Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale View Article Online
PAPER
View Journal | View Issue
Cite this: Nanoscale, 2014, 6, 6959
Maintaining the pluripotency of mouse embryonic stem cells on gold nanoparticle layers with nanoscale but not microscale surface roughness† Zhonglin Lyu, Hongwei Wang, Yanyun Wang, Kaiguo Ding, Huan Liu, Lin Yuan,* Xiujuan Shi, Mengmeng Wang, Yanwei Wang and Hong Chen* Efficient control of the self-renewal and pluripotency maintenance of embryonic stem cell (ESC) is a prerequisite for translating stem cell technologies to clinical applications. Surface topography is one of the most important factors that regulates cell behaviors. In the present study, micro/nano topographical structures composed of a gold nanoparticle layer (GNPL) with nano-, sub-micro-, and microscale surface roughnesses were used to study the roles of these structures in regulating the behaviors of mouse
ESCs
(mESCs)
under
feeder-free
conditions.
The
distinctive
results
from
Oct-4
immunofluorescence staining and quantitative real-time polymerase chain reaction (qPCR) demonstrate that nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) are conducive to the long-term maintenance of mESC pluripotency, while high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm) result in a significant loss of mESC pluripotency and a faster undirectional differentiation, particularly in long-term culture. Moreover, the likely signalling cascades engaged in the topological sensing of mESCs were investigated and their role in affecting the maintenance of the long-term cell pluripotency was discussed by analyzing the expression of proteins Received 20th March 2014 Accepted 9th April 2014
related to E-cadherin mediated cell–cell adhesions and integrin-mediated focal adhesions (FAs). Additionally, the conclusions from MTT, cell morphology staining and alkaline phosphatase (ALP) activity
DOI: 10.1039/c4nr01540a
assays show that the surface roughness can provide a potent regulatory signal for various mESC
www.rsc.org/nanoscale
behaviors, including cell attachment, proliferation and osteoinduction.
Introduction Embryonic stem cells (ESCs) derived from preimplantation embryos have the potential to differentiate into any somatic cell type that is derived from the three germ layers, the ectoderm, mesoderm and endoderm; therefore, ESCs provide a good opportunity for stem cell-based regenerative therapies and the development of drug discovery platforms.1–7 The ability to control the pluripotency of ESCs during long-term culture and still induce differentiation into multiple lineages is necessary to realize the potential clinical and industrial applications of ESCs. Previous work has demonstrated that biological cues, such as growth factors, hormones, small chemicals, and bioactive molecules, can determine stem cell pluripotency and differentiation.8,9 In addition, physical cues, such as the properties of
The Key Lab of Health Chemistry and Molecular Diagnosis of Suzhou, Department of Polymer Science and Engineering, College of Chemistry, Chemical Engineering and Materials Science, Soochow University, Suzhou 215123, P. R. China. E-mail: yuanl@ suda.edu.cn; [email protected]; Fax: +86-512-65880583; Tel: +86-512-65880827 † Electronic supplementary 10.1039/c4nr01540a
information
(ESI)
This journal is © The Royal Society of Chemistry 2014
available.
See
DOI:
the surface where cells are cultured, including topography,10 stiffness1,11,12 and wettability,13 directly inuence the selfrenewal and pluripotency maintenance of ESCs. Of these factors, precisely controlled substrate nano/micro topography, independent of substrate chemistry, has been reported to play a crucial role in affecting the attachment, proliferation, pluripotency and subsequent differentiation of stem cells.10,14–18 The inuence of surface nanoscale features on ESC functions has attracted increasing attention because these features can make the surface resemble the natural extracellular matrix (ECM) in which cells reside and interact.10,19,20 Recently, Chen et al. fabricated patterned nanorough glass substrates with surface roughnesses of 70 nm and 150 nm using photolithography followed by reactive ion etching techniques and investigated the ability of the surface nanoscale roughness to regulate the pluripotency of human ESCs (hESCs). The researchers found that culturing cells on a smooth glass surface was conducive to the self-renewal and pluripotency maintenance of hESCs in long-term culture; by contrast, the nanorough surfaces resulted in the spontaneous differentiation of a large portion of the hESCs, which thus lost their pluripotency.10 However, the inuence of surface sub-microscale and microscale roughness on the maintenance of ESC pluripotency
Nanoscale, 2014, 6, 6959–6969 | 6959
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
remains unclear and has been largely ignored to date. Actually, among the research reports on non-stem cells, several reports have shown that surface sub-micro- and microscale roughness, with feature sizes comparable to those of resorption pits and cell dimensions, can modulate cell behaviours and functions. For example, such a surface roughness has enhanced osteoblast differentiation and the local factor production of osteoblast-like cells in vitro,21,22 increased the bone-to-implant contact in vivo23,24 and improved the clinical rates of wound healing.25,26 Therefore, to better understand the ability of surface topography to control the pluripotency of ESCs, the effects of surface sub-micro- and microscale roughness must be investigated. In the present study, we attempted to determine the optimal surface roughness for maintaining mESC pluripotency during long-term culture under feeder-free conditions by preparing gold nanoparticle layers (GNPLs) with nano-, sub-micro- and microscale surface roughness via a convenient chemical plating method. The relationship between the surface roughness and mESC pluripotency was described. Besides, the likely signalling cascades engaged in the topological sensing of mESCs cultured on surfaces with various roughnesses were investigated. Furthermore, we studied the role of the surface roughness in regulating the attachment, proliferation and osteoinduction behaviors of mESCs. The resulting ndings are of fundamental interest and have important consequences for designing a synthetic cell microenvironment to control and direct ESC behaviors.
Experimental Materials Silicon wafers (0.53 mm thick, polished on both sides) were coated with a chromium adhesion layer followed by a layer of gold (approximately 100 nm) and diced into 0.5 cm 0.5 cm pieces. Hydrogen tetrachloroaurate hydrate (HAuCl4$4H2O), glucose and b-glycerin sodium phosphate were from Sinopharm Chemical Reagent Co. (Shanghai, China). Potassium hydrogen carbonate (AR) was from Shanghai Zhanyun Chemical Co. (Shanghai, China). b-Cysteamine (C2H7NS, 95%) was from Aladdin Reagent Co. (Shanghai, China). Bovine serum albumin (BSA), paraformaldehyde, gelatin, dexamethasone, Triton X-100 and vitamin C were from Sigma-Aldrich. MTT (3-(4,5-dimethyl2-thiazol)-2,5-diphenyl-2H-tetrazolium bromide, 98%) was from Amresco. PCR primers were from Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China). DAPI (40 ,6-diamidino-2phenylindole) and Alexa Fluor 488 phalloidin were from Invitrogen. All other solvents, which were of analytical reagent grade, were from Sinopharm Chemical Reagent Co. (Shanghai, China). All aqueous solutions were prepared in 18.2 MU cm puried water from a Milli-Q water purication system (Millipore, Bedford, MA, USA). Preparation of gold nanoparticle layers (GNPLs) Gold-coated silicon slides (0.5 cm 0.5 cm) were placed in freshly prepared Piranha solution (H2SO4–30% H2O2 ¼ 7 : 3 v/v) to remove organic impurities. The slides were then rinsed with
6960 | Nanoscale, 2014, 6, 6959–6969
Paper
deionized water several times until the pH of the wash became neutral. Aer being dried in a stream of nitrogen, the gold slides were immersed in a solution of b-cysteamine in ethanol (20 mmol L1) overnight at room temperature. The aminated surfaces were then rinsed with ethanol (at least 3 times) and dried in a stream of nitrogen. The GNPLs were prepared as described by Zhou et al.27 Briey, the aminated surfaces were placed in the wells of a 48-well plate; then, 80, 160, 300, 500 or 800 mL plating solutions (12 mM HAuCl4$4H2O, 0.5 M KHCO3, and 25 mM glucose) containing 0.96, 1.92, 3.60, 6.00 or 9.60 mmol hydrogen tetrachloroaurate acid, respectively, were added to each well and incubated at 37 C for 3 h to form gold nanoparticle layers. The slides were removed from the solution, rinsed with deionized water, and dried in a stream of nitrogen. The nal GNPLs were termed GL-1, GL-2, GL-3, GL-4 and GL-5 for the increasing volumes of plating solution. Surface characterization The surface topography of the GNPLs was investigated by scanning electron microscopy (SEM, S-4700, Hitachi) and atomic force microscopy (AFM, Bruker, Santa Barbara, CA). The surface roughnesses of GL-1 to GL-5 were measured by using a Multi-Mode Nanoscope V AFM with a V-shaped antimony N-doped Si cantilever RTESP (Bruker, nominal spring constant: 20–80 N m1, f0: 312–333 kHz) in tapping mode. The evaluation area for each sample ranged from 2 2 mm2 to 20 20 mm2. The roughness parameters (i.e., the arithmetic mean value (Ra) and the root-mean-square average (Rq)) were obtained directly from the NanoScope Analysis 14 soware (Bruker) with zerodegree polynomial tting based on the multiscale roughness parameter evaluation method described by Bigerelle et al.28 The static water contact angle was measured with an SL200C optical contact angle meter (USA Kino Industry Co., Ltd.) using the sessile drop method at room temperature. Culture and growth of mouse embryonic stem cells (mESCs) MESCs (R1/E, Stem Cell Bank, Chinese Academy of Sciences) were cultivated on a feeder layer of mitomycin C-inactivated mouse embryonic broblasts (mEFs, ICR MEF, Stem Cell Bank, Chinese Academy of Sciences) with ESC maintenance media consisting of Dulbecco's modied Eagle's media with high glucose but without L-glutamine (DMEM; Thermo Hyclone) and were supplemented with 10% fetal bovine serum (FBS), 100 U mL1 penicillin (Genview), 100 mg mL1 streptomycin (Solarbio), 2 mM L-glutamine (Invitrogen), 0.1 mM non-essential amino acids (Gibco), 0.1 mM b-mercaptoethanol (Amresco) and 1000 U mL1 leukemia inhibitory factor (LIF; Chemicon) at 37 C in a humidied 5% (v/v) CO2 incubator (Eppendorf Galaxy 170R). Aer the mESCs were cultured in a gelatin-coated cell culture ask and passaged twice to remove mEFs, the mESCs were dissociated and seeded onto Au and GNPLs at a density of 2 104 cells per cm2. For osteoinduction, the cells grown on Au and GNPLs were transferred to osteoinduction media aer being cultured in ESC media for 3 days. The osteoinduction media consisted of Dulbecco's modied Eagle's media with high glucose but without
This journal is © The Royal Society of Chemistry 2014
View Article Online
Paper
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
L-glutamine (DMEM) 1
and was supplemented with 10% FBS, 100 U mL penicillin, 100 mg mL1 streptomycin, 2 mM L-glutamine, 0.1 mM non-essential amino acids, 0.1 mM b-mercaptoethanol, 1 mM dexamethasone, 50 mg mL1 ascorbic acid and 10 mM b-glycerin sodium phosphate.29 An MTT-based assay was performed on the cells seeded on Au and GNPLs to characterize the cell growth. Briey, the cells were seeded on the substrates at a density of 8 103 cells per cm2 and incubated for 1, 3 and 7 days in ESC media with changing the medium every other day. At the end of days 1, 3 and 7, the substrates were transferred into a 96-well culture plate (Costar), and the media were replaced by 200 mL fresh media, followed by the addition of 20 mL MTT (5 mg mL1). The cells were then incubated for 4 h at 37 C in a humidied 5% CO2 (v/v) incubator. The wells were drained of the media, the formazan crystals that formed due to the interaction of the MTT solution with the live cells were dissolved in 220 mL DMSO, and the absorbance of the resulting solution was read at 490 nm using a microplate reader (Thermo Fisher Scientic Inc.).
Immunocytochemistry The mESCs cultured on Au and the GNPLs in ESC media aer certain period of time were rinsed in situ in PBS, xed for 10 min in 4% paraformaldehyde at room temperature, and washed three times for 5 min in PBS. The cells were permeabilized with 0.1% Triton X-100 for 5 min. Aer being washed twice with PBS and incubated in blocking buffer (3% BSA in PBS) for 30–60 min, the cells were then incubated with primary antibodies Oct4 (Sangon Shanghai, China), E-cadherin, b-catenin and vinculin (all from Boster Wuhan, China) in blocking buffer overnight at 4 C and rinsed in PBS three times for 5 min. Next, the cells were incubated for 1 h at room temperature with either TRITC or FITC conjugated secondary antibodies (both from Boster Wuhan, China), followed by three more 5 min washes in PBS. The cells were then counterstained with Alexa Fluor 488 phalloidin in PBS for 15 min or DAPI (0.5 mg mL1) for 5 min in PBS. Images were captured using an Olympus IX71 uorescence microscope. The images were overlapped using Image-Pro Plus 6.0 soware (public soware from Media Cybernetics, http:// www.mediacy.com/).
