bs_bs_banner
Nephrology 20 (2015) 609–616
Original Article
Mast cell involvement in the progression of peritoneal fibrosis in rats with chronic renal failure ITSURO KAZAMA,1 ASUKA BABA,1,2 YASUHIRO ENDO,3 HIROAKI TOYAMA,3 YUTAKA EJIMA,3 MITSUNOBU MATSUBARA4 and MASAHIRO TACHI2 Departments of 1Physiology I and 2Plastic and Reconstructive Surgery, 4Division of Molecular Medicine, Center for Translational and Advanced Animal Research, Tohoku University Graduate School of Medicine, and 3Department of Anesthesiology, Tohoku University Hospital, Sendai, Japan
KEY WORDS: chronic renal failure, fibroblast-activating factors, mast cells, peritoneal fibrosis, tranilast. Correspondence: Dr Itsuro Kazama, Department of Physiology I, Tohoku University Graduate School of Medicine, Seiryo-cho, Aoba-ku, Sendai, Miyagi, 980-8575, Japan. Email: [email protected] Accepted for publication 11 April 2015. Accepted manuscript online 16 April 2015. doi:10.1111/nep.12489 Declaration of interest: The authors declare no conflicts of interest.
SUMMARY AT A GLANCE Using a rat model of CKD and peritoneal fibrosis, the authors demonstrated the possible involvement of mast cells in the pathogenesis of peritoneal fibrosis, as indicated by their increased numbers and activity.
ABSTRACT: Aim: Peritoneal fibrosis is a serious complication in patients with end stage renal disease (ESRD), especially those undergoing long-term peritoneal dialysis therapy. Since the peritoneum is a major site of mast cell accumulation, and since mast cells are known to facilitate the progression of organ fibrosis, they would also contribute to the pathogenesis of peritoneal fibrosis. The aim of this study was to reveal the involvement of mast cells in the progression of peritoneal fibrosis in chronic renal failure. Methods: Using a rat model with chronic renal failure (CRF) resulting from 5/6 nephrectomy, we examined the histopathological features of the rat peritoneum and compared them to those of age-matched sham-operated rat peritoneum. By treating the CRF rats with a potent mast cell stabilizer, tranilast, we also examined the involvement of mast cells in the progression of peritoneal fibrosis. Results: The CRF rat peritoneum was characterized by the wide staining of collagen III and an increased number of myofibroblasts, indicating the progression of fibrosis. Compared to sham-operated rat peritoneum, the number of toluidine blue-stained mast cells was significantly higher in the fibrotic peritoneum of CRF rats. The mRNA expression of fibroblastactivating factors and stem cell factor was significantly higher in peritoneal mast cells obtained from CRF rats than in those obtained from shamoperated rats. Treatment with tranilast significantly suppressed the progression of peritoneal fibrosis in CRF rats. Conclusions: This study demonstrated for the first time that the number of mast cells was significantly increased in the fibrotic peritoneum of CRF rats. The proliferation of mast cells and their increased activity in the peritoneum were thought to be responsible for the progression of peritoneal fibrosis.
Encapsulating peritoneal sclerosis (EPS) is a serious complication in patients with end-stage renal disease (ESRD) undergoing long-term peritoneal dialysis (PD) therapy.1 Using chemically induced animal models of EPS, previous studies demonstrated that external stimuli, such as PD solutions and infections, trigger the development of peritoneal fibrosis.2,3 However, peritoneal fibrosis can also be induced by chronic uraemia alone, indicating the involvement of inflammatory stimuli in its pathogenesis.4,5 By performing experiments with gene transfer into rat peritoneum, Margetts et al. revealed that inflammatory cytokines, such as interleukin-1β (IL-1β) and tumour necrosis factor-α (TNFα), were directly responsible for the development of perito© 2015 Asian Pacific Society of Nephrology
neal fibrosis.6 According to our previous study, these cytokines were produced by leukocytes that infiltrated into diseased organs and proliferated in situ.7 In an experimental model of peritoneal fibrosis, however, leukocytes, such as macrophages and lymphocytes, were not detected in the fibrotic peritoneum.8 Mast cells, which are also of hematopoietic origin, are known to produce cytokines in addition to their exocytotic release of chemokines.9 Recent advances in molecular biology further revealed that mast cells produce fibroblast growth factors in certain pathological conditions, such as inflammation,9 and thus facilitate the progression of organ fibrosis.10–12 Since chronic renal failure (CRF) is associated with a peripheral increase in mast cells,13 609
I Kazama et al.
and since the peritoneum is the site where mast cells predominantly accumulate,14 they are thought to contribute to the pathogenesis of peritoneal fibrosis in CRF. To clarify this, using a rat model of CRF, we examined the histopathological features of the peritoneum under chronic uraemia, and the involvement of infiltrated mast cells in the progression of peritoneal fibrosis. Here, we show for the first time that the number of mast cells was significantly increased in the fibrotic peritoneum of CRF rats. We also show that the proliferation of mast cells and their increased activity in the peritoneum were responsible for the progression of peritoneal fibrosis.
