < 0.05.

Microglia/macrophages are the primary mediators of the brain’s innate immune response to injury and disease (Hu et al., 2012; Loane and Byrnes, 2010). Recent research on the functions of microglia in the injured CNS provides strong evidence to support their phenotypic activation into either M1 or M2 subtypes and their dual roles—both beneficial and harmful. A large number of studies indicate that microglia contribute to neuronal dysfunction and cell death by releasing proinflammatory mediators such as cytokines, reactive oxygen species, and MMPS (Min et al., 2004; Woo et al., 2008; Kim et al., 2003). However, microglial activation


8


Fig. 4. Influence of recombinant human tissue plasminogen activator (tPA) after middle cerebral artery occlusion (MCAO) on M1/M2 polarization of microglia/macrophages and the effect of progesterone (P4) on M1/M2 polarity after MCAO with tPA treatment. Expression of (A–C) M1 (iNOS, IL-1b and TNF-a) and (D and E) M2 (IL-10 and arginase1) in brain tissue examined by quantitative RT-PCR. Results are expressed as means ± s.e.m.; n = 6–7, *p < 0.05.

also exerts beneficial effects in the injured brain because the cells can remove cellular debris and help to restore tissue integrity (Lalancette-Hebert et al., 2007). Thus, microglial activation after stroke can participate in either or both of these processes. We observed an increase in microglia after MCAO and both microglia and macrophage reaction after MCAO with tPA treatment. Our observation is in line with previous work in which microglia are reported to be the first immune cells to respond to ischemic injury (Fig. 1) (Jin et al., 2010; Gelderblom et al., 2009).

4.2. ICAMs, MIP-1a and endothelial cells The infiltration of macrophages with tPA treatment after stroke can be traced to BBB disruption and hemorrhage, as we have shown previously (Won et al., 2014). Leukocyte recruitment into the brain is thought to involve a signaling cascade leading to firm endothelial adhesion and subsequently to transmigration, which largely depends on the upregulation of adhesion molecules such as ICAM1, P-selectin, and E-selectin after cerebral ischemia (Rossi et al., 2011). We found that tPA induces an increase of ICAM-1 protein expression compared to hypoxia alone and this was attenuated by PROG treatment in bEnd.3 cells (Fig. 2). ICAM-1, a transmembrane immunoglobulin protein that is predominantly expressed on endothelial cells, is of major importance in leukocyte recruitment. Upregulation of ICAM-1 contributes to stable binding of leukocytes and facilitates their transmigration by rearranging

the endothelial cytoskeleton and loosening the endothelial cell tight junctions. Chemokines, as primarily secreted small proteins, have been known to modulate multiple aspects of the inflammatory response and host defense. Several groups have reported the induction of MIP-1a in various stroke animal models and in stroke patients (Zaremba et al., 2006). As an active mediator in cerebral post-ischemic inflammation, MIP-1a upregulation can cause monocyte/macrophage and microglial accumulation both in vitro (Skuljec et al., 2011) and in vivo (Wang et al., 2008). The increased mRNA expression of MIP-1a was observed at 6–48 h following permanent MCAO in rats (Kim et al., 1995) and at 6 h after reperfusion following transient MCAO in mice (Nishi et al., 2005). In the present study, we found that tPA enhances MIP-1a expression in microvessels and neurons in vivo after stroke as well as in brain endothelial cells in vitro under hypoxia. We suggest that MIP-1a induction in cerebral endothelial cells and neurons triggers microglia/macrophage cell recruitment. 4.3. M1 polarization Microglia/macrophage polarization is flexible and is involved in the generation of different cell types with distinct effector functions (Murray and Wynn, 2011). The phenotype and functional activities of microglia/macrophages are regulated by many cytokines and microbial products which allow the development of M1 or M2 subtypes that then play a role in mediating different functional



d

b

c

β

α

A a

9

e

Fig. 5. Influence of recombinant human tissue plasminogen activator (tPA) with hypoxia on M1/M2 polarization in primary microglia isolated from adult brain and BV2 microglia and the effect of progesterone (P4) on M1/M2 polarity after hypoxia with tPA treatment. (5A(a–c)) Expression of M1 (TNF-a, IL-1b and iNOS) and (5A(d and e)) M2 (IL-10 and arginase-1) examined by RT-PCR. Results are expressed as means ± s.e.m.; n = 4, *p < 0.05. (5B(a–c)) Expression of M1 (TNF-a, IL-23 and iNOS) and (5B(d–f)) M2 (arginase-1, Ym1 and fizz1) examined by RT-PCR. Results are expressed as means ± s.e.m.; n = 6, *p < 0.05.