Cell morphology aer osteoinduction Aer being cultured in osteoinduction media for 3 and 7 days, the cells were washed with warm PBS, xed for 10 min in 4% paraformaldehyde at room temperature, and washed three times for 5 min in PBS. The cells were then permeabilized with 0.1% Triton X-100 for 5 min and blocked with 1% BSA in PBS for 20 min, followed by 20 min of uorescence staining with Alexa Fluor 488 phalloidin. Aer three more 5 min washes in PBS, the cells were counterstained with DAPI (0.5 mg mL1) for 5 min. Images were captured using an Olympus IX71 uorescence microscope. The images were overlapped using Image-Pro Plus 6.0 soware.
This journal is © The Royal Society of Chemistry 2014
Nanoscale
Measurement of alkaline phosphatase (ALP) activity The ALP activity of the cells seeded on each surface in osteoinduction media was measured on days 3 and 7. At each time point, the cells cultured on all surfaces were rinsed twice with cold PBS and lysed in lysis buffer containing 0.1% Triton X-100. Aer centrifugation at 4 C for 10 min, the upper aqueous phase was used to measure the ALP activity. The ALP activity was quantied with an alkaline phosphatase assay kit according to the manufacturer's protocol (Beyotime Biotechnology, China). The absorbance was read at 405 nm using a microplate reader (Thermo Fisher Scientic Inc.) to determine the enzyme concentration. The total protein content was determined using the Coomassie Brilliant Blue method,30 and the ALP activity was calculated according to a formula provided by the manufacturer (Beyotime Biotechnology, China) and expressed as nmol per assay time per mg protein. Quantitative real-time polymerase chain reaction (qPCR) and reverse transcription PCR (RT-PCR) The total RNA was extracted from the cultured cells using an RNAsimple total RNA kit according to the manufacturer's instructions (Tiangen Biotech Co., Ltd. [Beijing]). Then, the isolated RNA sample was reversely transcribed for rst-strand cDNA synthesis (RevertAid First Strand cDNA Synthesis Kit, Thermo Scientic) using oligo (dT) as a reverse transcription primer. For the qPCR, the Oct-4 gene was selected to assess the maintenance of pluripotency in the mESCs aer 7 days of culture. Oct-4 is expressed in the undifferentiated mESCs. Real-time qPCR was performed in a real-time PCR machine (StepOne Plus realtime PCR system, Applied Biosystems) using a Fast SYBR Green Master Mix (Applied Biosystems) to quantify the levels of mRNA expression of 2 selected genes in the mESCs. The primer details are summarized as follows: GAPDH-f 50 -GCACAGTCAAGGCCGA GAAT-30 , GAPDH-r 50 -GCCTTTCCATGGTGGTGAA-30 (60 C, 151 bps); Oct-4-f 50 -GGCGTTCTCTTTGGAAAGGT-30 , Oct-4-r 50 TCTCATTGTTGTCGGCTTCCT-30 (60 C, 112 bps). The threshold cycle (Ct) value was calculated from the amplication plots. The DCt value for each sample was obtained by subtracting the Ct values of a housekeeping gene, glyceraldehyde phosphate dehydrogenase (GAPDH). Then, the DDCt value of the GNPL samples was normalized by the DCt value of the cells on the Au samples and was converted into relative gene expression by raising 2 to the DDCt power.31 Each sample was analyzed in triplicate. For the RT-PCR, different germ layer (including endoderm: Sox7 and Foxa2; mesoderm: Flk1 and Branchyury; ectoderm: Pax6 and Fgf5) marker genes were selected to investigate the possible differentiation directions of the mESCs on GL-5 with microscale surface roughness aer culture of 7 days. The primer details are as follows: Sox7-f 50 -GAGCTAAGCAAGATGCTAGG-30 , Sox7-r 50 TACTTGTAGTTGGGGTGGTC-30 (55 C, 122 bps); Foxa2-f 50 ACTGGAGCAGCTACTACG-30 , Foxa2-r 50 -CCCACATAGGATGA CATG-30 (55 C, 169 bps); Flk1-f 50 - CACCTGGCACTCTCCACCTTC30 , Flk1-r 50 -GATTTCATCCCACTACCGAAAG-30 (60 C, 239 bps); Branchyury-f 50 - GACTTCGTGACGGCTGACAA-30 , Branchyury-r 50 -CGAGTCTGGGTGGATGTAG-30 (59 C, 110 bps); Pax6-f
Nanoscale, 2014, 6, 6959–6969 | 6961
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
50 -CTGGAGAAAGAGTTTGAGAGG-30 , Pax6-r 50 -CTGCTGCTGA TAGGAATGTG-30 (60 C, 196 bps); Fgf5-f 50 -ACAAGAGAGGGAAAG CCAAGAG-30 , Fgf5-r 50 -GAACAGTGACGGTGAAGGAAAG-30 (60 C, 122 bps). RT-PCR amplication was performed using a standard procedure with Taq DNA Polymerase (Thermo Scientic) with denaturation at 95 C for 30 s, annealing at 55–60 C for 30 s according to melting temperature of each primer, and extension at 72 C for 45 s. The number of cycles was 40. A nal extension of 10 min was also performed. Following RT-PCR, samples were run on 1.5% agarose gel labelled with ethidium bromide solution. The gels were then imaged using a EC3 Imaging System (UVP LLC, Upland, CA, USA). Statistical methods Every independent experiment was duplicated at least three times, and the results were represented as the mean standard deviation (SD). P-values less than 0.05 were considered to be signicant.
Results and discussion Sample characterization SEM and surface roughness. Previous studies have already demonstrated that gold nanoparticle layers (GNPLs) can be easily prepared using a chemical gold plating method, and their surface roughnesses can be regulated by adjusting the mole number of hydrogen tetrachloroaurate acid (from 1.8 mmol to 6.0 mmol) in the gold plating solution.27,32,33 To investigate the biological effects of the GNPL surface on a larger surface roughness scale in this study, we increased the mole number of hydrogen tetrachloroaurate acid to 9.6 mmol in the gold plating solution. Five types of GNPL-modied Au surfaces were fabricated and termed GL-1, GL-2, GL-3, GL-4 and GL-5 in the order of increasing hydrogen tetrachloroaurate mole number. Aer the deposition and aggregation of gold nanoparticles, the GNPLs actually adopt the morphology of three-dimensional micro- and nanosized structures, which consist of gold nanoparticle aggregates with different sizes. Besides, these structures became more densely aggregated with the increment of the gold plating solution which resulted in the GNPLs with a rougher surface morphology (see ESI Fig. 1†); this morphology completely differs from the smooth Au surface (see Fig. 1A and B). AFM was used to further characterize the surface topography of the different GNPLs and the roughness versus evaluation
SEM images of an Au surface and a GNPL prepared by chemical gold plating. (A) Au and (B) GNPL. Bar, 1 mm.
Fig. 1
6962 | Nanoscale, 2014, 6, 6959–6969
Paper
length plot for GL-1, GL-2, GL-3, GL-4 and GL-5 was acquired using different scanning scales of 2 2 mm2 to 20 20 mm2 (Fig. 2A–E). The results suggest that for each sample, both roughness parameters (Rq and Ra) increase with the evaluation length and reached a plateau before 20 mm. Fig. 2F shows the surface roughness parameters Ra and Rq for GL-1, GL-2, GL-3, GL-4 and GL-5 at the evaluation length of 20 mm. The Ra was 58, 270, 433, 710 and 969 nm for GL-1, GL-2, GL-3, GL-4 and GL-5, respectively, and the Rq was 106, 392, 573, 920 and 1205 nm for GL-1, GL-2, GL-3, GL-4 and GL-5, respectively. Water contact angle. The wettability of surfaces with micro/ nanosized topography is usually quite different from that of ordinary plane surfaces; the former exhibit a super hydrophilic or hydrophobic state.34 The GNPLs we prepared consist of gold nanoparticle aggregates and have three-dimensional micro/ nanosized structures. To determine the wettability of these surfaces, a static water contact angle test was performed on Au and GNPLs at room temperature aer the newly fabricated samples were blown dry under a nitrogen stream. As shown in Fig. 3, the water contact angle of the smooth Au surface was 55.4 5.0 . In contrast, GL-1 and GL-2, whose surface roughnesses are less than 392 nm, were hydrophilic with water contact angles of 36.4 2.2 and 29.2. 1.2 , respectively. GL-3, GL-4 and GL-5, which have surface roughnesses greater than 573 nm, were super hydrophilic with water contact angles of 9.8 2.3 , 10.5 1.3 and 5.6 0.8 , respectively. Our results indicate that as the mole number of hydrogen tetrachloroaurate acid in the gold plating solution increases, the GNPLs become more hydrophilic; this nding is consistent with the conclusions of other researchers using gold nanoparticle aggregates that were deposited on a PDMS substrate.35 Cell attachment and proliferation. The MTT test is a common tool for measuring cell viability.36–39 The growth of mESCs seeded on different surfaces aer 1, 3 and 7 days was monitored using an MTT test. The absorbance at 490 nm is proportional to the number of viable cells for a certain range of absorbances.40 As shown in Fig. 4, the OD value of cells on the Au surface is the highest (approximately 0.1) compared with that on all GNPLs (approximately 0.04) aer 1 day, indicating that the number of cells that adhered to the GNPLs is measurably lower than that adhered to the Au surface. Moreover, no obvious difference was observed in the number of adhered cells among all GNPLs with their various surface roughnesses. These results indicate that rough GNPLs decrease the attachment of mESCs; we quantied the cell proliferation rate, dened as the increase in the ratio of the OD values on days 3 and 7 to that on day 1, to study the inuence of the surface roughness on mESC proliferation. Aer 3 days, the number of cells on the Au surface was still the highest, although the number of cells on the GNPLs also increased measurably, as indicated by their OD values. However, a faster cell proliferation rate was observed on GL-1 (Rq of 106 nm) with a proliferation ratio of approximately 1.3; in contrast, for the other rough GNPLs and the Au surface, the proliferation ratios were approximately 0.5 and 0.4, respectively. These results demonstrate the tendency for nanorough GNPLs to increase the cell proliferation rate. Aer 7 days, this tendency
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Paper
Nanoscale
(A–E) Plot of roughness vs. evaluation length for GL-1, GL-2, GL-3, GL-4 and GL-5 to describe the topography and provide the roughness parameters Rq and Ra using AFM. For each GNPL sample, the evaluation length was 2, 5, 8, 10, 12, 15, 18 and 20 mm, respectively; (F) surface roughness parameters Rq and Ra for Au, GL-1, GL-2, GL-3, GL-4 and GL-5. The evaluation length was 20 mm. Data are the mean SD (n ¼ 3). Fig. 2
Fig. 3
Static water contact angle of Au and GNPLs at room temperature. Data are the mean SD (n ¼ 3).
Fig. 4 The growth of viable cells that were cultured on various surfaces for 1, 3 and 7 days was determined using an MTT test by measuring the absorbance at 490 nm. Data are the mean SD (n ¼ 3).
became more noticeable. The proliferation rate on GL-1 and GL2, whose surface roughnesses are less than 392 nm, was approximately 3.4; in contrast, the rate on Au was approximately 1.6, and the rate was approximately 1.4 on GL-3, GL-4 and GL-5, whose surface roughnesses are greater than 573 nm. Together, these results thus conrmed that although the rough GNPL decreased the attachment of mESCs, a GNPL with suitable roughness (less than 392 nm) provides better support for cell proliferation than does the smooth Au surface.
Oct-4 immunouorescence staining. MESCs are pluripotent, and they can successfully express the POU-domain transcription factor encoded by the Oct-4 gene, which is essential for maintaining ESCs in an undifferentiated state. Decreases in Oct-4 immunoreactivity are associated with the onset of ESC differentiation.13,41,42 Therefore, the Oct-4 immunoreactivity of mESCs grown on Au and the GNPLs with different surface roughnesses were examined to monitor the surface-induced alterations to the pluripotency status.
This journal is © The Royal Society of Chemistry 2014
Nanoscale, 2014, 6, 6959–6969 | 6963
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
Paper
Fig. 5 Immunofluorescence images of mESCs cultured for 3 and 7 days on various surfaces. The cells were co-stained for Oct-4 (red) and nuclei (DAPI; blue). Undifferentiated mESCs were positively immuno-labeled for Oct-4 and were stained red. DAPI (blue counterstain) labels all cells in the population; therefore, differentiated cell types appear to be blue. (A) Au, GL-1, GL-2; (B) GL-3, GL-4, and GL-5. Bar, 100 mm.