METHODS Animal preparation Rats with 5/6 nephrectomy and 8-week recovery periods were used as the model of CRF in the present study. Subtotal nephrectomy was performed in male Sprague–Dawley rats weighing 150–180 g (Japan SLC, Shizuoka, Japan) as described in our previous studies.7,15 Briefly, the upper third and lower third of the right kidney were ligated to induce infarction. One week later, the left kidney was removed. During the subsequent 8 weeks, rats had free access to standard rat chow and water ad libitum, and were maintained in a humidity- and temperature-controlled room on a 12-hour light-dark cycle. Age-matched sham-operated rats were used as controls. At the end of the recovery period, the rats were deeply anaesthetized with isoflurane and then killed by cervical dislocation. Parietal and visceral peritoneal walls were removed for histological examination. Trunk blood was withdrawn for measurement of the serum creatinine and urea nitrogen levels. All experimental protocols described in the present study were approved by the Ethics Review Committee for Animal Experimentation of Tohoku University.
Tranilast treatment Tranilast, purchased from Tokyo Chemical Industry (Tokyo, Japan), was suspended in water containing 1% methylcellulose (Wako Pure Chemicals, Japan) to prepare a concentration of 40 mg/mL. After subtotal nephrectomy, a group of CRF rats (n = 5) were subjected to oral administration of tranilast at a dose of 200 mg/kg body weight via a gastric tube daily for 8 weeks (tranilast-treated group). In previous studies using experimental animals with sclerosing organs,16,17 tranilast most effectively suppressed the progression of the organ fibrosis at a dose as high as 200 mg/kg. Therefore, we selected this dose in the present study. For another group of CRF rats (n = 5), 1% methylcellulose alone was administered daily for 8 weeks, and these rats were used as vehicle-treated controls (vehicletreated group). At the end of the 8-week recovery period, parietal peritoneal walls were removed for histological examination.
Histological analyses Cross sections of parietal peritoneum were fixed in 4% paraformaldehyde, embedded in paraffin, and deparaffinized in xylene, and then 3-μm sections were stained with hematoxylin-eosin (H&E) or 610
Masson’s trichrome. Bright-field images were acquired from randomly selected, nonoverlapping high-power fields of view (10 views from 5 sham-operated and 5 CRF rats, respectively). The thickness of the submesothelial space was measured in each field and averaged.
Immunohistochemistry The 3-μM paraffin sections of 4% paraformaldehyde-fixed parietal or visceral peritoneal walls were placed in citrate-buffered solution (pH 6.0) and then boiled for 30 min for antigen retrieval. Endogenous peroxidase was blocked with 3% hydrogen peroxide, and nonspecific binding was blocked with 10% BSA. Primary antibodies were as follows: mouse anti-collagen type III (1:100; Abnova, Taipei City, Taiwan), anti-α-smooth muscle actin (α-SMA) (1:100; Thermo Fisher Scientific, Cheshire, UK), anti-CD3 (1:25; DAKO, Glostrup, Denmark) and anti-ED-1 (1:50; AbD Serotec, Oxfordshire, UK). Diaminobenzidine substrate (Sigma Chemical Co., St. Louis, MO, USA) was used for the color reaction. Sections were counterstained with hematoxylin. The secondary antibody alone was consistently negative on all sections. Toluidine blue staining was performed by immersion of the sections in 0.1% toluidine blue (Muto Pure Chemical Co., Tokyo, Japan) for 30 min at room temperature. Mast cells were identified by their characteristic metachromasia. Brightfield images were acquired from randomly selected, nonoverlapping high-power fields of view (10 views from 5 sham-operated and 5 CRF rats, respectively). The collagen III deposition, expressed as percentages of collagen III-positive areas relative to the total area, was quantified and the numbers of α − SMA-positive cells or mast cells were counted in each field and averaged.
Immunofluorescence staining Immunofluorescence staining was performed as described previously.15 Primary antibodies used were mouse anti-mast cell tryptase (1:100; AbD Serotec, Oxfordshire, UK), co-stained with rabbit antiKi-67 (1:100; Lab Vision Co., Fremont, CA, USA). Fluorescent images were taken using a TE 2000-E Nikon Eclipse confocal microscope (Nikon, Tokyo, Japan). The secondary antibody alone was consistently negative on all sections.