states. These M1- and M2-type cells express different levels of cell surface markers and secrete mediators such as adhesion molecules, scavenger receptors, chemokines, and cytokines. In the present study, we describe tPA-induced M1 microglia/macrophage polarization and the inhibitory effects of PROG on tPA-induced alterations after stroke (Fig. 3). These findings are supported by data obtained from BV2 microglia cells after tPA treatment under hypoxic injury (Fig. 4). To us, it seems increasingly apparent that tPA heightens the M1 microglia/macrophage reaction after stroke or hypoxic injury and that PROG counteracts this effect. M1 polarization is linked to inflammation and tissue damage, whereas the M2 reaction can have an anti-inflammatory role in wound repair by coordinating inflammation and angiogenesis. It has been suggested that microglial interaction with human immunodeficiency virus (HIV) proteins or TLR-3/4 ligands results in the M1-like phenotype (Bruce-Keller et al., 2001; Suh et al., 2009). Increased M1 polarization is consistent with increased TNF-a in plasma and brain specimens in HIV-associated dementia and Alzheimer’s disease, and has been implicated in the pathophysiology of these diseases (Minagar et al., 2002). These studies suggest that M1 polarization is involved in the initiation and perpetuation of neuroinflammation in other diseases as well as stroke,

whereas M2 polarization is more related to the resolution of neuroinflammation through engulfment and degradation of invading pathogens, peptides and apoptotic cells. The M2-related cytokine IL-10 increases macrophage phagocytic ability, and heightened activity of M2 macrophages results in necrotic cellular debris scavenging and tissue remodeling (Ruffell et al., 2009). Recently, it has been shown that the phenotype of recruited microglia after stroke (Hu et al., 2012) and traumatic brain injury (Wang et al., 2013) gradually changes from M2 to M1. In our experiment, the M1 phenotype was observed after tPA treatment with stroke and the expression of this phenotype was prevented by PROG treatment. Our data suggest that early M1 phenotype expression is related to the extent of delayed tPA-induced brain injury after stroke. Future analysis of the precise mechanism of tPA or PROG action in stroke may reveal and differentiate mechanisms underlying M1 and M2 polarization. 4.4. MMP-3 MMP-3 plays a critical role in intracerebral hemorrhage induced by tPA treatment after ischemic stroke. Suzuki et al. (2007) demonstrated that MMP-3 is more important than



1.0 0.5 0.0

e

0

H

H

yp ox ia yp ox ia H +t yp PA ox ia +t PA +P 4

L TR C 1

a yp ox ia +t yp PA ox ia +t PA +P 4

L

H

TR

yp ox H ia yp ox ia H +t yp PA ox ia +t PA +P 4

0

C

yp ox H ia yp ox ia H +t yp PA ox ia +t PA +P 4

H

C TR L

0.0

2

H

0.5

1

*

3

xi

1.0

2

yp o

1.5

4

Fold change (Fizzl1,control=1)

Fold change (Ym1, control=1)

Fold change (Arginase-1, control=1)

*

* 2.0

2

f 3

2.5

4

0

H

d

*

6

H H yp yp ox ox ia ia + tP H yp A +P ox 4 ia +t PA +P 4

ox ia yp ox ia H +t yp PA ox ia +t PA +P 4

yp H

C

TR

L

0

8

H

1

1.5

*

*

H

2

2.0

*

10

L

*

c

2.5

TR

*

Fold change (IL-23, control=1)

*

C

b

3

C R TL

a

Fold change (TNF-α control=1)