As shown in Fig. 5, the majority of mESCs that were seeded on Au, GL-1 and GL-2, whose surface roughnesses are less than 392 nm, retained their stemness aer being cultured for 3 and 7 days, as evidenced by their positive expression of the Oct-4 gene. In contrast, the pluripotency of the cells cultured on GL-3, GL-4 and GL-5, whose surface roughnesses are greater than 573 nm, started to decrease on day 3 (see ESI Fig. 2A†). Moreover, the loss of pluripotency was more signicant aer 7 days, particularly on GL-5, which has a microscale surface roughness. The results indicate that the smooth Au and GNPLs with low submicroscale surface roughness (Rq less than 392 nm) can provide good support for the long-term maintenance of mESC pluripotency. However, GNPLs with high sub-microscale surface roughness (Rq greater than 573 nm) and microscale surface roughness (Rq of 1205 nm) measurably decrease the long-term pluripotency of mESCs and accelerate their spontaneous differentiation rate, especially on microrough GNPLs, despite the presence of LIF in the culture media. Analysis of Oct-4 expression by qPCR and possible differentiation directions of the cells cultured on microrough GL-5 by RT-PCR. The mESCs cultured on Au, GL-1, GL-3 and GL-5 with
6964 | Nanoscale, 2014, 6, 6959–6969
representative surface roughnesses aer 7 days were chosen for quantitative characterization of the relative Oct-4 gene expression level using qPCR, and the results are shown in Fig. 6. The percentage of Oct-4 gene expression measurably decreased on GL-3 (73%) and GL-5 (52%), whose surface roughnesses are greater than 573 nm, compared with that on the control Au substrate. The Oct-4 expression level was particularly decreased on GL-5, which has the highest surface roughness, by approximately 50%. In contrast, no signicant loss of Oct-4 gene expression was observed on GL-1 (84%), whose surface roughness is less than 392 nm. The qPCR results are consistent with the conclusions from the Oct-4 immunouorescence staining experiments. We can conclude that GNPLs with nanoscale and low sub-microscale surface roughness (Rq less than 392 nm) provide good support for the long-term pluripotency of mESCs in the absence of feeder cells, whereas GNPLs with high sub-microscale and microscale surface roughness (Rq greater than 573 nm) lead to faster spontaneous differentiation and signicant loss of mESC pluripotency in long-term culture. RT-PCR was carried out to investigate the possible differentiation directions of mESCs on the microrough GL-5 (Rq of
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Paper
Fig. 6 qPCR analysis of Oct-4 gene expression in mESCs cultured on different surfaces after 7 days. ***p < 0.001. Data are the mean SD (n ¼ 3).
1205 nm) aer culture of 7 days. The chosen germ layer markers are as follows: endoderm: Sox7 and Foxa2; mesoderm: Flk1 and Brachyury; ectoderm: Pax6 and Fgf5. The results showed that both the expression of Brachyury (endoderm) and Fgf5 (ectoderm) were detected, which indicated the spontaneous differentiation of cells cultured on the microrough GL-5 was undirectional (see ESI Fig. 2B†). Topological sensing by E-cadherin mediated cell–cell adhesions in mESCs cultured on various surfaces. The strong cell– cell adhesions within ESC colonies are mediated by E-cadherin of the cadherin superfamily, whose expression is closely related to maintaining ESC survival and pluripotency.43 E-cadherin is a transmembrane glycoprotein whose extracellular domain establishes the hydrophilic interaction between neighbouring cells in a calcium-dependent manner in epithelial tissues and ESCs.44,45 The cytoplasmic domain binds to various adaptor proteins including b-catenin, which provides an anchorage to the actin cytoskeleton via a-catenin to form adherens junctions (AJs) to strengthen the cadherin-mediated cell–cell interaction.46 Therefore, in order to explore the likely cause for the different pluripotency status of mESCs grown on the smooth Au and GNPLs with various surface roughnesses, we investigated the expression of proteins related to cell–cell adhesions mediated by E-cadherin in mESCs grown on various surfaces aer 3 days using immunouorescence staining. The results revealed that mESCs cultured on the smooth Au and the nanorough GNPL (Rq of 106 nm) were more tightly connected with each other and tended to form larger colonies. Besides, they maintained much stronger expression of E-cadherin (Fig. 7A and B). In contrast, the cell colonization was found to be much slower on the microrough GNPL (Rq of 1205 nm) and most cells were distributed randomly with much weaker expression of E-cadherin. A similar phenomenon was also observed in cells cultured on GNPLs with low and high submicroscale surface roughensses (Rq less than 392 nm and Rq greater than 573 nm, respectively). Cells grown on the GNPL with low sub-microscale surface roughness showed stronger
This journal is © The Royal Society of Chemistry 2014
Nanoscale
expression of E-cadherin while the cells grown on the GNPL with high sub-microscale surface roughness decreased signicantly in the expression of E-cadherin (see ESI Fig. 3†). In contrast, in the study of Chen et al., hESCs adhered to the nanorough glass surface demonstrated a much weaker expression of E-cadherin than the cells adhered to the smooth glass surface. The fact that b-catenin was also exclusively found in the cells cultured on the smooth Au and GNPLs with nanoscale (Fig. 7C) and low sub-microscale surface roughnesses (see ESI Fig. 3†) is indicative of strong AJs that support E-cadherin mediated cell– cell adhesions in mESC colonies. In contrast, the cells cultured on GNPLs with high sub-microscale (see ESI Fig. 3†) and microscale surface roughnesses (Fig. 7C) maintained much weaker expression of b-catenin. Combing the fact that Au and GNPLs with nanoscale and low sub-microscale surface roughnesses are supportive for the maintenance of mESC pluripotency in long-term culture, we can conclude that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) are conductive to cell colonization and allow tight cell–cell adhesions by the strong expression of proteins related to cell–cell adhesions, which in turn supports the maintenance of long-term cell pluripotency under feeder-free conditions. Topological sensing by integrin-mediated focal adhesions (FAs). Integrin-mediated focal adhesion to the ECM contributes to cell-matrix signalling by activating intracellular tyrosine kinase and phosphatise signalling to elicit downstream biochemical signals important for regulation of gene expression and stem cell fate.10 Importantly, integrin-mediated FA signalling is closely related to its molecular arrangement and dynamic organization, which can be affected directly by local topological cues.47 To investigate the likely involvement of integrin-mediated FA formation in regulating the topological sensing of mESCs, we examined the FA formation and organization of mESCs cultured on the smooth Au and GNPLs with different surface roughnesses by immunouorescence staining of vinculin, a FA protein. As shown in Fig. 8, aer 3 days of culture, mESCs exhibited distinct FA formations on the smooth Au and the nanorough GNPL (Rq of 106 nm). The expression of vinculin in mESCs cultured on Au and the nanorough GNPL was much stronger than that on the microrough GNPL (Rq of 1205 nm). And no obvious difference in the formations and organizations of FAs was found between cells cultured on the smooth Au and the nanorough GNPL. However, in the study of Chen et al., there was a signicant difference in the formations and organizations of FAs between cells cultured on the smooth glass surface and the nanorough glass surface. On the smooth glass surface, vinculin-containing FAs formed primarily on the periphery of the undifferentiated hESCs but distributed randomly on the nanorough surface. Moreover, relatively strong vinculin expression was also observed in the cells cultured on the GNPL with low sub-microscale surface roughness (Rq less than 392 nm) while the cells cultured on the GNPL with high submicroscale surface roughness (Rq greater than 573 nm) showed a obviously weaker expression of vinculin (see ESI Fig. 4†). Our
Nanoscale, 2014, 6, 6959–6969 | 6965
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
Paper
Fig. 7 Immunofluorescence images of mESCs on the smooth Au and GNPLs with nanoscale and microscale surface roughnesses after culture of 3 days. (A) The cells were costained for nuclei (DAPI; blue) and E-cadherin (red); (B) the cells were costained for cytoskeleton (Phalloidin; green) and E-cadherin (red); (C) the cells were costained for nuclei (DAPI; blue) and b-catenin (red). Bar, 50 mm.
Fig. 8 Immunofluorescence images of mESCs on the smooth Au and GNPLs with nanoscale and microscale surface roughnesses after culture of 3 days. The cells were costained for nuclei (DAPI; blue), cytoskeleton (Phalloidin; green) and vinculin (red). Bar, 50 mm.
results indicated that surface topography signicantly affected the formation of FAs in mESCs. GNPLs with nanoscale and low sub-microscale surface roughnesses are conductive to the formation of FAs in mESCs. In contrast, GNPLs with high submicroscale and microscale surface roughnesses signicantly decreased the formation of FAs, which might in turn result in faster spontaneous differentiation of mESCs. We think that there are several possible reasons for the contradiction between our results concerning the long-term pluripotency on the nanorough GNPL and the conclusions reached by Chen et al.10 First, the substrate prepared in our work is gold while the substrate studied by Chen et al. is glass. And this difference in the substrate type can result in different cell behaviors even under the same culture conditions.48 Second, in our study, the nanorough GNPL demonstrated a faster cell proliferation rate than the smooth Au aer culture of
6966 | Nanoscale, 2014, 6, 6959–6969
both 3 and 7 days, which was demonstrated by MTT results (see Fig. 4). In contrast, the nanorough glass substrate signicantly decreased the cell proliferation rate compared with the smooth glass substrate in Chen's study. Third, the cell–cell adhesions were observed to be very tight both on the nanorough GNPL and on the smooth Au, as demonstrated by the strong expression of E-cadherin (see Fig. 7). While the expression of E-cadherin was much weaker on the nanorough glass substrate than that on the smooth glass substrate in Chen's study. Fourth, our results showed that there was no obvious difference in the formations and organizations of FAs between the mESCs cultured on the nanorough GNPL and the smooth Au. While in the study of Chen et al., there is an obvious difference in the formations and organizations of FAs between the nanorough glass substrate and the smooth glass substrate. The vinculin-containing FAs formed primarily on the periphery of the undifferentiated
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Paper
hESCs on the smooth glass surface, but distributed randomly on the nanorough surface. Thus, the nanorough GNPL in the present study can provide good support for the long-term maintenance of mESC pluripotency under feeder-free conditions. The effect of surface roughness on osteoinduction behaviours of mESCs Cell morphology. It is now believed that rough surfaces induce better osteointegration in vivo than smooth surfaces,49 suggesting that surface roughness has a direct effect on osteoblast attachment, proliferation, and differentiation. To study the effect of the surface roughness on the osteoinduction of mESCs, cells were placed in osteoinduction media and cultured for additional periods of 3 and 7 days aer being cultured on various surfaces in mESC media for 3 days. DAPI and Flour 488 were used to stain the cell nucleus and cytoskeleton, respectively, to observe the cell shape. Aer 7 days, signicant morphological changes in the cell shape were observed in the cells seeded on Au, GL-1 and GL-2, whose surface roughnesses are less than 392 nm. As the cell colonies disappeared, which is a typical characteristic of embryonic stem cells, the cells migrated from the colonies and began to grow in the form of a monolayer. The resulting wellspread cells contained visible nuclei and irregular shapes, such as spindles and polygons; protrusions also formed (see Fig. 9A). In contrast, no obvious morphological change was observed in the cells cultured on GL-3, GL-4 and GL-5, which have roughnesses greater than 573 nm (see Fig. 9B). Thus, the loss of ESC characteristics and the development of osteoblast cell characteristics indicate that osteoinduction successfully occurred in the cells grown on the Au, GL-1, and GL-2 surfaces in osteoinduction media. Thus, our results demonstrated that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) are able to induce osteodifferentiation in
Nanoscale
osteoinduction media. In contrast, GNPLs with high submicroscale and microscale surface roughnesses (Rq greater than 573 nm) measurably weaken the osteodifferentiation ability of mESCs and result in poor osteodifferentiation behaviours. To induce better osteodifferentiation, ESCs have to be pluripotent before they are cultured in osteoinduciton media. However, spontaneous differentiation already happened in mESCs cultured on GNPLs with high sub-microscale and microscale surface roughnesses (GL-3, GL-4 and GL-5) before these samples were placed into osteoinduction media (see Fig. 5 and 6), which decreased the cell pluripotency. Thus, GNPLs with high submicroscale and microscale surface roughnesses exhibited poor osteoinduction behaviours. Alkaline phosphatase (ALP) activity. Alkaline phosphatase (ALP) activity, an initial indicator of osteodifferentiation,50,51
Fig. 10 ALP activity of mESCs cultured on various surfaces in osteoinduction media after 3 and 7 days. Data are the mean SD (n ¼ 3).