Real-time RT-PCR Peritoneal cell suspensions were obtained by washing the peritoneal cavity with normal saline as described in our previous studies.18,19 Peritoneal mast cells were then isolated by velocity sedimentation at unit gravity.20 According to the literature, using this method, the yield of mast cells with an average purity of 95% was more than 75%. Additionally, in the present study, the purity of mast cells was actually determined by making a cytospin and staining with toluidine blue. Mast cells were also easily distinguishable from other cells by their intracellular inclusion of secretory granules.18,19 Total RNAs from freshly isolated mast cells were extracted using the RNeasy mini kit (Qiagen, Hilden, Germany). First-stand cDNA was synthesized from 2 μg of total RNA of each tissue in 20 μl of reaction mixture using the SuperScript VILO first-strand synthesis kit (Invitrogen, Carlsbad, CA, USA). The quantitative RT-PCR was carried out using the Applied Biosystems 7500 Real-Time PCR System (Life Technologies Inc, Gaithersburg, MD, USA) with SYBR Premix Ex Taq II (Takara Bio, Kyoto, Japan). The quantity of RNA © 2015 Asian Pacific Society of Nephrology
Mast cells in peritoneal fibrosis
Table 1 Primers used for quantitative real-time reverse transcriptase -polymerase chain reaction (RT-PCR) Gene
Primer
Product length (bp)
bFGF
Forward: GAACCGGTACCTGGCTATGA Reverse: TTCCGTGACCGGTAAGTGTT Forward: ACGAAAGCGCAAGAAATCCC Reverse: TTAACTCAAGCTGCCTCGCC Forward: GTCGTAGCAAACCACCAAG Reverse: AGAGAACCTGGGAGTAGATAAG Forward: TTCGCTTGTAATTGGCTTTGC Reverse: TTCAACTGCCCTTGTAAGACTTGA Forward: GGCACAGTCAAGGCTGAGAATG Reverse: ATGGTGGTGAAGACGCCAGTA
120
VEGF TNF-α SCF GAPDH
129 145 80 143
bFGF, basic fibroblast growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SCF, stem cell factor; TNF-α, tumour necrosis factor-α; VEGF, vascular endothelial growth factor.
samples was normalized by the expression level of GAPDH. The sequences of the primers used are listed in Table 1.
Other measurements and statistical analyses The serum creatinine and urea nitrogen levels were measured using a chemical autoanalyzer (DRI-CHEM 3500V; Fuji, Tokyo, Japan). Data were analyzed using Microsoft Excel (Microsoft Co., Redmond, WA, USA) and reported as means ± SEM. Statistical significance was assessed by two-way ANOVA followed by Dunnett’s or Student’s t test. A value of P < 0.05 was considered significant.
RESULTS Histological features of peritoneal walls in CRF rats The elevated serum creatinine (1.10 ± 0.06 vs. shamoperated 0.34 ± 0.02 mg/dl, n = 6, P < 0.05) and urea nitrogen (45.5 ± 4.80 vs. sham-operated 13.9 ± 1.28 mg/dl, n = 6, P < 0.05) levels in the nephrectomized rats indicated CRF with uraemia as a result of deteriorated renal function.7,15,21 Sections of the parietal peritoneal walls from sham-operated rats showed normal peritoneum, which was composed of a monolayer of flat mesothelial cells and a thin compact zone of mature fibrous tissue, on top of a massive layer of muscle fibers (Fig. 1Aa). In the peritoneum from CRF rats, however, the surface layer of mesothelial cells was almost completely destroyed (Fig. 1Ab). As previously reported,4,22 the submesothelial area was remarkably thickened with widely spaced fibrous tissue (Fig. 1Ad vs. c), which, downwards, was interposed between muscle fibers, loosening their bundled structure (Fig. 1Ad). Figure 1B shows the marked difference in the thickness of the submesothelial space between the sham-operated and CRF rat peritoneum.
Progression of peritoneal fibrosis in CRF rats In CRF rat peritoneum (Fig. 2Ab), the immunohistochemistry for collagen III, a marker of fibrosis, showed a © 2015 Asian Pacific Society of Nephrology
Fig. 1 Histological features of parietal peritoneal walls in sham-operated (sham) and chronic renal failure (CRF) rats. (A) Haematoxylin and eosin (H&E) and Masson’s trichrome staining, in sham-operated (sham) (a, c) and CRF (b, d) rat peritoneum. Magnification, ×20. (B) Thickness of submethothelial area was measured in sham-operated and CRF rat peritoneum. #P < 0.05 vs. shamoperated rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t-test.