B

Fold change (iNOS, control=1)

10

Fig. 5 (continued)

MMP-9 in increasing intracerebral hemorrhage resulting from tPA treatment of ischemic stroke in MMP-3 KO mice. We now think that MMP-3 might be involved in BBB disruption and contribute to further intracerebral hemorrhage. Several studies have shown that the production of MMP-3 is increased by the proinflammatory cytokines IL-1b, TNF-a, IFN-c, and IL-17A, as well as by serum amyloid A, and down-regulated by IL-4 and IL-13 (Manicone and McGuire, 2008). These studies support our finding that tPA-induced inflammation increases MMP-3 expression after stroke. Our results also demonstrate that delayed tPA treatment after stroke causes MMP-3 induction in microglia and microvessels, as confirmed with in vitro experiments using BV2 microglia under ischemic stress. 5. Conclusion It is well known that microglia/macrophage-related neuroinflammation can lead to secondary brain injury after stroke. Further, the amplification of inflammation and immune reactions continues beyond the initial hours after stroke onset and this response provides a window of opportunity for blocking the secondary events associated with increased infarction. Classical anti-inflammatory agents, steroids and nonsteroidal drugs have been tested against this type of neuroinflammation but have not yet found a major role in the treatment of the cytotoxic cascade following stroke (Nimmo and Vink, 2009). Recently, several pluripotent agents such as the microglia inhibitor minocycline, statins, and the T-cell blocker natalizumab, have shown positive

effects in preclinical (Liesz et al., 2011) and in retrospective analyses of clinical trials in patients with acute ischemic stroke (Kohler et al., 2013; Endres, 2005). These results support the importance of modulating the immune reaction after stroke or stroke with tPA treatment if stroke outcomes are to be improved, and suggest a strategy for managing acute ischemic stroke patients with novel combination therapies to enhance the effects of tPA while reducing some of its proinflammatory side effects. However, one of the unintended effects of combination therapies is to block the ability of macrophages and microglia to remove cellular debris, a notion supported by observations that selective depletion of proliferative microglia exacerbates brain injuries and, conversely, that injections of exogenous microglia into the brain ameliorate CNS injuries (Imai et al., 2007). Despite its known proinflammatory properties, tPA was nevertheless approved for clinical use (Siao and Tsirka, 2002). Since it can be proinflammatory, combining it with an agent to prevent tPA-induced M1 activation may eventually benefit the treatment of stroke victims. tPA has a direct effect on microglia/macrophage polarization and these effects can modulate the interaction between brain endothelial cells and microglia after stroke. Treatment with tPA started at 4.5 h after stroke in rats induced the sustained or increased M1 microglia phenotype without altering M2, and increased chemokine MIP-1a activity in cerebral blood vessels and neurons. The cytotoxic changes induced by tPA were prevented by post-stroke treatment with PROG. In bEnd.3 cells, tPA treatment caused an increase of ICAM-1 expression leading to brain endothelial cell activation and MIP-1a gene expression.



11

Fig. 6. Effect of progesterone (P4) on metalloproteinase (MMP)-3 and -9 after stroke in rats and hypoxia in BV2 microglia with tPA treatment. (A and B) Immunoblot image and quantitative data showing MMP-3 expression in the cortical area. MMP-3 expression is elevated in the ischemic group given tPA (5 mg/kg, intravenous) compared with the sham group. P4 treatment (8 mg/kg) reduced MMP-3 expression in cortex after delayed tPA treatment. Results are expressed as means ± s.e.m.; n = 6–7, *p < 0.05. (C) Representative fluorescence microscopy images showing colocalization of MMP-3 (green) and Iba-1-positive microglia (red) in the ischemic penumbra area. (D–F) Immunoblot image and quantitative data showing MMP-3/-9 expression in BV2 microglia. MMP-3 expression is significantly elevated under tPA (20 lg/mL) treatment with hypoxia compared with the sham and hypoxia alone group. P4 treatment (20 lmol/L) significantly attenuated tPA-induced increase in MMP-3 expression. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)