Fluorescence images of mESCs cultured for 7 days in osteoinduction media on different surfaces. The cells were co-stained for cytoskeleton (Phalloidin; green) and nuclei (DAPI; blue). (A) Au, GL-1, GL-2; (B) GL-3, GL-4, and GL-5. Bar, 50 mm. After culture of 7 days, significant morphological changes were found in the cells on Au, GL-1, GL-2 with surface roughness less than 392 nm whereas no obvious morphological change was observed in the cells on GL-3, GL-4 and GL-5, which have surface roughnesses greater than 573 nm. Fig. 9
This journal is © The Royal Society of Chemistry 2014
Nanoscale, 2014, 6, 6959–6969 | 6967
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
was detected in the cells grown on various surfaces for 3 days and 7 days in osteoinduction media. The ALP activity was monitored to characterize the osteoinduction status of the mESCs. As shown in Fig. 10, the ALP activity of the cells cultured on the smooth Au and on GL-1 and GL-2, whose surface roughnesses are less than 392 nm, was signicantly higher than that of the cells grown on GL-3, GL-4 and GL-5, whose surface roughnesses are greater than 573 nm. Furthermore, this tendency was more obvious aer 7 days. The ALP activity results are consistent with the morphological changes shown in Fig. 9. Together, these results indicate that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) can provide good support for the osteoinduction of mESCs, whereas GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm) signicantly decrease the osteodifferentiation ability of mESCs.
Conclusions In summary, we successfully prepared GNPLs with nano-, submicro- and microscale surface roughnesses via a convenient chemical plating method. The capacity of these GNPLs to regulate the behaviors of mESCs was investigated, leading to the following conclusions: (a) the MTT test showed that although the rough GNPLs decreased cell attachment, GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) provided better support for cell proliferation than did the smooth Au and GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm). (b) The consistent results from the Oct-4 immunouorescence staining and qPCR demonstrated that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) allowed the long-term pluripotency of mESCs to be maintained; the majority of the cells retained their stemness aer being cultured for 7 days on these surfaces in the absence of feeder cells; however, on GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm), the cells underwent faster spontaneous differentiation. Besides, the differentiation of cells on GNPLs with high sub-microscale and microscale surface roughnesses was undirectional, as demonstrated by the results from RT-PCR. (c) It was demonstrated by the results from immunouorescence staining of proteins related to E-cadherin mediated cell–cell adhesions and integrin-mediated focal adhesions (FAs) that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) were supportive for the colonization of mESCs; cells were relatively more tightly connected with each other inside the colony and strongly expressed the proteins connected with E-cadherin mediated cell–cell adhesions and integrinmediated FAs, which in turn resulted in better maintenance of the long-term pluripotency of mESCs under feeder-free conditions. In contrast, GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm) signicantly decreased the cell colonization; cells were distributed randomly with much weaker expression of proteins related to E-cadherin mediated cell–cell adhesions and FAs, which led to a faster cell undirectional differentiation rate. (d) The results
6968 | Nanoscale, 2014, 6, 6959–6969
Paper
of the cell morphology staining and the ALP activity test were also consistent and suggested that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm), which were able to maintain cell pluripotency, were conducive to the subsequent osteoinduction. In contrast, GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm) signicantly reduced the cell pluripotency during long-term culture; these GNPLs also resulted in poor osteoinduction behaviors; together, these results provide important insights into the importance of a synthetic cell microenvironment for controlling and directing mESC behaviors that are desirable for functional tissue engineering and regenerative medicine.
Acknowledgements This work was supported by the National Natural Science Foundation of China (21104055, 21374070 and 21334004), the National Science Fund for Distinguished Young Scholars (21125418), and the Project of Scientic and Technologic Infrastructure of Suzhou (SZS201207).
Notes and references 1 A. Higuchi, Q.-D. Ling, Y.-A. Ko, Y. Chang and A. Umezawa, Chem. Rev., 2011, 111, 3021–3035. 2 A. Higuchi, Q.-D. Ling, S.-T. Hsu and A. Umezawa, Chem. Rev., 2012, 112, 4507–4540. 3 J. A. Thomson, J. Itskovitz-Eldor, S. S. Shapiro, M. A. Waknitz, J. J. Swiergiel, V. S. Marshall and J. M. Jones, Science, 1998, 282, 1145–1147. 4 B. E. Reubinoff, M. F. Pera, C.-Y. Fong, A. Trounson and A. Bongso, Nat. Biotechnol., 2000, 18, 399–404. 5 R. L. Judson, J. E. Babiarz, M. Venere and R. Blelloch, Nat. Biotechnol., 2009, 27, 459–461. 6 M. P. Lutolf, P. M. Gilbert and H. M. Blau, Nature, 2009, 462, 433–441. 7 M. Caiazzo, M. T. Dell'Anno, E. Dvoretskova, D. Lazarevic, S. Taverna, D. Leo, T. D. Sotnikova, A. Menegon, P. Roncaglia and G. Colciago, Nature, 2011, 476, 224–227. 8 K. Okita, T. Ichisaka and S. Yamanaka, Nature, 2007, 448, 313–317. 9 J. Yu, M. A. Vodyanik, K. Smuga-Otto, J. Antosiewicz-Bourget, J. L. Frane, S. Tian, J. Nie, G. A. Jonsdottir, V. Ruotti and R. Stewart, Science, 2007, 318, 1917–1920. 10 W. Chen, L. G. Villa-Diaz, Y. Sun, S. Weng, J. K. Kim, R. H. Lam, L. Han, R. Fan, P. H. Krebsbach and J. Fu, ACS Nano, 2012, 6, 4094–4103. 11 F. Chowdhury, Y. Li, Y.-C. Poh, T. Yokohama-Tamaki, N. Wang and T. S. Tanaka, PLoS One, 2010, 5, e15655. 12 Y. Sun, L. G. Villa-Diaz, R. H. Lam, W. Chen, P. H. Krebsbach and J. Fu, PLoS One, 2012, 7, e37178. 13 J. Harrison, S. Pattanawong, J. Forsythe, K. Gross, D. Nisbet, H. Beh, T. Scott, A. Trounson and R. Mollard, Biomaterials, 2004, 25, 4963–4970. 14 J. Tang, R. Peng and J. Ding, Biomaterials, 2010, 31, 2470– 2476.
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Paper
15 R. Peng, X. Yao and J. Ding, Biomaterials, 2011, 32, 8048– 8057. 16 W. Song, H. Lu, N. Kawazoe and G. Chen, J. Bioact. Compat. Polym., 2011, 26, 242–256. 17 W. Song, H. Lu, N. Kawazoe and G. Chen, Langmuir, 2011, 27, 6155–6162. 18 D. Bae, S.-H. Moon, B. G. Park, S.-J. Park, T. Jung, J. S. Kim, K. B. Lee and H.-M. Chung, Biomaterials, 2014, 35, 916–928. 19 M. R. Lee, K. W. Kwon, H. Jung, H. N. Kim, K. Y. Suh, K. Kim and K.-S. Kim, Biomaterials, 2010, 31, 4360–4366. 20 L. A. Smith, X. Liu, J. Hu, P. Wang and P. X. Ma, Tissue Eng., Part A, 2009, 15, 1855–1864. 21 K. Kieswetter, Z. Schwartz, T. Hummert, D. Cochran, J. Simpson, D. Dean and B. Boyan, J. Biomed. Mater. Res., 1996, 32, 55–63. 22 A. L. Raines, R. Olivares-Navarrete, M. Wieland, D. L. Cochran, Z. Schwartz and B. D. Boyan, Biomaterials, 2010, 31, 4909–4917. 23 D. Buser, R. Schenk, S. Steinemann, J. Fiorellini, C. Fox and H. Stich, J. Biomed. Mater. Res., 1991, 25, 889–902. 24 D. Cochran, R. Schenk, A. Lussi, F. Higginbottom and D. Buser, J. Biomed. Mater. Res., 1998, 40, 1–11. 25 D. L. Cochran, J. Periodontol., 1999, 70, 1523–1539. 26 D. L. Cochran, D. Buser, C. M. Ten Bruggenkate, D. Weingart, T. M. Taylor, J. P. Bernard, F. Peters and J. P. Simpson, Clin Oral Implants Res, 2002, 13, 144–153. 27 F. Zhou, D. Li, Z. Wu, B. Song, L. Yuan and H. Chen, Macromol. Biosci., 2012, 12, 1391–1400. 28 M. Bigerelle, A. Van Gorp and A. Iost, Polym. Eng. Sci., 2008, 48, 1725–1736. 29 L. A. Smith, X. Liu, J. Hu and P. X. Ma, Biomaterials, 2009, 30, 2516–2522. 30 M. M. Bradford, Anal. Biochem., 1976, 72, 248–254. 31 H. T. Aung, K. Schroder, S. R. Himes, K. Brion, W. van Zuylen, A. Trieu, H. Suzuki, Y. Hayashizaki, D. A. Hume and M. J. Sweet, FASEB J., 2006, 20, 1315–1327. 32 Y. Wang, F. Zhou, X. Liu, L. Yuan, D. Li, Y. Wang and H. Chen, ACS Appl. Mater. Interfaces, 2013, 5, 3816–3823. 33 F. Zhou, L. Yuan, H. Wang, D. Li and H. Chen, Langmuir, 2011, 27, 2155–2158.
This journal is © The Royal Society of Chemistry 2014
Nanoscale
34 K. Liu, X. Yao and L. Jiang, Chem. Soc. Rev., 2010, 39, 3240– 3255. 35 J. Wu, H.-J. Bai, X.-B. Zhang, J.-J. Xu and H.-Y. Chen, Langmuir, 2009, 26, 1191–1198. 36 R. G. Contreras, H. Sakagami, H. Nakajima and J. Shimada, In Vivo, 2010, 24, 513–517. 37 P. Jasinski, P. Zwolak, R. I. Vogel, V. Bodempudi, K. Terai, J. Galvez, D. Land and A. Z. Dudek, Invest. New Drugs, 2011, 29, 846–852. 38 T. Matsuta, H. Sakagami, M. Kitajima, H. Oizumi and T. Oizumi, In Vivo, 2011, 25, 751–755. 39 S. Sista, A. Nouri, Y. Li, C. Wen, P. D. Hodgson and G. Pande, J. Biomed. Mater. Res., Part A, 2013, 101, 3416–3430. 40 H. Wang, W. Jiang, L. Yuan, L. Wang and H. Chen, ACS Appl. Mater. Interfaces, 2013, 5, 1800–1805. 41 H. Niwa, J.-i. Miyazaki and A. G. Smith, Nat. Genet., 2000, 24, 372–376. 42 M. H. Rosner, M. A. Vigano, K. Ozato, P. M. Timmons, F. Poirie, P. W. Rigby and L. M. Staudt, Nature, 1990, 345, 686–692. 43 Y. Xu, X. Zhu, H. S. Hahm, W. Wei, E. Hao, A. Hayek and S. Ding, Proc. Natl. Acad. Sci. U. S. A., 2010, 107, 8129–8134. 44 H. Oda and M. Takeichi, J. Cell Biol., 2011, 193, 1137–1146. 45 D. Li, J. Zhou, L. Wang, M. E. Shin, P. Su, X. Lei, H. Kuang, W. Guo, H. Yang and L. Cheng, J. Cell Biol., 2010, 191, 631–644. 46 S. Yonemura, M. Itoh, A. Nagafuchi and S. Tsukita, J. Cell Sci., 1995, 108, 127–142. 47 V. Vogel and M. Sheetz, Nat. Rev. Mol. Cell Biol., 2006, 7, 265– 275. 48 H. Hakala, K. Rajala, M. Ojala, S. Panula, S. Areva, M. Kellom¨ aki, R. Suuronen and H. Skottman, Tissue Eng., Part A, 2009, 15, 1775–1785. 49 M. Vandrovcova, J. Hanus, M. Drabik, O. Kylian, H. Biederman, V. Lisa and L. Bacakova, J. Biomed. Mater. Res., Part A, 2012, 100, 1016–1032. 50 N. D. Evans, E. Gentleman, X. Chen, C. J. Roberts, J. M. Polak and M. M. Stevens, Biomaterials, 2010, 31, 3244–3252. 51 J. Kawaguchi, P. J. Mee and A. G. Smith, Bone, 2005, 36, 758– 769.
