Vol. 59, No. 3
INFECTION AND IMMUNITY, Mar. 1991, p. 829-835
0019-9567/91/030829-07$02.00/0 Copyright ©D 1991, American Society for Microbiology
Mapping the Minimal Contiguous Gene Segment That Encodes Functionally Active Shiga-Like Toxin II L. P. PERERA, J. E. SAMUEL,t R. K. HOLMES, AND A. D. O'BRIEN*
Department of Microbiology, Uniformed Services University of the Health Sciences, 4301 Jones Bridge Road, Bethesda, Maryland 208144799 Received 17 August 1990/Accepted 27 November 1990
Shiga-like toxin type II (SLT-II) is one of two antigenically distinct cytotoxins produced by enterohemorrhagic Escherichia coli that are believed to play a central role in the pathogenesis of enterohemorrhagic E. coli-induced disease. SLT-II is a bipartite toxin with an enzymatically active A subunit that inhibits protein synthesis and an oligomeric B subunit that binds to the glycolipid globotriaosylceramide on eukaryotic cells. In this study, functional boundaries of the slt-IT operon were mapped. Mutant proteins lacking the last four amino acids from the carboxy terminus of the 70-amino-acid mature SLT-II B polypeptide had no cytotoxic activity. However, when only two amino acids were removed from the carboxy terminus of the B subunit, the cytotoxic activity of the holotoxin was not altered drastically. Furthermore, a 21-amino-acid extension to the carboxy terminus of the SLT-II B polypeptide was tolerated with a minimum reduction in cytotoxic activity of the holotoxin. Deletion of the region coding for amino acids 3 through 18 of the 296-amino-acid mature SLT-II A polypeptide resulted in complete ablation of the cytotoxic activity of the holotoxin as well as abolition of the enzymatic activity of the A subunit. Thus, it appears that both 5'- and 3'-terminal coding sequences are essential for function of the slt-II operon.
Enterohemorrhagic Escherichia coli (EHEC) strains are recently emerging human pathogens associated with outbreaks of hemorrhagic colitis as well as sporadic cases of hemolytic uremic syndrome and thrombotic thrombocytopenic purpura in North America and Europe (10, 21, 23). Accumulating evidence indicates that the cytotoxins produced by EHEC, namely Shiga-like toxins (also called verocytotoxins), play a central role in the pathogenesis of EHEC-induced disease (11, 20, 29). Currently, two antigenically distinct Shiga-like toxins, Shiga-like toxin I (SLT-T) and SLT-TT, in EHEC have been identified (27, 30). On the basis of deduced amino acid sequences, SLT-I and SLT-1I have about 60% sequence homology and possess similar biological and biochemical properties (8, 20). These toxins are bipartite toxins that consist of an enzymatically active A subunit and a receptorbinding, oligomeric B subunit. The A subunit cleaves a specific adenine residue in the 28S ribosomal RNA in a manner identical to that of the plant toxin ricin, and this RNA N-glycosidase activity results in eukaryotic cell death due to inhibition of protein synthesis (3). The oligomeric B subunits of SLT-1 and SLT-IT bind to the same glycolipid receptor, globotriaosylceramide, on eukaryotic cells (14, 15). The purpose of this study was to better define the structure-function relationships of the Shiga-like toxins. We used deletion analysis to determine the amino-terminal and carboxy-terminal functional boundaries of SLT-II.
broth (16). Strain MV1190 was maintained in M9 minimal salt agar supplemented with glucose (0.2% [wt/vol]), thiamine (0.5 ,ug/ml), and NAD (1 ,ug/ml). When indicated, media were supplemented with ampicillin (200 p.g/ml) and chloramphenicol (34 ,ug/ml), both from Sigma Chemical Co., St. Louis, Mo. All restriction enzymes were purchased from Boehringer Mannheim Biochemicals (Indianapolis, Ind.), unless otherwise indicated. The Sequenase DNA sequencing kit was purchased from U. S. Biochemical Corp., Cleveland, Ohio. The Muta-Gene in vitro mutagenesis kit was purchased from Bio-Rad Laboratories (Richmond, Calif.). The in vitro protein synthesis kit was purchased from Stratagene Cloning Systems (La Jolla, Calif.). The radionuclides were purchased from NEN Research Products (Boston, Mass.). Plasmid pNN76, which carries the SLT-II operon (slt-IT), has been described earlier by Newland et al. (19). This plasmid was cut with Sphl and KpnI. The resultant 2.4-kb fragment with the entire slt-TI operon was subcloned into Bluescribe phagemid expression vector pBS(-) (Stratagene Cloning Systems), and the plasmid so generated was designated pLP15 (Fig. 1). Bal 31 exonuclease deletions. To determine the 3' (carboxyterminal) functional boundary of the slt-IT operon, pLP15 DNA was first digested with EcoRI to linearize the plasmid. The unique EcoRI site in pLP15 is approximately 200 bp downstream from the 3' end of the slt-II operon (Fig. 1). The linearized plasmid was then treated with Bal 31 exonuclease (Bethesda Research Laboratories) according to published procedures (1). Briefly, Bal 31 exonuclease was added to the linearized pLP15 DNA, and samples were then obtained at 10, 12.5, 15, 17.5, and 20 min of incubation at 30°C. These samples were placed in Eppendorf tubes that contained 3 RI of 0.5 M EDTA on dry ice. Next, the samples were pooled, and the DNA was extracted with phenol-chloroform and precipitated with ethanol. The DNA was resuspended in 50 ,ul of Tris-EDTA buffer. The ends of the deleted fragments were then filled with T4 DNA polymerase in the presence of deoxynucleoside triphosphate. The fragments were then
MATERIALS AND METHODS
Bacterial strains, media, and plasmid constructions. The E. coli K-12 strains and plasmids used in this study are listed in Table 1. Bacteria were grown exponentially at 37°C in 2YT *
Corresponding author.