12


These inflammatory/destructive reactions were blocked by PROG treatment. We think that the beneficial effects of combining tPA with PROG could have potential clinical implications in the development of better neuroprotective therapies for stroke. Disclosures The authors have no conflicts of interest to disclose. Acknowledgments This work was supported by AHA 14POST20130024 to S.W., and additional partial support from philanthropic gifts from the Marcus Foundation and Allen and Company. The authors thank Leslie McCann for her editorial assistance. References An, J., Zhang, C., Polavarapu, R., Zhang, X., Zhang, X., Yepes, M., 2008. Tissue-type plasminogen activator and the low-density lipoprotein receptor-related protein induce Akt phosphorylation in the ischemic brain. Blood 112 (7), 2787–2794. Block, M.L., Hong, J.S., 2005. Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Prog. Neurobiol. 76 (2), 77–98. Bruce-Keller, A.J., Barger, S.W., Moss, N.I., Pham, J.T., Keller, J.N., Nath, A., 2001. Proinflammatory and pro-oxidant properties of the HIV protein Tat in a microglial cell line: attenuation by 17 beta-estradiol. J. Neurochem. 78 (6), 1315–1324. Cao, C., Lawrence, D.A., Li, Y., Von Arnim, C.A., Herz, J., Su, E.J., Makarova, A., Hyman, B.T., Strickland, D.K., Zhang, L., 2006. Endocytic receptor LRP together with tPA and PAI-1 coordinates Mac-1-dependent macrophage migration. EMBO J. 25 (9), 1860–1870. Cekic, M., Johnson, S.J., Bhatt, V.H., Stein, D.G., 2012. Progesterone treatment alters neurotrophin/proneurotrophin balance and receptor expression in rats with traumatic brain injury. Restor. Neurol. Neurosci. 28, 1–12. Cumming, G., 2012. Understanding the New Statistics, Effect Sizes, Confidence Intervals and Meta Analysis. Rutledge Press, London. David, S., Kroner, A., 2011. Repertoire of microglial and macrophage responses after spinal cord injury. Nat. Rev. Neurosci. 12 (7), 388–399. Endres, M., 2005. Statins and stroke. J. Cereb. Blood Flow Metab. 25 (9), 1093–1110. Gelderblom, M., Leypoldt, F., Steinbach, K., Behrens, D., Choe, C.U., Siler, D.A., Arumugam, T.V., Orthey, E., Gerloff, C., Tolosa, E., Magnus, T., 2009. Temporal and spatial dynamics of cerebral immune cell accumulation in stroke. Stroke 40 (5), 1849–1857. Godfrey, K.R., Tanswell, P., Bates, R.A., Chappell, M.J., Madden, F.N., 1998. Nonlinear pharmacokinetics of tissue-type plasminogen activator in three animal species: a comparison of mathematical models. Biopharm. Drug Dispos. 19 (2), 131–140. Grobmyer, S.R., Kuo, A., Orishimo, M., Okada, S.S., Cines, D.B., Barnathan, E.S., 1993. Determinants of binding and internalization of tissue-type plasminogen activator by human vascular smooth muscle and endothelial cells. J. Biol. Chem. 268 (18), 13291–13300. Hu, X., Li, P., Guo, Y., Wang, H., Leak, R.K., Chen, S., Gao, Y., Chen, J., 2012. Microglia/macrophage polarization dynamics reveal novel mechanism of injury expansion after focal cerebral ischemia. Stroke 43 (11), 3063–3070. I.M.S. Study Investigators, 2004. Combined intravenous and intra-arterial recanalization for acute ischemic stroke: the Interventional Management of Stroke Study. Stroke 35 (4), 904–911. Imai, F., Suzuki, H., Oda, J., Ninomiya, T., Ono, K., Sano, H., Sawada, M., 2007. Neuroprotective effect of exogenous microglia in global brain ischemia. J. Cereb. Blood Flow Metab. 27 (3), 488–500. Ishrat, T., Sayeed, I., Atif, F., Stein, D.G., 2009. Effects of progesterone administration on infarct volume and functional deficits following permanent focal cerebral ischemia in rats. Brain Res. 1257, 94–101. Ishrat, T., Sayeed, I., Atif, F., Hua, F., Stein, D.G., 2010. Progesterone and allopregnanolone attenuate blood–brain barrier dysfunction following permanent focal ischemia by regulating the expression of matrix metalloproteinases. Exp. Neurol. 226 (1), 183–190. Ishrat, T., Sayeed, I., Atif, F., Hua, F., Stein, D.G., 2012. Progesterone is neuroprotective against ischemic brain injury through its effects on the phosphoinositide 3-kinase/protein kinase B signaling pathway. Neuroscience 210, 442–450. Jin, R., Yang, G., Li, G., 2010. Inflammatory mechanisms in ischemic stroke: role of inflammatory cells. J. Leukoc. Biol. 87 (5), 779–789. Kigerl, K.A., Gensel, J.C., Ankeny, D.P., Alexander, J.K., Donnelly, D.J., Popovich, P.G., 2009. Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. J. Neurosci. 29 (43), 13435–13444. Kim, J.S., Gautam, S.C., Chopp, M., Zaloga, C., Jones, M.L., Ward, P.A., Welch, K.M., 1995. Expression of monocyte chemoattractant protein-1 and macrophage inflammatory protein-1 after focal cerebral ischemia in the rat. J. Neuroimmunol. 56 (2), 127–134.