Nanoscale, 2014, 6, 6959–6969 | 6969
Nanoscale View Article Online
PAPER
View Journal | View Issue
Cite this: Nanoscale, 2014, 6, 6959
Maintaining the pluripotency of mouse embryonic stem cells on gold nanoparticle layers with nanoscale but not microscale surface roughness† Zhonglin Lyu, Hongwei Wang, Yanyun Wang, Kaiguo Ding, Huan Liu, Lin Yuan,* Xiujuan Shi, Mengmeng Wang, Yanwei Wang and Hong Chen* Efficient control of the self-renewal and pluripotency maintenance of embryonic stem cell (ESC) is a prerequisite for translating stem cell technologies to clinical applications. Surface topography is one of the most important factors that regulates cell behaviors. In the present study, micro/nano topographical structures composed of a gold nanoparticle layer (GNPL) with nano-, sub-micro-, and microscale surface roughnesses were used to study the roles of these structures in regulating the behaviors of mouse
ESCs
(mESCs)
under
feeder-free
conditions.
The
distinctive
results
from
Oct-4
immunofluorescence staining and quantitative real-time polymerase chain reaction (qPCR) demonstrate that nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) are conducive to the long-term maintenance of mESC pluripotency, while high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm) result in a significant loss of mESC pluripotency and a faster undirectional differentiation, particularly in long-term culture. Moreover, the likely signalling cascades engaged in the topological sensing of mESCs were investigated and their role in affecting the maintenance of the long-term cell pluripotency was discussed by analyzing the expression of proteins Received 20th March 2014 Accepted 9th April 2014
related to E-cadherin mediated cell–cell adhesions and integrin-mediated focal adhesions (FAs). Additionally, the conclusions from MTT, cell morphology staining and alkaline phosphatase (ALP) activity
DOI: 10.1039/c4nr01540a
assays show that the surface roughness can provide a potent regulatory signal for various mESC
www.rsc.org/nanoscale
behaviors, including cell attachment, proliferation and osteoinduction.
Introduction Embryonic stem cells (ESCs) derived from preimplantation embryos have the potential to differentiate into any somatic cell type that is derived from the three germ layers, the ectoderm, mesoderm and endoderm; therefore, ESCs provide a good opportunity for stem cell-based regenerative therapies and the development of drug discovery platforms.1–7 The ability to control the pluripotency of ESCs during long-term culture and still induce differentiation into multiple lineages is necessary to realize the potential clinical and industrial applications of ESCs. Previous work has demonstrated that biological cues, such as growth factors, hormones, small chemicals, and bioactive molecules, can determine stem cell pluripotency and differentiation.8,9 In addition, physical cues, such as the properties of
The Key Lab of Health Chemistry and Molecular Diagnosis of Suzhou, Department of Polymer Science and Engineering, College of Chemistry, Chemical Engineering and Materials Science, Soochow University, Suzhou 215123, P. R. China. E-mail: yuanl@ suda.edu.cn; [email protected]; Fax: +86-512-65880583; Tel: +86-512-65880827 † Electronic supplementary 10.1039/c4nr01540a
information
(ESI)
This journal is © The Royal Society of Chemistry 2014
available.
See
DOI:
the surface where cells are cultured, including topography,10 stiffness1,11,12 and wettability,13 directly inuence the selfrenewal and pluripotency maintenance of ESCs. Of these factors, precisely controlled substrate nano/micro topography, independent of substrate chemistry, has been reported to play a crucial role in affecting the attachment, proliferation, pluripotency and subsequent differentiation of stem cells.10,14–18 The inuence of surface nanoscale features on ESC functions has attracted increasing attention because these features can make the surface resemble the natural extracellular matrix (ECM) in which cells reside and interact.10,19,20 Recently, Chen et al. fabricated patterned nanorough glass substrates with surface roughnesses of 70 nm and 150 nm using photolithography followed by reactive ion etching techniques and investigated the ability of the surface nanoscale roughness to regulate the pluripotency of human ESCs (hESCs). The researchers found that culturing cells on a smooth glass surface was conducive to the self-renewal and pluripotency maintenance of hESCs in long-term culture; by contrast, the nanorough surfaces resulted in the spontaneous differentiation of a large portion of the hESCs, which thus lost their pluripotency.10 However, the inuence of surface sub-microscale and microscale roughness on the maintenance of ESC pluripotency
Nanoscale, 2014, 6, 6959–6969 | 6959
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
remains unclear and has been largely ignored to date. Actually, among the research reports on non-stem cells, several reports have shown that surface sub-micro- and microscale roughness, with feature sizes comparable to those of resorption pits and cell dimensions, can modulate cell behaviours and functions. For example, such a surface roughness has enhanced osteoblast differentiation and the local factor production of osteoblast-like cells in vitro,21,22 increased the bone-to-implant contact in vivo23,24 and improved the clinical rates of wound healing.25,26 Therefore, to better understand the ability of surface topography to control the pluripotency of ESCs, the effects of surface sub-micro- and microscale roughness must be investigated. In the present study, we attempted to determine the optimal surface roughness for maintaining mESC pluripotency during long-term culture under feeder-free conditions by preparing gold nanoparticle layers (GNPLs) with nano-, sub-micro- and microscale surface roughness via a convenient chemical plating method. The relationship between the surface roughness and mESC pluripotency was described. Besides, the likely signalling cascades engaged in the topological sensing of mESCs cultured on surfaces with various roughnesses were investigated. Furthermore, we studied the role of the surface roughness in regulating the attachment, proliferation and osteoinduction behaviors of mESCs. The resulting ndings are of fundamental interest and have important consequences for designing a synthetic cell microenvironment to control and direct ESC behaviors.
Experimental Materials Silicon wafers (0.53 mm thick, polished on both sides) were coated with a chromium adhesion layer followed by a layer of gold (approximately 100 nm) and diced into 0.5 cm 0.5 cm pieces. Hydrogen tetrachloroaurate hydrate (HAuCl4$4H2O), glucose and b-glycerin sodium phosphate were from Sinopharm Chemical Reagent Co. (Shanghai, China). Potassium hydrogen carbonate (AR) was from Shanghai Zhanyun Chemical Co. (Shanghai, China). b-Cysteamine (C2H7NS, 95%) was from Aladdin Reagent Co. (Shanghai, China). Bovine serum albumin (BSA), paraformaldehyde, gelatin, dexamethasone, Triton X-100 and vitamin C were from Sigma-Aldrich. MTT (3-(4,5-dimethyl2-thiazol)-2,5-diphenyl-2H-tetrazolium bromide, 98%) was from Amresco. PCR primers were from Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China). DAPI (40 ,6-diamidino-2phenylindole) and Alexa Fluor 488 phalloidin were from Invitrogen. All other solvents, which were of analytical reagent grade, were from Sinopharm Chemical Reagent Co. (Shanghai, China). All aqueous solutions were prepared in 18.2 MU cm puried water from a Milli-Q water purication system (Millipore, Bedford, MA, USA). Preparation of gold nanoparticle layers (GNPLs) Gold-coated silicon slides (0.5 cm 0.5 cm) were placed in freshly prepared Piranha solution (H2SO4–30% H2O2 ¼ 7 : 3 v/v) to remove organic impurities. The slides were then rinsed with
6960 | Nanoscale, 2014, 6, 6959–6969
Paper
deionized water several times until the pH of the wash became neutral. Aer being dried in a stream of nitrogen, the gold slides were immersed in a solution of b-cysteamine in ethanol (20 mmol L1) overnight at room temperature. The aminated surfaces were then rinsed with ethanol (at least 3 times) and dried in a stream of nitrogen. The GNPLs were prepared as described by Zhou et al.27 Briey, the aminated surfaces were placed in the wells of a 48-well plate; then, 80, 160, 300, 500 or 800 mL plating solutions (12 mM HAuCl4$4H2O, 0.5 M KHCO3, and 25 mM glucose) containing 0.96, 1.92, 3.60, 6.00 or 9.60 mmol hydrogen tetrachloroaurate acid, respectively, were added to each well and incubated at 37 C for 3 h to form gold nanoparticle layers. The slides were removed from the solution, rinsed with deionized water, and dried in a stream of nitrogen. The nal GNPLs were termed GL-1, GL-2, GL-3, GL-4 and GL-5 for the increasing volumes of plating solution. Surface characterization The surface topography of the GNPLs was investigated by scanning electron microscopy (SEM, S-4700, Hitachi) and atomic force microscopy (AFM, Bruker, Santa Barbara, CA). The surface roughnesses of GL-1 to GL-5 were measured by using a Multi-Mode Nanoscope V AFM with a V-shaped antimony N-doped Si cantilever RTESP (Bruker, nominal spring constant: 20–80 N m1, f0: 312–333 kHz) in tapping mode. The evaluation area for each sample ranged from 2 2 mm2 to 20 20 mm2. The roughness parameters (i.e., the arithmetic mean value (Ra) and the root-mean-square average (Rq)) were obtained directly from the NanoScope Analysis 14 soware (Bruker) with zerodegree polynomial tting based on the multiscale roughness parameter evaluation method described by Bigerelle et al.28 The static water contact angle was measured with an SL200C optical contact angle meter (USA Kino Industry Co., Ltd.) using the sessile drop method at room temperature. Culture and growth of mouse embryonic stem cells (mESCs) MESCs (R1/E, Stem Cell Bank, Chinese Academy of Sciences) were cultivated on a feeder layer of mitomycin C-inactivated mouse embryonic broblasts (mEFs, ICR MEF, Stem Cell Bank, Chinese Academy of Sciences) with ESC maintenance media consisting of Dulbecco's modied Eagle's media with high glucose but without L-glutamine (DMEM; Thermo Hyclone) and were supplemented with 10% fetal bovine serum (FBS), 100 U mL1 penicillin (Genview), 100 mg mL1 streptomycin (Solarbio), 2 mM L-glutamine (Invitrogen), 0.1 mM non-essential amino acids (Gibco), 0.1 mM b-mercaptoethanol (Amresco) and 1000 U mL1 leukemia inhibitory factor (LIF; Chemicon) at 37 C in a humidied 5% (v/v) CO2 incubator (Eppendorf Galaxy 170R). Aer the mESCs were cultured in a gelatin-coated cell culture ask and passaged twice to remove mEFs, the mESCs were dissociated and seeded onto Au and GNPLs at a density of 2 104 cells per cm2. For osteoinduction, the cells grown on Au and GNPLs were transferred to osteoinduction media aer being cultured in ESC media for 3 days. The osteoinduction media consisted of Dulbecco's modied Eagle's media with high glucose but without
This journal is © The Royal Society of Chemistry 2014
View Article Online
Paper
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
L-glutamine (DMEM) 1
and was supplemented with 10% FBS, 100 U mL penicillin, 100 mg mL1 streptomycin, 2 mM L-glutamine, 0.1 mM non-essential amino acids, 0.1 mM b-mercaptoethanol, 1 mM dexamethasone, 50 mg mL1 ascorbic acid and 10 mM b-glycerin sodium phosphate.29 An MTT-based assay was performed on the cells seeded on Au and GNPLs to characterize the cell growth. Briey, the cells were seeded on the substrates at a density of 8 103 cells per cm2 and incubated for 1, 3 and 7 days in ESC media with changing the medium every other day. At the end of days 1, 3 and 7, the substrates were transferred into a 96-well culture plate (Costar), and the media were replaced by 200 mL fresh media, followed by the addition of 20 mL MTT (5 mg mL1). The cells were then incubated for 4 h at 37 C in a humidied 5% CO2 (v/v) incubator. The wells were drained of the media, the formazan crystals that formed due to the interaction of the MTT solution with the live cells were dissolved in 220 mL DMSO, and the absorbance of the resulting solution was read at 490 nm using a microplate reader (Thermo Fisher Scientic Inc.).
Immunocytochemistry The mESCs cultured on Au and the GNPLs in ESC media aer certain period of time were rinsed in situ in PBS, xed for 10 min in 4% paraformaldehyde at room temperature, and washed three times for 5 min in PBS. The cells were permeabilized with 0.1% Triton X-100 for 5 min. Aer being washed twice with PBS and incubated in blocking buffer (3% BSA in PBS) for 30–60 min, the cells were then incubated with primary antibodies Oct4 (Sangon Shanghai, China), E-cadherin, b-catenin and vinculin (all from Boster Wuhan, China) in blocking buffer overnight at 4 C and rinsed in PBS three times for 5 min. Next, the cells were incubated for 1 h at room temperature with either TRITC or FITC conjugated secondary antibodies (both from Boster Wuhan, China), followed by three more 5 min washes in PBS. The cells were then counterstained with Alexa Fluor 488 phalloidin in PBS for 15 min or DAPI (0.5 mg mL1) for 5 min in PBS. Images were captured using an Olympus IX71 uorescence microscope. The images were overlapped using Image-Pro Plus 6.0 soware (public soware from Media Cybernetics, http:// www.mediacy.com/).