t Present address: BioCarb Inc., Gaithersburg, MD 20879.
829
830
PERERA ET AL.
INFECT. IMMUN.
TABLE 1. Bacterial strains and plasmids used in this study
CJ236 DH5a MV1l90 pBS(-) pNN76 pLP15 pLP15Hpl pLP15Hp2 pLP15AHE pLP15AHH
Reference
Description or genotypea
plasmid
dut-1 ung-J thi-l relAJ(pCJ105 Cm9 supE44 AlacUl69 (4)80 lacZAM15) hsdR17 recAl endAl gyrA96 thi-l relAl supE A(srl-recA)306::Tn 10 (Tc) A(lac-proAB) thi [F' traD36 proAB laclqZ/& M15] Apr; phagemid expression vector pBR328 with slt-II; Apr pBS(-) with slt-I1; Apr pLP15 with a single HpaI site in slt-II A; Apr pLP15 with two HpaI sites in slt-II A; Apr pLP15Hpl with HpaI-EcoRV deletion in slt-II A; Apr pLP15Hp2 with Hpal-Hpal deletion in slt-1l A; Ap'
a Abbreviations: Tcr, Cmr, and Apr, resistance to tetracycline, chloramphenicol, and ampicillin, respectively. stx, Shiga toxin operon; slt-II, slt-Il A, gene for A subunit of SLT-II.
circularized by blunt-end ligation with T4 DNA ligase and transformed into E. coli DH5a. Colony screening by oligonucleotide probe hybridization. The pool of deletion mutants was first probed with an oligonucleotide probe (19-mer) which spanned the 43rd through 49th codons of the 70-amino-acid mature SLT-II B polypeptide to identify mutants that retained the coding sequences for at least 49 amino acid residues of the mature B polypeptide. Briefly, E. coli transformed with Bal 31-treated pLP15 was directly plated on nylon membrane filters (GeneScreen hybridization transfer membranes [NEN Research Products]) placed over 2YT agar plates with ampicillin (200 ,ug/ml). The plates were incubated at 37°C until bacterial colonies reached approximately 1 mm in diameter. Replica filters were made from the original membranes, and the colonies on the replica membrane were incubated on a 2YT agar plate with ampicillin until the colonies reached approximately 1 mm in diameter. Next, the replica filter was transferred onto a 2YT plate with chloramphenicol (0.15 ,ug/ml), and the plate was incubated at 37°C overnight (to amplify the plasmid copy number). The bacterial colonies on the nylon membrane were lysed, and the plasmid DNA was denatured according to published procedures (1). The filter was baked at 80°C for 1 h and then immersed in a prehybridization solution (6x SSC [lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate] [16]-5x Denhardt's solution [16]-20 mM NaH2PO4-500 ,g of sonically disrupted salmon sperm DNA per ml) for 2 h at 42°C. Next, the filter was immersed in a hybridization solution (0.4% sodium dodecyl sulfate [SDS]6x SSC-20 mM NaH2PO4-500 jig of sonically disrupted ,
13 5 13 Stratagene 19 This study This study This study This study This study
SLT-II operon;
salmon sperm DNA per ml) that contained the labeled oligonucleotide probe, and the filter was incubated overnight at 42°C. The probe (5' CAGTTGACAGGAATGACTG 3') was used after it was 5' end labeled with T4 polynucleotide kinase (Bethesda Research Laboratories) and [.y-32P]ATP at a specific activity of 1,000 to 3,000 Ci/mmol. The filter was washed three times at room temperature in 6x SSC that contained 0.1% SDS. A fourth and final wash was done at 45°C in 3 x SSC that contained 0.1% SDS. The filter was exposed at -70°C to an X-ray film with an intensifying screen (Kodak X-Omat). The colonies that elicited signals on the replica filter were identified. The corresponding colonies from the master filter were then picked, and the plasmid DNA was isolated from them and sequenced. DNA sequencing. Plasmid DNA was sequenced by using the Sequenase DNA sequencing kit (U. S. Biochemical Corp.) according to the double-stranded DNA sequencing protocol provided by the manufacturer, with the modification that 1 ,ul of undiluted Sequenase enzyme was used in each sequencing reaction. Oligonucleotide-directed, site-specific in vitro mutagenesis. To prepare single-strand DNA templates with misincorporated uracil, pLP15 was transformed into E. coli CJ236 (dutung ) according to the Hanahan method (5). The transformants were selected on plates containing both ampicillin (200 ,ug/ml) and chloramphenicol (34 jig/ml). E. coli CJ236 transformants were grown to an optical density at 600 nm of approximately 0.3 in 2YT containing ampicillin (200 jxg/ml) and chloramphenicol (34 jxg/ml). The cells were then infected with R408 helper phage (24) at a multiplicity of