Kim, N.G., Lee, H., Son, E., Kwon, O.Y., Park, J.Y., Park, J.H., Cho, G.J., Choi, W.S., Suk, K., 2003. Hypoxic induction of caspase-11/caspase-1/interleukin-1beta in brain microglia. Brain Res. Mol. Brain Res. 114 (2), 107–114. Kim, J.Y., Kawabori, M., Yenari, M.A., 2014. Innate inflammatory responses in stroke: mechanisms and potential therapeutic targets. Curr. Med. Chem. 21 (18), 2076– 2097. Kohler, E., Prentice, D.A., Bates, T.R., Hankey, G.J., Claxton, A., van Heerden, J., Blacker, D., 2013. Intravenous minocycline in acute stroke: a randomized, controlled pilot study and meta-analysis. Stroke 44 (9), 2493–2499. Lalancette-Hebert, M., Gowing, G., Simard, A., Weng, Y.C., Kriz, J., 2007. Selective ablation of proliferating microglial cells exacerbates ischemic injury in the brain. J. Neurosci. 27 (10), 2596–2605. Lawrence, T., Natoli, G., 2011. Transcriptional regulation of macrophage polarization: enabling diversity with identity. Nat. Rev. Immunol. 11 (11), 750–761. Lee, J.K., Tansey, M.G., 2013. Microglia isolation from adult mouse brain. Methods Mol. Biol. 1041, 17–23. Lees, K.R., Bluhmki, E., von Kummer, R., Brott, T.G., Toni, D., Grotta, J.C., Albers, G.W., Kaste, M., Marler, J.R., Hamilton, S.A., Tilley, B.C., Davis, S.M., Donnan, G.A., Hacke, W.ECASS, ATLANTIS, NINDS and EPITHET rt-PA Study Group, Allen, K., Mau, J., Meier, D., del Zoppo, G., De Silva, D.A., Butcher, K.S., Parsons, M.W., Barber, P.A., Levi, C., Bladin, C., Byrnes, G., 2010. Time to treatment with intravenous alteplase and outcome in stroke: an updated pooled analysis of ECASS, ATLANTIS, NINDS, and EPITHET trials. Lancet 375 (9727), 1695–1703. Liesz, A., Zhou, W., Mracsko, E., Karcher, S., Bauer, H., Schwarting, S., Sun, L., Bruder, D., Stegemann, S., Cerwenka, A., Sommer, C., Dalpke, A.H., Veltkamp, R., 2011. Inhibition of lymphocyte trafficking shields the brain against deleterious neuroinflammation after stroke. Brain 134 (Pt 3), 704–720. Loane, D.J., Byrnes, K.R., 2010. Role of microglia in neurotrauma. Neurotherapeutics 7 (4), 366–377. Luster, A.D., Alon, R., von Andrian, U.H., 2005. Immune cell migration in inflammation: present and future therapeutic targets. Nat. Immunol. 6 (12), 1182–1190. Manicone, A.M., McGuire, J.K., 2008. Matrix metalloproteinases as modulators of inflammation. Semin. Cell Dev. Biol. 19 (1), 34–41. Mikita, J., Dubourdieu-Cassagno, N., Deloire, M.S., Vekris, A., Biran, M., Raffard, G., Brochet, B., Canron, M.H., Franconi, J.M., Boiziau, C., Petry, K.G., 2011. Altered M1/M2 activation patterns of monocytes in severe relapsing experimental rat model of multiple sclerosis. Amelioration of clinical status by M2 activated monocyte administration. Mult. Scler. 