Cell morphology aer osteoinduction Aer being cultured in osteoinduction media for 3 and 7 days, the cells were washed with warm PBS, xed for 10 min in 4% paraformaldehyde at room temperature, and washed three times for 5 min in PBS. The cells were then permeabilized with 0.1% Triton X-100 for 5 min and blocked with 1% BSA in PBS for 20 min, followed by 20 min of uorescence staining with Alexa Fluor 488 phalloidin. Aer three more 5 min washes in PBS, the cells were counterstained with DAPI (0.5 mg mL1) for 5 min. Images were captured using an Olympus IX71 uorescence microscope. The images were overlapped using Image-Pro Plus 6.0 soware.
This journal is © The Royal Society of Chemistry 2014
Nanoscale
Measurement of alkaline phosphatase (ALP) activity The ALP activity of the cells seeded on each surface in osteoinduction media was measured on days 3 and 7. At each time point, the cells cultured on all surfaces were rinsed twice with cold PBS and lysed in lysis buffer containing 0.1% Triton X-100. Aer centrifugation at 4 C for 10 min, the upper aqueous phase was used to measure the ALP activity. The ALP activity was quantied with an alkaline phosphatase assay kit according to the manufacturer's protocol (Beyotime Biotechnology, China). The absorbance was read at 405 nm using a microplate reader (Thermo Fisher Scientic Inc.) to determine the enzyme concentration. The total protein content was determined using the Coomassie Brilliant Blue method,30 and the ALP activity was calculated according to a formula provided by the manufacturer (Beyotime Biotechnology, China) and expressed as nmol per assay time per mg protein. Quantitative real-time polymerase chain reaction (qPCR) and reverse transcription PCR (RT-PCR) The total RNA was extracted from the cultured cells using an RNAsimple total RNA kit according to the manufacturer's instructions (Tiangen Biotech Co., Ltd. [Beijing]). Then, the isolated RNA sample was reversely transcribed for rst-strand cDNA synthesis (RevertAid First Strand cDNA Synthesis Kit, Thermo Scientic) using oligo (dT) as a reverse transcription primer. For the qPCR, the Oct-4 gene was selected to assess the maintenance of pluripotency in the mESCs aer 7 days of culture. Oct-4 is expressed in the undifferentiated mESCs. Real-time qPCR was performed in a real-time PCR machine (StepOne Plus realtime PCR system, Applied Biosystems) using a Fast SYBR Green Master Mix (Applied Biosystems) to quantify the levels of mRNA expression of 2 selected genes in the mESCs. The primer details are summarized as follows: GAPDH-f 50 -GCACAGTCAAGGCCGA GAAT-30 , GAPDH-r 50 -GCCTTTCCATGGTGGTGAA-30 (60 C, 151 bps); Oct-4-f 50 -GGCGTTCTCTTTGGAAAGGT-30 , Oct-4-r 50 TCTCATTGTTGTCGGCTTCCT-30 (60 C, 112 bps). The threshold cycle (Ct) value was calculated from the amplication plots. The DCt value for each sample was obtained by subtracting the Ct values of a housekeeping gene, glyceraldehyde phosphate dehydrogenase (GAPDH). Then, the DDCt value of the GNPL samples was normalized by the DCt value of the cells on the Au samples and was converted into relative gene expression by raising 2 to the DDCt power.31 Each sample was analyzed in triplicate. For the RT-PCR, different germ layer (including endoderm: Sox7 and Foxa2; mesoderm: Flk1 and Branchyury; ectoderm: Pax6 and Fgf5) marker genes were selected to investigate the possible differentiation directions of the mESCs on GL-5 with microscale surface roughness aer culture of 7 days. The primer details are as follows: Sox7-f 50 -GAGCTAAGCAAGATGCTAGG-30 , Sox7-r 50 TACTTGTAGTTGGGGTGGTC-30 (55 C, 122 bps); Foxa2-f 50 ACTGGAGCAGCTACTACG-30 , Foxa2-r 50 -CCCACATAGGATGA CATG-30 (55 C, 169 bps); Flk1-f 50 - CACCTGGCACTCTCCACCTTC30 , Flk1-r 50 -GATTTCATCCCACTACCGAAAG-30 (60 C, 239 bps); Branchyury-f 50 - GACTTCGTGACGGCTGACAA-30 , Branchyury-r 50 -CGAGTCTGGGTGGATGTAG-30 (59 C, 110 bps); Pax6-f
Nanoscale, 2014, 6, 6959–6969 | 6961
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
50 -CTGGAGAAAGAGTTTGAGAGG-30 , Pax6-r 50 -CTGCTGCTGA TAGGAATGTG-30 (60 C, 196 bps); Fgf5-f 50 -ACAAGAGAGGGAAAG CCAAGAG-30 , Fgf5-r 50 -GAACAGTGACGGTGAAGGAAAG-30 (60 C, 122 bps). RT-PCR amplication was performed using a standard procedure with Taq DNA Polymerase (Thermo Scientic) with denaturation at 95 C for 30 s, annealing at 55–60 C for 30 s according to melting temperature of each primer, and extension at 72 C for 45 s. The number of cycles was 40. A nal extension of 10 min was also performed. Following RT-PCR, samples were run on 1.5% agarose gel labelled with ethidium bromide solution. The gels were then imaged using a EC3 Imaging System (UVP LLC, Upland, CA, USA). Statistical methods Every independent experiment was duplicated at least three times, and the results were represented as the mean standard deviation (SD). P-values less than 0.05 were considered to be signicant.
Results and discussion Sample characterization SEM and surface roughness. Previous studies have already demonstrated that gold nanoparticle layers (GNPLs) can be easily prepared using a chemical gold plating method, and their surface roughnesses can be regulated by adjusting the mole number of hydrogen tetrachloroaurate acid (from 1.8 mmol to 6.0 mmol) in the gold plating solution.27,32,33 To investigate the biological effects of the GNPL surface on a larger surface roughness scale in this study, we increased the mole number of hydrogen tetrachloroaurate acid to 9.6 mmol in the gold plating solution. Five types of GNPL-modied Au surfaces were fabricated and termed GL-1, GL-2, GL-3, GL-4 and GL-5 in the order of increasing hydrogen tetrachloroaurate mole number. Aer the deposition and aggregation of gold nanoparticles, the GNPLs actually adopt the morphology of three-dimensional micro- and nanosized structures, which consist of gold nanoparticle aggregates with different sizes. Besides, these structures became more densely aggregated with the increment of the gold plating solution which resulted in the GNPLs with a rougher surface morphology (see ESI Fig. 1†); this morphology completely differs from the smooth Au surface (see Fig. 1A and B). AFM was used to further characterize the surface topography of the different GNPLs and the roughness versus evaluation
SEM images of an Au surface and a GNPL prepared by chemical gold plating. (A) Au and (B) GNPL. Bar, 1 mm.
Fig. 1
6962 | Nanoscale, 2014, 6, 6959–6969
Paper
length plot for GL-1, GL-2, GL-3, GL-4 and GL-5 was acquired using different scanning scales of 2 2 mm2 to 20 20 mm2 (Fig. 2A–E). The results suggest that for each sample, both roughness parameters (Rq and Ra) increase with the evaluation length and reached a plateau before 20 mm. Fig. 2F shows the surface roughness parameters Ra and Rq for GL-1, GL-2, GL-3, GL-4 and GL-5 at the evaluation length of 20 mm. The Ra was 58, 270, 433, 710 and 969 nm for GL-1, GL-2, GL-3, GL-4 and GL-5, respectively, and the Rq was 106, 392, 573, 920 and 1205 nm for GL-1, GL-2, GL-3, GL-4 and GL-5, respectively. Water contact angle. The wettability of surfaces with micro/ nanosized topography is usually quite different from that of ordinary plane surfaces; the former exhibit a super hydrophilic or hydrophobic state.34 The GNPLs we prepared consist of gold nanoparticle aggregates and have three-dimensional micro/ nanosized structures. To determine the wettability of these surfaces, a static water contact angle test was performed on Au and GNPLs at room temperature aer the newly fabricated samples were blown dry under a nitrogen stream. As shown in Fig. 3, the water contact angle of the smooth Au surface was 55.4 5.0 . In contrast, GL-1 and GL-2, whose surface roughnesses are less than 392 nm, were hydrophilic with water contact angles of 36.4 2.2 and 29.2. 1.2 , respectively. GL-3, GL-4 and GL-5, which have surface roughnesses greater than 573 nm, were super hydrophilic with water contact angles of 9.8 2.3 , 10.5 1.3 and 5.6 0.8 , respectively. Our results indicate that as the mole number of hydrogen tetrachloroaurate acid in the gold plating solution increases, the GNPLs become more hydrophilic; this nding is consistent with the conclusions of other researchers using gold nanoparticle aggregates that were deposited on a PDMS substrate.35 Cell attachment and proliferation. The MTT test is a common tool for measuring cell viability.36–39 The growth of mESCs seeded on different surfaces aer 1, 3 and 7 days was monitored using an MTT test. The absorbance at 490 nm is proportional to the number of viable cells for a certain range of absorbances.40 As shown in Fig. 4, the OD value of cells on the Au surface is the highest (approximately 0.1) compared with that on all GNPLs (approximately 0.04) aer 1 day, indicating that the number of cells that adhered to the GNPLs is measurably lower than that adhered to the Au surface. Moreover, no obvious difference was observed in the number of adhered cells among all GNPLs with their various surface roughnesses. These results indicate that rough GNPLs decrease the attachment of mESCs; we quantied the cell proliferation rate, dened as the increase in the ratio of the OD values on days 3 and 7 to that on day 1, to study the inuence of the surface roughness on mESC proliferation. Aer 3 days, the number of cells on the Au surface was still the highest, although the number of cells on the GNPLs also increased measurably, as indicated by their OD values. However, a faster cell proliferation rate was observed on GL-1 (Rq of 106 nm) with a proliferation ratio of approximately 1.3; in contrast, for the other rough GNPLs and the Au surface, the proliferation ratios were approximately 0.5 and 0.4, respectively. These results demonstrate the tendency for nanorough GNPLs to increase the cell proliferation rate. Aer 7 days, this tendency
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Paper
Nanoscale
(A–E) Plot of roughness vs. evaluation length for GL-1, GL-2, GL-3, GL-4 and GL-5 to describe the topography and provide the roughness parameters Rq and Ra using AFM. For each GNPL sample, the evaluation length was 2, 5, 8, 10, 12, 15, 18 and 20 mm, respectively; (F) surface roughness parameters Rq and Ra for Au, GL-1, GL-2, GL-3, GL-4 and GL-5. The evaluation length was 20 mm. Data are the mean SD (n ¼ 3). Fig. 2
Fig. 3
Static water contact angle of Au and GNPLs at room temperature. Data are the mean SD (n ¼ 3).
Fig. 4 The growth of viable cells that were cultured on various surfaces for 1, 3 and 7 days was determined using an MTT test by measuring the absorbance at 490 nm. Data are the mean SD (n ¼ 3).
became more noticeable. The proliferation rate on GL-1 and GL2, whose surface roughnesses are less than 392 nm, was approximately 3.4; in contrast, the rate on Au was approximately 1.6, and the rate was approximately 1.4 on GL-3, GL-4 and GL-5, whose surface roughnesses are greater than 573 nm. Together, these results thus conrmed that although the rough GNPL decreased the attachment of mESCs, a GNPL with suitable roughness (less than 392 nm) provides better support for cell proliferation than does the smooth Au surface.
Oct-4 immunouorescence staining. MESCs are pluripotent, and they can successfully express the POU-domain transcription factor encoded by the Oct-4 gene, which is essential for maintaining ESCs in an undifferentiated state. Decreases in Oct-4 immunoreactivity are associated with the onset of ESC differentiation.13,41,42 Therefore, the Oct-4 immunoreactivity of mESCs grown on Au and the GNPLs with different surface roughnesses were examined to monitor the surface-induced alterations to the pluripotency status.
This journal is © The Royal Society of Chemistry 2014
Nanoscale, 2014, 6, 6959–6969 | 6963
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
Paper
Fig. 5 Immunofluorescence images of mESCs cultured for 3 and 7 days on various surfaces. The cells were co-stained for Oct-4 (red) and nuclei (DAPI; blue). Undifferentiated mESCs were positively immuno-labeled for Oct-4 and were stained red. DAPI (blue counterstain) labels all cells in the population; therefore, differentiated cell types appear to be blue. (A) Au, GL-1, GL-2; (B) GL-3, GL-4, and GL-5. Bar, 100 mm.