RI Pst
WA
IT/M
Sph
sit-IIB
sit-IA
FIG. 1. A schematic map of the SphI-EcoRI fragment of pLP15. To generate pLP15, plasmid pNN76, which carries the slt-II operon (19), was cut with SphI and KpnI, and the resultant 2.4-kb fragment with the entire slt-II operon was subcloned into Bluescribe phagemid expression vector pBS(-). Naturally occurring restriction enzyme sites in the SphI-KpnI fragment are shown in standard type, and the new HpaI restriction enzyme sites and terminator codons (TAA) introduced by oligonucleotide-directed, site-specific mutagenesis are shown in shaded print. See text for specific descriptions of each construct made. The EcoRI site is in the vector downstream from the KpnI site and was used to create Bal 31 deletions of the slt-II B gene.
VOL. 59, 1991
infection of 10, and the infected cells were incubated for another 8 h at 37°C with vigorous shaking. This helper phage was used to rescue the noncoding strand of the slt-TI operon from the phagemid pLP15. Single-strand DNA was extracted from the rescued phage by phenol-chloroform extraction according to published procedures (16). To induce HpaI restriction sites into the slt-IT A gene and ochre terminators into the slt-IT B gene, single-strand DNA templates rescued from the recombinant phagemid pLP15 were used. The mutating oligonucleotide primer 5' CCCGGGAGTTAAC GATAGAC 3', corresponding to the coding strand, was used to introduce the first HpaI site by changing the third codon, TTT, of the mature A subunit of SLT-II to TTA. To introduce the second HpaI site, the mutating oligonucleotide primer 5' GTCTCTTCGTTAACTAGTATACGGAC 3', corresponding to the coding strand, was used to change the 18th codon, AAT, of the mature A subunit of SLT-II to ACT. The ochre terminator codons were introduced at either the 67th or the 69th codon of the mature SLT-II B subunit by using the mutating oligonucleotide primers 5' GTGCAGTTTAAT IAAGACTGAGGC 3' or 5' GCTGAAGTGCAGTAAAA TAATGACTGAGGC 3', respectively, which correspond to the coding strands. The oligonucleotide-directed, site-specific mutagenesis was done with the Muta-Gene in vitro mutagenesis kit (Bio-Rad Laboratories) according to the manufacturer's instructions. Cytotoxicity assay. The cytotoxicity assay was performed with either HeLa or Vero cells essentially as described earlier (4). Briefly, transformants were grown overnight at 37°C with vigorous shaking in 1 ml of 2YT with 200 pLg of ampicillin per ml. After the bacteria were pelleted by centrifugation (10,000 x g for 5 min), the culture supernatant was added to freshly seeded HeLa or Vero cells in 96-well microtiter plates (1 ,ul of bacterial culture supernatant per well in duplicate). The cytotoxic titers of the mutants were determined by 10-fold serial dilutions. The highest toxin dilution that caused lysis of 50% of the cell monolayer (CD50) was taken as the titer of each toxin. Dot blot ELISA. A dot blot enzyme-linked immunosorbent assay (ELISA) described previously (31) was used to determine the effects of mutations on immunoreactivity with the SLT-II-specific monoclonal antibodies (MAbs). Briefly, overnight cultures of E. coli expressing the wild-type or mutant toxin were subjected to sonic lysis, and after removal of cellular debris, the supernatants of the sonic lysates were concentrated by 60% ammonium sulfate precipitation of proteins. The concentrated sonic lysates were spotted on a nitrocellulose membrane and probed with an SLT-II-specific MAb. The MAbs used were specific for either the A subunit of SLT-II (liE10) (22) or the B subunit of SLT-II (BC5) (2). TLC overlay assay. The thin-layer chromatogram (TLC) overlay assay was done essentially as described previously (25). Briefly, total glycolipid extracts from HeLa and Vero cells, as well as purified neutral and acidic glycolipids serving as controls, were subjected to chromatography on aluminum-backed silica gel high-performance TLC plates (Silica Gel 60; E. Merck AG, Darmstadt, Federal Republic of Germany). The chromatograms were air dried before they were soaked in TBS-BSA buffer (100 mM Tris-HCI [pH 7.8] containing 150 mM NaCl and 1% bovine serum albumin) for 2 h at room temperature. The plates were then overlaid with the toxins in TBS-BSA buffer, incubated for 18 h at 4°C, and washed five times in cold phosphate-buffered saline (PBS). Next, the plates were overlaid for 1 h at room temperature with MAb llElO (specific for the A subunit of SLT-II) diluted in TBS-BSA buffer. The unbound MAb was removed