17 (1), 2–15. Min, K.J., Pyo, H.K., Yang, M.S., Ji, K.A., Jou, I., Joe, E.H., 2004. Gangliosides activate microglia via protein kinase C and NADPH oxidase. Glia 48 (3), 197–206. Minagar, A., Shapshak, P., Fujimura, R., Ownby, R., Heyes, M., Eisdorfer, C., 2002. The role of macrophage/microglia and astrocytes in the pathogenesis of three neurologic disorders: HIV-associated dementia, Alzheimer disease, and multiple sclerosis. J. Neurol. Sci. 202 (1–2), 13–23. Moretti, A., Ferrari, F., Villa, R.F., 2014. Neuroprotection for ischaemic stroke: current status and challenges. Pharmacol. Ther. Murray, P.J., Wynn, T.A., 2011. Protective and pathogenic functions of macrophage subsets. Nat. Rev. Immunol. 11 (11), 723–737. Nagai, N., De Mol, M., Lijnen, H.R., Carmeliet, P., Collen, D., 1999. Role of plasminogen system components in focal cerebral ischemic infarction: a gene targeting and gene transfer study in mice. Circulation 99 (18), 2440–2444. Nicole, O., Docagne, F., Ali, C., Margaill, I., Carmeliet, P., MacKenzie, E.T., Vivien, D., Buisson, A., 2001. The proteolytic activity of tissue-plasminogen activator enhances NMDA receptor-mediated signaling. Nat. Med. 7 (1), 59–64. Nimmo, A.J., Vink, R., 2009. Recent patents in CNS drug discovery: the management of inflammation in the central nervous system. Recent Pat. CNS Drug Discov. 4 (2), 86–95. Nishi, T., Maier, C.M., Hayashi, T., Saito, A., Chan, P.H., 2005. Superoxide dismutase 1 overexpression reduces MCP-1 and MIP-1 alpha expression after transient focal cerebral ischemia. J. Cereb. Blood Flow Metab. 25 (10), 1312–1324. Orth, K., Willnow, T., Herz, J., Gething, M.J., Sambrook, J., 1994. Low density lipoprotein receptor-related protein is necessary for the internalization of both tissue-type plasminogen activator–inhibitor complexes and free tissue-type plasminogen activator. J. Biol. Chem. 269 (33), 21117–21122. Pineda, D., Ampurdanes, C., Medina, M.G., Serratosa, J., Tusell, J.M., Saura, J., Planas, A.M., Navarro, P., 2012. Tissue plasminogen activator induces microglial inflammation via a noncatalytic molecular mechanism involving activation of mitogen-activated protein kinases and Akt signaling pathways and AnnexinA2 and Galectin-1 receptors. Glia 60 (4), 526–540. Ponomarev, E.D., Maresz, K., Tan, Y., Dittel, B.N., 2007. CNS-derived interleukin-4 is essential for the regulation of autoimmune inflammation and induces a state of alternative activation in microglial cells. J. Neurosci. 27 (40), 10714–10721. Riazi, K., Galic, M.A., Pittman, Q.J., 2010. Contributions of peripheral inflammation to seizure susceptibility: cytokines and brain excitability. Epilepsy Res. 89 (1), 34– 42. Rossi, B., Angiari, S., Zenaro, E., Budui, S.L., Constantin, G., 2011. Vascular inflammation in central nervous system diseases: adhesion receptors controlling leukocyte–endothelial interactions. J. Leukoc. Biol. 89 (4), 539–556. Ruffell, D., Mourkioti, F., Gambardella, A., Kirstetter, P., Lopez, R.G., Rosenthal, N., Nerlov, C., 2009. A CREB-C/EBPbeta cascade induces M2 macrophage-specific gene expression and promotes muscle injury repair. Proc. Natl. Acad. Sci. U.S.A. 106 (41), 17475–17480. Saver, J.L., Fonarow, G.C., Smith, E.E., Reeves, M.J., Grau-Sepulveda, M.V., Pan, W., Olson, D.M., Hernandez, A.F., Peterson, E.D., Schwamm, L.H., 2013. Time to