As shown in Fig. 5, the majority of mESCs that were seeded on Au, GL-1 and GL-2, whose surface roughnesses are less than 392 nm, retained their stemness aer being cultured for 3 and 7 days, as evidenced by their positive expression of the Oct-4 gene. In contrast, the pluripotency of the cells cultured on GL-3, GL-4 and GL-5, whose surface roughnesses are greater than 573 nm, started to decrease on day 3 (see ESI Fig. 2A†). Moreover, the loss of pluripotency was more signicant aer 7 days, particularly on GL-5, which has a microscale surface roughness. The results indicate that the smooth Au and GNPLs with low submicroscale surface roughness (Rq less than 392 nm) can provide good support for the long-term maintenance of mESC pluripotency. However, GNPLs with high sub-microscale surface roughness (Rq greater than 573 nm) and microscale surface roughness (Rq of 1205 nm) measurably decrease the long-term pluripotency of mESCs and accelerate their spontaneous differentiation rate, especially on microrough GNPLs, despite the presence of LIF in the culture media. Analysis of Oct-4 expression by qPCR and possible differentiation directions of the cells cultured on microrough GL-5 by RT-PCR. The mESCs cultured on Au, GL-1, GL-3 and GL-5 with
6964 | Nanoscale, 2014, 6, 6959–6969
representative surface roughnesses aer 7 days were chosen for quantitative characterization of the relative Oct-4 gene expression level using qPCR, and the results are shown in Fig. 6. The percentage of Oct-4 gene expression measurably decreased on GL-3 (73%) and GL-5 (52%), whose surface roughnesses are greater than 573 nm, compared with that on the control Au substrate. The Oct-4 expression level was particularly decreased on GL-5, which has the highest surface roughness, by approximately 50%. In contrast, no signicant loss of Oct-4 gene expression was observed on GL-1 (84%), whose surface roughness is less than 392 nm. The qPCR results are consistent with the conclusions from the Oct-4 immunouorescence staining experiments. We can conclude that GNPLs with nanoscale and low sub-microscale surface roughness (Rq less than 392 nm) provide good support for the long-term pluripotency of mESCs in the absence of feeder cells, whereas GNPLs with high sub-microscale and microscale surface roughness (Rq greater than 573 nm) lead to faster spontaneous differentiation and signicant loss of mESC pluripotency in long-term culture. RT-PCR was carried out to investigate the possible differentiation directions of mESCs on the microrough GL-5 (Rq of
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Paper
Fig. 6 qPCR analysis of Oct-4 gene expression in mESCs cultured on different surfaces after 7 days. ***p < 0.001. Data are the mean SD (n ¼ 3).
1205 nm) aer culture of 7 days. The chosen germ layer markers are as follows: endoderm: Sox7 and Foxa2; mesoderm: Flk1 and Brachyury; ectoderm: Pax6 and Fgf5. The results showed that both the expression of Brachyury (endoderm) and Fgf5 (ectoderm) were detected, which indicated the spontaneous differentiation of cells cultured on the microrough GL-5 was undirectional (see ESI Fig. 2B†). Topological sensing by E-cadherin mediated cell–cell adhesions in mESCs cultured on various surfaces. The strong cell– cell adhesions within ESC colonies are mediated by E-cadherin of the cadherin superfamily, whose expression is closely related to maintaining ESC survival and pluripotency.43 E-cadherin is a transmembrane glycoprotein whose extracellular domain establishes the hydrophilic interaction between neighbouring cells in a calcium-dependent manner in epithelial tissues and ESCs.44,45 The cytoplasmic domain binds to various adaptor proteins including b-catenin, which provides an anchorage to the actin cytoskeleton via a-catenin to form adherens junctions (AJs) to strengthen the cadherin-mediated cell–cell interaction.46 Therefore, in order to explore the likely cause for the different pluripotency status of mESCs grown on the smooth Au and GNPLs with various surface roughnesses, we investigated the expression of proteins related to cell–cell adhesions mediated by E-cadherin in mESCs grown on various surfaces aer 3 days using immunouorescence staining. The results revealed that mESCs cultured on the smooth Au and the nanorough GNPL (Rq of 106 nm) were more tightly connected with each other and tended to form larger colonies. Besides, they maintained much stronger expression of E-cadherin (Fig. 7A and B). In contrast, the cell colonization was found to be much slower on the microrough GNPL (Rq of 1205 nm) and most cells were distributed randomly with much weaker expression of E-cadherin. A similar phenomenon was also observed in cells cultured on GNPLs with low and high submicroscale surface roughensses (Rq less than 392 nm and Rq greater than 573 nm, respectively). Cells grown on the GNPL with low sub-microscale surface roughness showed stronger
This journal is © The Royal Society of Chemistry 2014
Nanoscale
expression of E-cadherin while the cells grown on the GNPL with high sub-microscale surface roughness decreased signicantly in the expression of E-cadherin (see ESI Fig. 3†). In contrast, in the study of Chen et al., hESCs adhered to the nanorough glass surface demonstrated a much weaker expression of E-cadherin than the cells adhered to the smooth glass surface. The fact that b-catenin was also exclusively found in the cells cultured on the smooth Au and GNPLs with nanoscale (Fig. 7C) and low sub-microscale surface roughnesses (see ESI Fig. 3†) is indicative of strong AJs that support E-cadherin mediated cell– cell adhesions in mESC colonies. In contrast, the cells cultured on GNPLs with high sub-microscale (see ESI Fig. 3†) and microscale surface roughnesses (Fig. 7C) maintained much weaker expression of b-catenin. Combing the fact that Au and GNPLs with nanoscale and low sub-microscale surface roughnesses are supportive for the maintenance of mESC pluripotency in long-term culture, we can conclude that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) are conductive to cell colonization and allow tight cell–cell adhesions by the strong expression of proteins related to cell–cell adhesions, which in turn supports the maintenance of long-term cell pluripotency under feeder-free conditions. Topological sensing by integrin-mediated focal adhesions (FAs). Integrin-mediated focal adhesion to the ECM contributes to cell-matrix signalling by activating intracellular tyrosine kinase and phosphatise signalling to elicit downstream biochemical signals important for regulation of gene expression and stem cell fate.10 Importantly, integrin-mediated FA signalling is closely related to its molecular arrangement and dynamic organization, which can be affected directly by local topological cues.47 To investigate the likely involvement of integrin-mediated FA formation in regulating the topological sensing of mESCs, we examined the FA formation and organization of mESCs cultured on the smooth Au and GNPLs with different surface roughnesses by immunouorescence staining of vinculin, a FA protein. As shown in Fig. 8, aer 3 days of culture, mESCs exhibited distinct FA formations on the smooth Au and the nanorough GNPL (Rq of 106 nm). The expression of vinculin in mESCs cultured on Au and the nanorough GNPL was much stronger than that on the microrough GNPL (Rq of 1205 nm). And no obvious difference in the formations and organizations of FAs was found between cells cultured on the smooth Au and the nanorough GNPL. However, in the study of Chen et al., there was a signicant difference in the formations and organizations of FAs between cells cultured on the smooth glass surface and the nanorough glass surface. On the smooth glass surface, vinculin-containing FAs formed primarily on the periphery of the undifferentiated hESCs but distributed randomly on the nanorough surface. Moreover, relatively strong vinculin expression was also observed in the cells cultured on the GNPL with low sub-microscale surface roughness (Rq less than 392 nm) while the cells cultured on the GNPL with high submicroscale surface roughness (Rq greater than 573 nm) showed a obviously weaker expression of vinculin (see ESI Fig. 4†). Our
Nanoscale, 2014, 6, 6959–6969 | 6965
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
Paper
Fig. 7 Immunofluorescence images of mESCs on the smooth Au and GNPLs with nanoscale and microscale surface roughnesses after culture of 3 days. (A) The cells were costained for nuclei (DAPI; blue) and E-cadherin (red); (B) the cells were costained for cytoskeleton (Phalloidin; green) and E-cadherin (red); (C) the cells were costained for nuclei (DAPI; blue) and b-catenin (red). Bar, 50 mm.
Fig. 8 Immunofluorescence images of mESCs on the smooth Au and GNPLs with nanoscale and microscale surface roughnesses after culture of 3 days. The cells were costained for nuclei (DAPI; blue), cytoskeleton (Phalloidin; green) and vinculin (red). Bar, 50 mm.
results indicated that surface topography signicantly affected the formation of FAs in mESCs. GNPLs with nanoscale and low sub-microscale surface roughnesses are conductive to the formation of FAs in mESCs. In contrast, GNPLs with high submicroscale and microscale surface roughnesses signicantly decreased the formation of FAs, which might in turn result in faster spontaneous differentiation of mESCs. We think that there are several possible reasons for the contradiction between our results concerning the long-term pluripotency on the nanorough GNPL and the conclusions reached by Chen et al.10 First, the substrate prepared in our work is gold while the substrate studied by Chen et al. is glass. And this difference in the substrate type can result in different cell behaviors even under the same culture conditions.48 Second, in our study, the nanorough GNPL demonstrated a faster cell proliferation rate than the smooth Au aer culture of
6966 | Nanoscale, 2014, 6, 6959–6969
both 3 and 7 days, which was demonstrated by MTT results (see Fig. 4). In contrast, the nanorough glass substrate signicantly decreased the cell proliferation rate compared with the smooth glass substrate in Chen's study. Third, the cell–cell adhesions were observed to be very tight both on the nanorough GNPL and on the smooth Au, as demonstrated by the strong expression of E-cadherin (see Fig. 7). While the expression of E-cadherin was much weaker on the nanorough glass substrate than that on the smooth glass substrate in Chen's study. Fourth, our results showed that there was no obvious difference in the formations and organizations of FAs between the mESCs cultured on the nanorough GNPL and the smooth Au. While in the study of Chen et al., there is an obvious difference in the formations and organizations of FAs between the nanorough glass substrate and the smooth glass substrate. The vinculin-containing FAs formed primarily on the periphery of the undifferentiated
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Paper
hESCs on the smooth glass surface, but distributed randomly on the nanorough surface. Thus, the nanorough GNPL in the present study can provide good support for the long-term maintenance of mESC pluripotency under feeder-free conditions. The effect of surface roughness on osteoinduction behaviours of mESCs Cell morphology. It is now believed that rough surfaces induce better osteointegration in vivo than smooth surfaces,49 suggesting that surface roughness has a direct effect on osteoblast attachment, proliferation, and differentiation. To study the effect of the surface roughness on the osteoinduction of mESCs, cells were placed in osteoinduction media and cultured for additional periods of 3 and 7 days aer being cultured on various surfaces in mESC media for 3 days. DAPI and Flour 488 were used to stain the cell nucleus and cytoskeleton, respectively, to observe the cell shape. Aer 7 days, signicant morphological changes in the cell shape were observed in the cells seeded on Au, GL-1 and GL-2, whose surface roughnesses are less than 392 nm. As the cell colonies disappeared, which is a typical characteristic of embryonic stem cells, the cells migrated from the colonies and began to grow in the form of a monolayer. The resulting wellspread cells contained visible nuclei and irregular shapes, such as spindles and polygons; protrusions also formed (see Fig. 9A). In contrast, no obvious morphological change was observed in the cells cultured on GL-3, GL-4 and GL-5, which have roughnesses greater than 573 nm (see Fig. 9B). Thus, the loss of ESC characteristics and the development of osteoblast cell characteristics indicate that osteoinduction successfully occurred in the cells grown on the Au, GL-1, and GL-2 surfaces in osteoinduction media. Thus, our results demonstrated that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) are able to induce osteodifferentiation in
Nanoscale
osteoinduction media. In contrast, GNPLs with high submicroscale and microscale surface roughnesses (Rq greater than 573 nm) measurably weaken the osteodifferentiation ability of mESCs and result in poor osteodifferentiation behaviours. To induce better osteodifferentiation, ESCs have to be pluripotent before they are cultured in osteoinduciton media. However, spontaneous differentiation already happened in mESCs cultured on GNPLs with high sub-microscale and microscale surface roughnesses (GL-3, GL-4 and GL-5) before these samples were placed into osteoinduction media (see Fig. 5 and 6), which decreased the cell pluripotency. Thus, GNPLs with high submicroscale and microscale surface roughnesses exhibited poor osteoinduction behaviours. Alkaline phosphatase (ALP) activity. Alkaline phosphatase (ALP) activity, an initial indicator of osteodifferentiation,50,51
Fig. 10 ALP activity of mESCs cultured on various surfaces in osteoinduction media after 3 and 7 days. Data are the mean SD (n ¼ 3).