MUTATIONAL ANALYSIS OF SLT-II
831
by washing with PBS before adding '25I-labeled goat antimouse immunoglobulin G in TBS-BSA buffer. The plates were then incubated at room temperature for 1 h, washed four times in cold PBS, air dried, and subjected to autoradiography. In vitro translation assay. The effect of 5' deletions of the slt-II operon on the enzymatic activity of the SLT-II A subunit was determined by assessing the degree of inhibition of protein synthesis in an in vitro translation system (Stratagene Cloning Systems). Periplasmic extracts of E. coli expressing the deletion mutations were prepared as described by Hovde et al. (6). The mutants were grown for 24 h at 37°C with aeration in 300 ml of brain heart infusion medium (Difco Laboratories, Detroit, Mich.) supplemented with ampicillin (200 jig/ml). The cells were collected by centrifugation (5,000 x g for 10 min at 4°C) and washed three times in 300 ml of PBS. The washed cells were resuspended in 5 ml of PBS containing polymyxin B sulfate (2 mg/ml) and incubated at 4°C for 15 min. The polymyxin B-treated cells were pelleted by centrifugation (10,000 x g for 10 min at 4°C), and the supernatant (periplasmic extract) was collected and stored at -20°C. One microliter of this periplasmic extract was added to 20 ,jl of nuclease-treated rabbit reticulocyte lysate provided in the in vitro translation kit. This mixture was incubated at 30°C for 15 min, and then 100 ng of brome mosaic virus (BMV) RNA (Promega Corporation, Madison, Wis.) and 2 ,ul of [35S]methionine (10 VxCi) were added. The mixture was then incubated for 1 h at 30°C. The translated products were analyzed by autoradiography of SDS-polyacrylamide gels as described above. The controls included in the assay were a periplasmic extract of E. coli[pBS(-)] incubated with the rabbit reticulocyte lysate mixture and BMV RNA, a periplasmic extract of E. coli[pBS(-)] incubated with the reticulocyte lysate mixture without BMV RNA, and a periplasmic extract of E. coli(pLP15) incubated with the reticulocyte lysate mixture and BMV RNA.
RESULTS Mapping of the 3' functional boundary of the sit-IT operon. The first step was to coarsely map the 3' functional boundary of the slt-IT operon. To achieve this goal, progressive deletions of slt-II in linearized pLP15 were made with Bal 31 exonuclease under controlled conditions. The single disulfide linkage between the two cysteine residues encoded by codons 3 and 56 of the mature SLT-II B polypeptide has been shown to be critical for holotoxin activity (9). Thus, any deletion extending beyond the 56th codon will result in ablation of holotoxin activity because of disruption of the disulfide linkage. Therefore, in the present experiment, the pool of deletion mutants was first probed with an oligonucleotide probe (19-mer) which spanned the 43rd and 49th codons of the 70-amino-acid mature SLT-II B polypeptide to identify mutants that retained at least 49 amino acid residues of the mature B polypeptide. Twenty-five mutants which hybridized with the oligonucleotide probe were selected for further analysis. Nine of these 25 probe-positive mutants retained cytotoxic activity for HeLa cells. These nine cytotoxic mutants contained the entire coding region of the slt-II gene. However, in two of these cytotoxic mutants (pLP17 and pLP46) (Table 2), the terminator codon TGA at the 3' end of slt-II was removed by Bal 31 exonuclease, which resulted in the addition of vector-derived sequences to the coding sequence of the gene. These short vector-derived extensions continued until a new stop codon was encoun-
832
PERERA ET AL.
INFECT. IMMUN.