S. Won et al. / Brain, Behavior, and Immunity xxx (2015) xxx–xxx treatment with intravenous tissue plasminogen activator and outcome from acute ischemic stroke. JAMA 309 (23), 2480–2488. Siao, C.J., Tsirka, S.E., 2002. Tissue plasminogen activator mediates microglial activation via its finger domain through annexin II. J. Neurosci. 22 (9), 3352– 3358. Siao, C.J., Fernandez, S.R., Tsirka, S.E., 2003. Cell type-specific roles for tissue plasminogen activator released by neurons or microglia after excitotoxic injury. J. Neurosci. 23 (8), 3234–3242. Skuljec, J., Sun, H., Pul, R., Benardais, K., Ragancokova, D., Moharregh-Khiabani, D., Kotsiari, A., Trebst, C., Stangel, M., 2011. CCL5 induces a pro-inflammatory profile in microglia in vitro. Cell. Immunol. 270 (2), 164–171. Suh, H.S., Zhao, M.L., Choi, N., Belbin, T.J., Brosnan, C.F., Lee, S.C., 2009. TLR3 and TLR4 are innate antiviral immune receptors in human microglia: role of IRF3 in modulating antiviral and inflammatory response in the CNS. Virology 392 (2), 246–259. Suzuki, Y., Nagai, N., Umemura, K., Collen, D., Lijnen, H.R., 2007. Stromelysin-1 (MMP-3) is critical for intracranial bleeding after t-PA treatment of stroke in mice. J. Thromb. Haemost. 5 (8), 1732–1739. Wang, Y.F., Tsirka, S.E., Strickland, S., Stieg, P.E., Soriano, S.G., Lipton, S.A., 1998. Tissue plasminogen activator (tPA) increases neuronal damage after focal cerebral ischemia in wild-type and tPA-deficient mice. Nat. Med. 4 (2), 228– 231. Wang, H.K., Park, U.J., Kim, S.Y., Lee, J.H., Kim, S.U., Gwag, B.J., Lee, Y.B., 2008. Free radical production in CA1 neurons induces MIP-1alpha expression, microglia recruitment, and delayed neuronal death after transient forebrain ischemia. J. Neurosci. 28 (7), 1721–1727. Wang, G., Zhang, J., Hu, X., Zhang, L., Mao, L., Jiang, X., Liou, A.K., Leak, R.K., Gao, Y., Chen, J., 2013. Microglia/macrophage polarization dynamics in white matter after traumatic brain injury. J. Cereb. Blood Flow Metab. 33 (12), 1864–1874. Weber, C., Koenen, R.R., 2006. Fine-tuning leukocyte responses: towards a chemokine ‘interactome’. Trends Immunol. 27 (6), 268–273.