Fluorescence images of mESCs cultured for 7 days in osteoinduction media on different surfaces. The cells were co-stained for cytoskeleton (Phalloidin; green) and nuclei (DAPI; blue). (A) Au, GL-1, GL-2; (B) GL-3, GL-4, and GL-5. Bar, 50 mm. After culture of 7 days, significant morphological changes were found in the cells on Au, GL-1, GL-2 with surface roughness less than 392 nm whereas no obvious morphological change was observed in the cells on GL-3, GL-4 and GL-5, which have surface roughnesses greater than 573 nm. Fig. 9
This journal is © The Royal Society of Chemistry 2014
Nanoscale, 2014, 6, 6959–6969 | 6967
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Nanoscale
was detected in the cells grown on various surfaces for 3 days and 7 days in osteoinduction media. The ALP activity was monitored to characterize the osteoinduction status of the mESCs. As shown in Fig. 10, the ALP activity of the cells cultured on the smooth Au and on GL-1 and GL-2, whose surface roughnesses are less than 392 nm, was signicantly higher than that of the cells grown on GL-3, GL-4 and GL-5, whose surface roughnesses are greater than 573 nm. Furthermore, this tendency was more obvious aer 7 days. The ALP activity results are consistent with the morphological changes shown in Fig. 9. Together, these results indicate that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) can provide good support for the osteoinduction of mESCs, whereas GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm) signicantly decrease the osteodifferentiation ability of mESCs.
Conclusions In summary, we successfully prepared GNPLs with nano-, submicro- and microscale surface roughnesses via a convenient chemical plating method. The capacity of these GNPLs to regulate the behaviors of mESCs was investigated, leading to the following conclusions: (a) the MTT test showed that although the rough GNPLs decreased cell attachment, GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) provided better support for cell proliferation than did the smooth Au and GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm). (b) The consistent results from the Oct-4 immunouorescence staining and qPCR demonstrated that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) allowed the long-term pluripotency of mESCs to be maintained; the majority of the cells retained their stemness aer being cultured for 7 days on these surfaces in the absence of feeder cells; however, on GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm), the cells underwent faster spontaneous differentiation. Besides, the differentiation of cells on GNPLs with high sub-microscale and microscale surface roughnesses was undirectional, as demonstrated by the results from RT-PCR. (c) It was demonstrated by the results from immunouorescence staining of proteins related to E-cadherin mediated cell–cell adhesions and integrin-mediated focal adhesions (FAs) that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm) were supportive for the colonization of mESCs; cells were relatively more tightly connected with each other inside the colony and strongly expressed the proteins connected with E-cadherin mediated cell–cell adhesions and integrinmediated FAs, which in turn resulted in better maintenance of the long-term pluripotency of mESCs under feeder-free conditions. In contrast, GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm) signicantly decreased the cell colonization; cells were distributed randomly with much weaker expression of proteins related to E-cadherin mediated cell–cell adhesions and FAs, which led to a faster cell undirectional differentiation rate. (d) The results
6968 | Nanoscale, 2014, 6, 6959–6969
Paper
of the cell morphology staining and the ALP activity test were also consistent and suggested that GNPLs with nanoscale and low sub-microscale surface roughnesses (Rq less than 392 nm), which were able to maintain cell pluripotency, were conducive to the subsequent osteoinduction. In contrast, GNPLs with high sub-microscale and microscale surface roughnesses (Rq greater than 573 nm) signicantly reduced the cell pluripotency during long-term culture; these GNPLs also resulted in poor osteoinduction behaviors; together, these results provide important insights into the importance of a synthetic cell microenvironment for controlling and directing mESC behaviors that are desirable for functional tissue engineering and regenerative medicine.
Acknowledgements This work was supported by the National Natural Science Foundation of China (21104055, 21374070 and 21334004), the National Science Fund for Distinguished Young Scholars (21125418), and the Project of Scientic and Technologic Infrastructure of Suzhou (SZS201207).
Notes and references 1 A. Higuchi, Q.-D. Ling, Y.-A. Ko, Y. Chang and A. Umezawa, Chem. Rev., 2011, 111, 3021–3035. 2 A. Higuchi, Q.-D. Ling, S.-T. Hsu and A. Umezawa, Chem. Rev., 2012, 112, 4507–4540. 3 J. A. Thomson, J. Itskovitz-Eldor, S. S. Shapiro, M. A. Waknitz, J. J. Swiergiel, V. S. Marshall and J. M. Jones, Science, 1998, 282, 1145–1147. 4 B. E. Reubinoff, M. F. Pera, C.-Y. Fong, A. Trounson and A. Bongso, Nat. Biotechnol., 2000, 18, 399–404. 5 R. L. Judson, J. E. Babiarz, M. Venere and R. Blelloch, Nat. Biotechnol., 2009, 27, 459–461. 6 M. P. Lutolf, P. M. Gilbert and H. M. Blau, Nature, 2009, 462, 433–441. 7 M. Caiazzo, M. T. Dell'Anno, E. Dvoretskova, D. Lazarevic, S. Taverna, D. Leo, T. D. Sotnikova, A. Menegon, P. Roncaglia and G. Colciago, Nature, 2011, 476, 224–227. 8 K. Okita, T. Ichisaka and S. Yamanaka, Nature, 2007, 448, 313–317. 9 J. Yu, M. A. Vodyanik, K. Smuga-Otto, J. Antosiewicz-Bourget, J. L. Frane, S. Tian, J. Nie, G. A. Jonsdottir, V. Ruotti and R. Stewart, Science, 2007, 318, 1917–1920. 10 W. Chen, L. G. Villa-Diaz, Y. Sun, S. Weng, J. K. Kim, R. H. Lam, L. Han, R. Fan, P. H. Krebsbach and J. Fu, ACS Nano, 2012, 6, 4094–4103. 11 F. Chowdhury, Y. Li, Y.-C. Poh, T. Yokohama-Tamaki, N. Wang and T. S. Tanaka, PLoS One, 2010, 5, e15655. 12 Y. Sun, L. G. Villa-Diaz, R. H. Lam, W. Chen, P. H. Krebsbach and J. Fu, PLoS One, 2012, 7, e37178. 13 J. Harrison, S. Pattanawong, J. Forsythe, K. Gross, D. Nisbet, H. Beh, T. Scott, A. Trounson and R. Mollard, Biomaterials, 2004, 25, 4963–4970. 14 J. Tang, R. Peng and J. Ding, Biomaterials, 2010, 31, 2470– 2476.
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 10 April 2014. Downloaded by State University of New York at Stony Brook on 23/10/2014 19:42:54.
Paper
15 R. Peng, X. Yao and J. Ding, Biomaterials, 2011, 32, 8048– 8057. 16 W. Song, H. Lu, N. Kawazoe and G. Chen, J. Bioact. Compat. Polym., 2011, 26, 242–256. 17 W. Song, H. Lu, N. Kawazoe and G. Chen, Langmuir, 2011, 27, 6155–6162. 18 D. Bae, S.-H. Moon, B. G. Park, S.-J. Park, T. Jung, J. S. Kim, K. B. Lee and H.-M. Chung, Biomaterials, 2014, 35, 916–928. 19 M. R. Lee, K. W. Kwon, H. Jung, H. N. Kim, K. Y. Suh, K. Kim and K.-S. Kim, Biomaterials, 2010, 31, 4360–4366. 20 L. A. Smith, X. Liu, J. Hu, P. Wang and P. X. Ma, Tissue Eng., Part A, 2009, 15, 1855–1864. 21 K. Kieswetter, Z. Schwartz, T. Hummert, D. Cochran, J. Simpson, D. Dean and B. Boyan, J. Biomed. Mater. Res., 1996, 32, 55–63. 22 A. L. Raines, R. Olivares-Navarrete, M. Wieland, D. L. Cochran, Z. Schwartz and B. D. Boyan, Biomaterials, 2010, 31, 4909–4917. 23 D. Buser, R. Schenk, S. Steinemann, J. Fiorellini, C. Fox and H. Stich, J. Biomed. Mater. Res., 1991, 25, 889–902. 24 D. Cochran, R. Schenk, A. Lussi, F. Higginbottom and D. Buser, J. Biomed. Mater. Res., 1998, 40, 1–11. 25 D. L. Cochran, J. Periodontol., 1999, 70, 1523–1539. 26 D. L. Cochran, D. Buser, C. M. Ten Bruggenkate, D. Weingart, T. M. Taylor, J. P. Bernard, F. Peters and J. P. Simpson, Clin Oral Implants Res, 2002, 13, 144–153. 27 F. Zhou, D. Li, Z. Wu, B. Song, L. Yuan and H. Chen, Macromol. Biosci., 2012, 12, 1391–1400. 28 M. Bigerelle, A. Van Gorp and A. Iost, Polym. Eng. Sci., 2008, 48, 1725–1736. 29 L. A. Smith, X. Liu, J. Hu and P. X. Ma, Biomaterials, 2009, 30, 2516–2522. 30 M. M. Bradford, Anal. Biochem., 1976, 72, 248–254. 31 H. T. Aung, K. Schroder, S. R. Himes, K. Brion, W. van Zuylen, A. Trieu, H. Suzuki, Y. Hayashizaki, D. A. Hume and M. J. Sweet, FASEB J., 2006, 20, 1315–1327. 32 Y. Wang, F. Zhou, X. Liu, L. Yuan, D. Li, Y. Wang and H. Chen, ACS Appl. Mater. Interfaces, 2013, 5, 3816–3823. 33 F. Zhou, L. Yuan, H. Wang, D. Li and H. Chen, Langmuir, 2011, 27, 2155–2158.
This journal is © The Royal Society of Chemistry 2014
Nanoscale
34 K. Liu, X. Yao and L. Jiang, Chem. Soc. Rev., 2010, 39, 3240– 3255. 35 J. Wu, H.-J. Bai, X.-B. Zhang, J.-J. Xu and H.-Y. Chen, Langmuir, 2009, 26, 1191–1198. 36 R. G. Contreras, H. Sakagami, H. Nakajima and J. Shimada, In Vivo, 2010, 24, 513–517. 37 P. Jasinski, P. Zwolak, R. I. Vogel, V. Bodempudi, K. Terai, J. Galvez, D. Land and A. Z. Dudek, Invest. New Drugs, 2011, 29, 846–852. 38 T. Matsuta, H. Sakagami, M. Kitajima, H. Oizumi and T. Oizumi, In Vivo, 2011, 25, 751–755. 39 S. Sista, A. Nouri, Y. Li, C. Wen, P. D. Hodgson and G. Pande, J. Biomed. Mater. Res., Part A, 2013, 101, 3416–3430. 40 H. Wang, W. Jiang, L. Yuan, L. Wang and H. Chen, ACS Appl. Mater. Interfaces, 2013, 5, 1800–1805. 41 H. Niwa, J.-i. Miyazaki and A. G. Smith, Nat. Genet., 2000, 24, 372–376. 42 M. H. Rosner, M. A. Vigano, K. Ozato, P. M. Timmons, F. Poirie, P. W. Rigby and L. M. Staudt, Nature, 1990, 345, 686–692. 43 Y. Xu, X. Zhu, H. S. Hahm, W. Wei, E. Hao, A. Hayek and S. Ding, Proc. Natl. Acad. Sci. U. S. A., 2010, 107, 8129–8134. 44 H. Oda and M. Takeichi, J. Cell Biol., 2011, 193, 1137–1146. 45 D. Li, J. Zhou, L. Wang, M. E. Shin, P. Su, X. Lei, H. Kuang, W. Guo, H. Yang and L. Cheng, J. Cell Biol., 2010, 191, 631–644. 46 S. Yonemura, M. Itoh, A. Nagafuchi and S. Tsukita, J. Cell Sci., 1995, 108, 127–142. 47 V. Vogel and M. Sheetz, Nat. Rev. Mol. Cell Biol., 2006, 7, 265– 275. 48 H. Hakala, K. Rajala, M. Ojala, S. Panula, S. Areva, M. Kellom¨ aki, R. Suuronen and H. Skottman, Tissue Eng., Part A, 2009, 15, 1775–1785. 49 M. Vandrovcova, J. Hanus, M. Drabik, O. Kylian, H. Biederman, V. Lisa and L. Bacakova, J. Biomed. Mater. Res., Part A, 2012, 100, 1016–1032. 50 N. D. Evans, E. Gentleman, X. Chen, C. J. Roberts, J. M. Polak and M. M. Stevens, Biomaterials, 2010, 31, 3244–3252. 51 J. Kawaguchi, P. J. Mee and A. G. Smith, Bone, 2005, 36, 758– 769.
Nanoscale, 2014, 6, 6959–6969 | 6969