TABLE 2. Characteristics of Bal 31-deleted mutants of SLT-II B subunit No. of
Plasmida pLP15 pLP17 pLP22 pLP24 pLP25 pLP46
amino acids deleted from C terminus
None Nonee 2 5 9 Nonee
Amino acids added from vectorencoded sequences'
HeLa
cell
Immunoreactivity
CytotoxDc)ty 50)
with MAb BC5d
105 103
None PEWRMEIVSVNILLKFALNFC ALNFC RAVNGEWKL NCKR SGGTFRGNVRGTPICLFF
+++ +++
10
INFECTION AND IMMUNITY, Mar. 1991, p. 829-835
0019-9567/91/030829-07$02.00/0 Copyright ©D 1991, American Society for Microbiology
Mapping the Minimal Contiguous Gene Segment That Encodes Functionally Active Shiga-Like Toxin II L. P. PERERA, J. E. SAMUEL,t R. K. HOLMES, AND A. D. O'BRIEN*
Department of Microbiology, Uniformed Services University of the Health Sciences, 4301 Jones Bridge Road, Bethesda, Maryland 208144799 Received 17 August 1990/Accepted 27 November 1990
Shiga-like toxin type II (SLT-II) is one of two antigenically distinct cytotoxins produced by enterohemorrhagic Escherichia coli that are believed to play a central role in the pathogenesis of enterohemorrhagic E. coli-induced disease. SLT-II is a bipartite toxin with an enzymatically active A subunit that inhibits protein synthesis and an oligomeric B subunit that binds to the glycolipid globotriaosylceramide on eukaryotic cells. In this study, functional boundaries of the slt-IT operon were mapped. Mutant proteins lacking the last four amino acids from the carboxy terminus of the 70-amino-acid mature SLT-II B polypeptide had no cytotoxic activity. However, when only two amino acids were removed from the carboxy terminus of the B subunit, the cytotoxic activity of the holotoxin was not altered drastically. Furthermore, a 21-amino-acid extension to the carboxy terminus of the SLT-II B polypeptide was tolerated with a minimum reduction in cytotoxic activity of the holotoxin. Deletion of the region coding for amino acids 3 through 18 of the 296-amino-acid mature SLT-II A polypeptide resulted in complete ablation of the cytotoxic activity of the holotoxin as well as abolition of the enzymatic activity of the A subunit. Thus, it appears that both 5'- and 3'-terminal coding sequences are essential for function of the slt-II operon.
Enterohemorrhagic Escherichia coli (EHEC) strains are recently emerging human pathogens associated with outbreaks of hemorrhagic colitis as well as sporadic cases of hemolytic uremic syndrome and thrombotic thrombocytopenic purpura in North America and Europe (10, 21, 23). Accumulating evidence indicates that the cytotoxins produced by EHEC, namely Shiga-like toxins (also called verocytotoxins), play a central role in the pathogenesis of EHEC-induced disease (11, 20, 29). Currently, two antigenically distinct Shiga-like toxins, Shiga-like toxin I (SLT-T) and SLT-TT, in EHEC have been identified (27, 30). On the basis of deduced amino acid sequences, SLT-I and SLT-1I have about 60% sequence homology and possess similar biological and biochemical properties (8, 20). These toxins are bipartite toxins that consist of an enzymatically active A subunit and a receptorbinding, oligomeric B subunit. The A subunit cleaves a specific adenine residue in the 28S ribosomal RNA in a manner identical to that of the plant toxin ricin, and this RNA N-glycosidase activity results in eukaryotic cell death due to inhibition of protein synthesis (3). The oligomeric B subunits of SLT-1 and SLT-IT bind to the same glycolipid receptor, globotriaosylceramide, on eukaryotic cells (14, 15). The purpose of this study was to better define the structure-function relationships of the Shiga-like toxins. We used deletion analysis to determine the amino-terminal and carboxy-terminal functional boundaries of SLT-II.
broth (16). Strain MV1190 was maintained in M9 minimal salt agar supplemented with glucose (0.2% [wt/vol]), thiamine (0.5 ,ug/ml), and NAD (1 ,ug/ml). When indicated, media were supplemented with ampicillin (200 p.g/ml) and chloramphenicol (34 ,ug/ml), both from Sigma Chemical Co., St. Louis, Mo. All restriction enzymes were purchased from Boehringer Mannheim Biochemicals (Indianapolis, Ind.), unless otherwise indicated. The Sequenase DNA sequencing kit was purchased from U. S. Biochemical Corp., Cleveland, Ohio. The Muta-Gene in vitro mutagenesis kit was purchased from Bio-Rad Laboratories (Richmond, Calif.). The in vitro protein synthesis kit was purchased from Stratagene Cloning Systems (La Jolla, Calif.). The radionuclides were purchased from NEN Research Products (Boston, Mass.). Plasmid pNN76, which carries the SLT-II operon (slt-IT), has been described earlier by Newland et al. (19). This plasmid was cut with Sphl and KpnI. The resultant 2.4-kb fragment with the entire slt-TI operon was subcloned into Bluescribe phagemid expression vector pBS(-) (Stratagene Cloning Systems), and the plasmid so generated was designated pLP15 (Fig. 1). Bal 31 exonuclease deletions. To determine the 3' (carboxyterminal) functional boundary of the slt-IT operon, pLP15 DNA was first digested with EcoRI to linearize the plasmid. The unique EcoRI site in pLP15 is approximately 200 bp downstream from the 3' end of the slt-II operon (Fig. 1). The linearized plasmid was then treated with Bal 31 exonuclease (Bethesda Research Laboratories) according to published procedures (1). Briefly, Bal 31 exonuclease was added to the linearized pLP15 DNA, and samples were then obtained at 10, 12.5, 15, 17.5, and 20 min of incubation at 30°C. These samples were placed in Eppendorf tubes that contained 3 RI of 0.5 M EDTA on dry ice. Next, the samples were pooled, and the DNA was extracted with phenol-chloroform and precipitated with ethanol. The DNA was resuspended in 50 ,ul of Tris-EDTA buffer. The ends of the deleted fragments were then filled with T4 DNA polymerase in the presence of deoxynucleoside triphosphate. The fragments were then
MATERIALS AND METHODS
Bacterial strains, media, and plasmid constructions. The E. coli K-12 strains and plasmids used in this study are listed in Table 1. Bacteria were grown exponentially at 37°C in 2YT *
Corresponding author.