13

Won, S., Lee, J.H., Wali, B., Stein, D.G., Sayeed, I., 2014. Progesterone attenuates hemorrhagic transformation after delayed tPA treatment in an experimental model of stroke in rats: involvement of the VEGF–MMP pathway. J. Cereb. Blood Flow Metab. 34 (1), 72–80. Woo, M.S., Park, J.S., Choi, I.Y., Kim, W.K., Kim, H.S., 2008. Inhibition of MMP-3 or -9 suppresses lipopolysaccharide-induced expression of proinflammatory cytokines and iNOS in microglia. J. Neurochem. 106 (2), 770–780. Wu, F., Nicholson, A.D., Haile, W.B., Torre, E., An, J., Chen, C., Lee, A.K., Duong, D.M., Dammer, E.B., Seyfried, N.T., Tong, F.C., Votaw, J.R., Yepes, M., 2013. Tissue-type plasminogen activator mediates neuronal detection and adaptation to metabolic stress. J. Cereb. Blood Flow Metab. 33 (11), 1761–1769. Wu, F., Catano, M., Echeverry, R., Torre, E., Haile, W.B., An, J., Chen, C., Cheng, L., Nicholson, A., Tong, F.C., Park, J., Yepes, M., 2014. Urokinase-type plasminogen activator promotes dendritic spine recovery and improves neurological outcome following ischemic stroke. J. Neurosci. 34 (43), 14219–14232. Yepes, M., Roussel, B.D., Ali, C., Vivien, D., 2009. Tissue-type plasminogen activator in the ischemic brain: more than a thrombolytic. Trends Neurosci. 32 (1), 48– 55. Young, A.M., Karri, S.K., Ogilvy, C.S., 2012. Exploring the use of estrogen & progesterone replacement therapy in subarachnoid hemorrhage. Curr. Drug Saf. 7 (3), 202–206. Zaremba, J., Ilkowski, J., Losy, J., 2006. Serial measurements of levels of the chemokines CCL2, CCL3 and CCL5 in serum of patients with acute ischaemic stroke. Folia Neuropathol. 44 (4), 282–289. Zhang, X., Polavarapu, R., She, H., Mao, Z., Yepes, M., 2007. Tissue-type plasminogen activator and the low-density lipoprotein receptor-related protein mediate cerebral ischemia-induced nuclear factor-kappaB pathway activation. Am. J. Pathol. 171 (4), 1281–1290. Zhu, H., Fan, X., Yu, Z., Liu, J., Murata, Y., Lu, J., Zhao, S., Hajjar, K.A., Lo, E.H., Wang, X., 2010. Annexin A2 combined with low-dose tPA improves thrombolytic therapy in a rat model of focal embolic stroke. J. Cereb. Blood Flow Metab. 30 (6), 1137– 1146.


Macrophage-Microglia Networks Drive M1 Microglia Polarization After Mycobacterium Infection.

Macrophage Polarization After Experimental Intracerebral Hemorrhage.

Macrophage Polarization.

Macrophage M1 and M2 Polarization in Theiler's Murine Encephalomyelitis.

M2 Macrophage Polarization and Neutrophil Recruitment.

M2 Macrophage Polarization and Neutrophil Recruitment.

NMAAP1 Expressed in BCG-Activated Macrophage Promotes M1 Macrophage Polarization.

macrophage polarization.

Molecular mechanisms that influence the macrophage m1-m2 polarization balance.

Macrophage M2 Polarization and Long-Term Recovery After Cerebral Ischemia.

Inflammatory cell recruitment after experimental thromboembolic stroke in rats.

Macrophage Polarization by miR-124 after Focal Cerebral Ischemia.

Redox regulation of NF-κB p50 and M1 polarization in microglia.

M2 Phenotype Changes in rd1 Mouse Model of Retinal Degeneration.

Secreted protein acidic and rich in cysteine facilitates age-related cardiac inflammation and macrophage M1 polarization.

M2 polarization in rats.

Aurora kinase a regulates m1 macrophage polarization and plays a role in experimental autoimmune encephalomyelitis.

Macrophage Polarization in Rat Model of Neuropathy.

Iron Reduces M1 Macrophage Polarization in RAW264.7 Macrophages Associated with Inhibition of STAT1.

Hypoxic Injury.

macrophage polarization.

High-density lipoprotein inhibits human M1 macrophage polarization through redistribution of caveolin-1.

ABIN1 contributes to inefficient M1 macrophage polarization during Hepatitis C virus infection.

AGEs Induced Autophagy Impairs Cutaneous Wound Healing via Stimulating Macrophage Polarization to M1 in Diabetes.