t Present address: BioCarb Inc., Gaithersburg, MD 20879.
829
830
PERERA ET AL.
INFECT. IMMUN.
TABLE 1. Bacterial strains and plasmids used in this study
CJ236 DH5a MV1l90 pBS(-) pNN76 pLP15 pLP15Hpl pLP15Hp2 pLP15AHE pLP15AHH
Reference
Description or genotypea
plasmid
dut-1 ung-J thi-l relAJ(pCJ105 Cm9 supE44 AlacUl69 (4)80 lacZAM15) hsdR17 recAl endAl gyrA96 thi-l relAl supE A(srl-recA)306::Tn 10 (Tc) A(lac-proAB) thi [F' traD36 proAB laclqZ/& M15] Apr; phagemid expression vector pBR328 with slt-II; Apr pBS(-) with slt-I1; Apr pLP15 with a single HpaI site in slt-II A; Apr pLP15 with two HpaI sites in slt-II A; Apr pLP15Hpl with HpaI-EcoRV deletion in slt-II A; Apr pLP15Hp2 with Hpal-Hpal deletion in slt-1l A; Ap'
a Abbreviations: Tcr, Cmr, and Apr, resistance to tetracycline, chloramphenicol, and ampicillin, respectively. stx, Shiga toxin operon; slt-II, slt-Il A, gene for A subunit of SLT-II.
circularized by blunt-end ligation with T4 DNA ligase and transformed into E. coli DH5a. Colony screening by oligonucleotide probe hybridization. The pool of deletion mutants was first probed with an oligonucleotide probe (19-mer) which spanned the 43rd through 49th codons of the 70-amino-acid mature SLT-II B polypeptide to identify mutants that retained the coding sequences for at least 49 amino acid residues of the mature B polypeptide. Briefly, E. coli transformed with Bal 31-treated pLP15 was directly plated on nylon membrane filters (GeneScreen hybridization transfer membranes [NEN Research Products]) placed over 2YT agar plates with ampicillin (200 ,ug/ml). The plates were incubated at 37°C until bacterial colonies reached approximately 1 mm in diameter. Replica filters were made from the original membranes, and the colonies on the replica membrane were incubated on a 2YT agar plate with ampicillin until the colonies reached approximately 1 mm in diameter. Next, the replica filter was transferred onto a 2YT plate with chloramphenicol (0.15 ,ug/ml), and the plate was incubated at 37°C overnight (to amplify the plasmid copy number). The bacterial colonies on the nylon membrane were lysed, and the plasmid DNA was denatured according to published procedures (1). The filter was baked at 80°C for 1 h and then immersed in a prehybridization solution (6x SSC [lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate] [16]-5x Denhardt's solution [16]-20 mM NaH2PO4-500 ,g of sonically disrupted salmon sperm DNA per ml) for 2 h at 42°C. Next, the filter was immersed in a hybridization solution (0.4% sodium dodecyl sulfate [SDS]6x SSC-20 mM NaH2PO4-500 jig of sonically disrupted ,
13 5 13 Stratagene 19 This study This study This study This study This study
SLT-II operon;
salmon sperm DNA per ml) that contained the labeled oligonucleotide probe, and the filter was incubated overnight at 42°C. The probe (5' CAGTTGACAGGAATGACTG 3') was used after it was 5' end labeled with T4 polynucleotide kinase (Bethesda Research Laboratories) and [.y-32P]ATP at a specific activity of 1,000 to 3,000 Ci/mmol. The filter was washed three times at room temperature in 6x SSC that contained 0.1% SDS. A fourth and final wash was done at 45°C in 3 x SSC that contained 0.1% SDS. The filter was exposed at -70°C to an X-ray film with an intensifying screen (Kodak X-Omat). The colonies that elicited signals on the replica filter were identified. The corresponding colonies from the master filter were then picked, and the plasmid DNA was isolated from them and sequenced. DNA sequencing. Plasmid DNA was sequenced by using the Sequenase DNA sequencing kit (U. S. Biochemical Corp.) according to the double-stranded DNA sequencing protocol provided by the manufacturer, with the modification that 1 ,ul of undiluted Sequenase enzyme was used in each sequencing reaction. Oligonucleotide-directed, site-specific in vitro mutagenesis. To prepare single-strand DNA templates with misincorporated uracil, pLP15 was transformed into E. coli CJ236 (dutung ) according to the Hanahan method (5). The transformants were selected on plates containing both ampicillin (200 ,ug/ml) and chloramphenicol (34 jig/ml). E. coli CJ236 transformants were grown to an optical density at 600 nm of approximately 0.3 in 2YT containing ampicillin (200 jxg/ml) and chloramphenicol (34 jxg/ml). The cells were then infected with R408 helper phage (24) at a multiplicity of
RI Pst
WA
IT/M
Sph
sit-IIB
sit-IA
FIG. 1. A schematic map of the SphI-EcoRI fragment of pLP15. To generate pLP15, plasmid pNN76, which carries the slt-II operon (19), was cut with SphI and KpnI, and the resultant 2.4-kb fragment with the entire slt-II operon was subcloned into Bluescribe phagemid expression vector pBS(-). Naturally occurring restriction enzyme sites in the SphI-KpnI fragment are shown in standard type, and the new HpaI restriction enzyme sites and terminator codons (TAA) introduced by oligonucleotide-directed, site-specific mutagenesis are shown in shaded print. See text for specific descriptions of each construct made. The EcoRI site is in the vector downstream from the KpnI site and was used to create Bal 31 deletions of the slt-II B gene.
VOL. 59, 1991
infection of 10, and the infected cells were incubated for another 8 h at 37°C with vigorous shaking. This helper phage was used to rescue the noncoding strand of the slt-TI operon from the phagemid pLP15. Single-strand DNA was extracted from the rescued phage by phenol-chloroform extraction according to published procedures (16). To induce HpaI restriction sites into the slt-IT A gene and ochre terminators into the slt-IT B gene, single-strand DNA templates rescued from the recombinant phagemid pLP15 were used. The mutating oligonucleotide primer 5' CCCGGGAGTTAAC GATAGAC 3', corresponding to the coding strand, was used to introduce the first HpaI site by changing the third codon, TTT, of the mature A subunit of SLT-II to TTA. To introduce the second HpaI site, the mutating oligonucleotide primer 5' GTCTCTTCGTTAACTAGTATACGGAC 3', corresponding to the coding strand, was used to change the 18th codon, AAT, of the mature A subunit of SLT-II to ACT. The ochre terminator codons were introduced at either the 67th or the 69th codon of the mature SLT-II B subunit by using the mutating oligonucleotide primers 5' GTGCAGTTTAAT IAAGACTGAGGC 3' or 5' GCTGAAGTGCAGTAAAA TAATGACTGAGGC 3', respectively, which correspond to the coding strands. The oligonucleotide-directed, site-specific mutagenesis was done with the Muta-Gene in vitro mutagenesis kit (Bio-Rad Laboratories) according to the manufacturer's instructions. Cytotoxicity assay. The cytotoxicity assay was performed with either HeLa or Vero cells essentially as described earlier (4). Briefly, transformants were grown overnight at 37°C with vigorous shaking in 1 ml of 2YT with 200 pLg of ampicillin per ml. After the bacteria were pelleted by centrifugation (10,000 x g for 5 min), the culture supernatant was added to freshly seeded HeLa or Vero cells in 96-well microtiter plates (1 ,ul of bacterial culture supernatant per well in duplicate). The cytotoxic titers of the mutants were determined by 10-fold serial dilutions. The highest toxin dilution that caused lysis of 50% of the cell monolayer (CD50) was taken as the titer of each toxin. Dot blot ELISA. A dot blot enzyme-linked immunosorbent assay (ELISA) described previously (31) was used to determine the effects of mutations on immunoreactivity with the SLT-II-specific monoclonal antibodies (MAbs). Briefly, overnight cultures of E. coli expressing the wild-type or mutant toxin were subjected to sonic lysis, and after removal of cellular debris, the supernatants of the sonic lysates were concentrated by 60% ammonium sulfate precipitation of proteins. The concentrated sonic lysates were spotted on a nitrocellulose membrane and probed with an SLT-II-specific MAb. The MAbs used were specific for either the A subunit of SLT-II (liE10) (22) or the B subunit of SLT-II (BC5) (2). TLC overlay assay. The thin-layer chromatogram (TLC) overlay assay was done essentially as described previously (25). Briefly, total glycolipid extracts from HeLa and Vero cells, as well as purified neutral and acidic glycolipids serving as controls, were subjected to chromatography on aluminum-backed silica gel high-performance TLC plates (Silica Gel 60; E. Merck AG, Darmstadt, Federal Republic of Germany). The chromatograms were air dried before they were soaked in TBS-BSA buffer (100 mM Tris-HCI [pH 7.8] containing 150 mM NaCl and 1% bovine serum albumin) for 2 h at room temperature. The plates were then overlaid with the toxins in TBS-BSA buffer, incubated for 18 h at 4°C, and washed five times in cold phosphate-buffered saline (PBS). Next, the plates were overlaid for 1 h at room temperature with MAb llElO (specific for the A subunit of SLT-II) diluted in TBS-BSA buffer. The unbound MAb was removed
MUTATIONAL ANALYSIS OF SLT-II
831
by washing with PBS before adding '25I-labeled goat antimouse immunoglobulin G in TBS-BSA buffer. The plates were then incubated at room temperature for 1 h, washed four times in cold PBS, air dried, and subjected to autoradiography. In vitro translation assay. The effect of 5' deletions of the slt-II operon on the enzymatic activity of the SLT-II A subunit was determined by assessing the degree of inhibition of protein synthesis in an in vitro translation system (Stratagene Cloning Systems). Periplasmic extracts of E. coli expressing the deletion mutations were prepared as described by Hovde et al. (6). The mutants were grown for 24 h at 37°C with aeration in 300 ml of brain heart infusion medium (Difco Laboratories, Detroit, Mich.) supplemented with ampicillin (200 jig/ml). The cells were collected by centrifugation (5,000 x g for 10 min at 4°C) and washed three times in 300 ml of PBS. The washed cells were resuspended in 5 ml of PBS containing polymyxin B sulfate (2 mg/ml) and incubated at 4°C for 15 min. The polymyxin B-treated cells were pelleted by centrifugation (10,000 x g for 10 min at 4°C), and the supernatant (periplasmic extract) was collected and stored at -20°C. One microliter of this periplasmic extract was added to 20 ,jl of nuclease-treated rabbit reticulocyte lysate provided in the in vitro translation kit. This mixture was incubated at 30°C for 15 min, and then 100 ng of brome mosaic virus (BMV) RNA (Promega Corporation, Madison, Wis.) and 2 ,ul of [35S]methionine (10 VxCi) were added. The mixture was then incubated for 1 h at 30°C. The translated products were analyzed by autoradiography of SDS-polyacrylamide gels as described above. The controls included in the assay were a periplasmic extract of E. coli[pBS(-)] incubated with the rabbit reticulocyte lysate mixture and BMV RNA, a periplasmic extract of E. coli[pBS(-)] incubated with the reticulocyte lysate mixture without BMV RNA, and a periplasmic extract of E. coli(pLP15) incubated with the reticulocyte lysate mixture and BMV RNA.
RESULTS Mapping of the 3' functional boundary of the sit-IT operon. The first step was to coarsely map the 3' functional boundary of the slt-IT operon. To achieve this goal, progressive deletions of slt-II in linearized pLP15 were made with Bal 31 exonuclease under controlled conditions. The single disulfide linkage between the two cysteine residues encoded by codons 3 and 56 of the mature SLT-II B polypeptide has been shown to be critical for holotoxin activity (9). Thus, any deletion extending beyond the 56th codon will result in ablation of holotoxin activity because of disruption of the disulfide linkage. Therefore, in the present experiment, the pool of deletion mutants was first probed with an oligonucleotide probe (19-mer) which spanned the 43rd and 49th codons of the 70-amino-acid mature SLT-II B polypeptide to identify mutants that retained at least 49 amino acid residues of the mature B polypeptide. Twenty-five mutants which hybridized with the oligonucleotide probe were selected for further analysis. Nine of these 25 probe-positive mutants retained cytotoxic activity for HeLa cells. These nine cytotoxic mutants contained the entire coding region of the slt-II gene. However, in two of these cytotoxic mutants (pLP17 and pLP46) (Table 2), the terminator codon TGA at the 3' end of slt-II was removed by Bal 31 exonuclease, which resulted in the addition of vector-derived sequences to the coding sequence of the gene. These short vector-derived extensions continued until a new stop codon was encoun-
832
PERERA ET AL.
INFECT. IMMUN.
TABLE 2. Characteristics of Bal 31-deleted mutants of SLT-II B subunit No. of
Plasmida pLP15 pLP17 pLP22 pLP24 pLP25 pLP46
amino acids deleted from C terminus
None Nonee 2 5 9 Nonee
Amino acids added from vectorencoded sequences'
HeLa
cell
Immunoreactivity
CytotoxDc)ty 50)
with MAb BC5d
105 103
None PEWRMEIVSVNILLKFALNFC ALNFC RAVNGEWKL NCKR SGGTFRGNVRGTPICLFF
+++ +++
10