wide range of staining in the thickened submesothelial space compared to the peritoneum from the sham-operated control rats (Fig. 2Aa). In the CRF rat peritoneum, the tissue deposition of collagen III, expressed as percentages of collagen III-positive areas relative to the total areas, was significantly increased (Fig. 2Ac), indicating the progression of peritoneal fibrosis. In sham-operated rat peritoneum, immunohistochemistry for α-SMA, a marker of myofibroblasts, was only weakly positive in several cells within the submesothelial compact zone or intramuscular spaces (Fig. 2Ba, arrow heads). In CRF rat peritoneum, however, the immunohistochemistry demonstrated a greater number of positively stained cells in the submesothelial space as well as in the loosened tissues between muscle fibers (Fig. 2Bb). Figure 2Bc shows the dramatic difference in the numbers of α-SMA positive cells between the sham-operated and CRF rat peritoneum. These results indicated that the number of 611
I Kazama et al.
Fig. 2 Fibrotic marker expression in parietal peritoneal walls of shamoperated (sham) and chronic renal failure (CRF) rats. (A) Immunohistochemistry using antibody for collagen III (brown) in sham-operated (a) and CRF (b) rat peritoneum. (c) Collagen III deposition was quantified and expressed as percentages of collagen III-positive areas relative to the total areas. (B) Immunohistochemistry using antibody for α-smooth muscle actin (α-SMA, brown) in sham-operated (a) and CRF (b) rat peritoneum. (c) α-SMApositive cells were counted in high-power views of sham-operated and CRF rat peritoneum. Magnification, ×20. #P < 0.05 vs. sham-operated rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t-test.
myofibroblasts was increased in CRF rat peritoneum, which may have facilitated the progression of peritoneal fibrosis (Figs 1 and 2A).
In situ proliferation of mast cells in the CRF rat peritoneum Mast cells are known to be increased in fibrotic tissues of sclerosing organs, such as in renal fibrosis,11,12 liver cirrhosis and myocardial infarction.10 Since mast cells are considered to be responsible for the progression of tissue fibrosis,9 and since a wide range of fibrosis was actually observed in CRF rat peritoneum (Figs 1,2A), we examined the numbers of 612
Fig. 3 Mast cells infiltration and proliferation in chronic renal failure (CRF) rat peritoneum. (A) Mast cells in sham-operated (sham) and CRF rat peritoneum. Toluidine blue staining of either parietal or visceral peritoneum in shamoperated (sham) (a, c) and CRF (b, d) rats. Magnification, ×20. (e, f) Toluidine blue-stained mast cells were counted in high-power fields of view in parietal (e) and visceral (f) peritonea (10 views from 6 sham-operated and CRF rat peritoneum, respectively). #P < 0.05 vs. sham-operated rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t test. (B) Immunofluorescence staining using an antibody for mast cell tryptase (green) co-stained with Ki-67 (red) in visceral peritoneal walls from CRF rats. A High-power view of visceral peritoneal wall. Magnification, ×60.
mast cells that had infiltrated into the CRF rat peritoneum (Fig. 3A). In both the parietal and visceral peritoneum of sham-operated rats (Fig. 3Aa,c), toluidine blue staining was only positive in a few mast cells within high-power views. In CRF rats, however, the staining showed a number of positive cells in both peritonea (Fig. 3Ab,d). Figure 3Ae and f show the differences in the numbers of toluidine blue-stained mast cells between sham-operated and CRF rat peritoneum, indicating that the number of peritoneal mast cells was significantly increased in CRF rats. Since these mast cells, which were positively stained with tryptase (Fig. 3B, green), were mostly co-stained with Ki-67 (red), they were thought to proliferate in situ in the CRF rat peritoneum. © 2015 Asian Pacific Society of Nephrology
Mast cells in peritoneal fibrosis
Fig. 5 Expression of fibroblast-activating factors and stem cell factor in peritoneal mast cells obtained from sham-operated (sham) and chronic renal failure (CRF) rats. The mRNA abundance of basic fibroblast growth factor (bFGF) (A), vascular endothelial growth factor (VEGF) (B), tumour necrosis factor-α (TNF-α) (C) and stem cell factor (SCF) (D) in mast cells obtained from the peritoneal cavity of sham-operated (sham) and CRF rats. #P < 0.05 vs. sham-operated rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t-test.
Fig. 4 Infiltration of inflammatory leukocytes in sham-operated (sham) and chronic renal failure (CRF) rat peritoneum. Immunohistochemistry using antibodies for CD3 (a, c) and ED-1 (b, d). (A) Mesenteric lymph nodes (a, b) and visceral peritoneum (c, d) from sham-operated rats. (B) Visceral peritoneum from CRF rats with 4 (a, b) or 8-week (c, d) recovery period after subtotal nephrectomy. Magnification, ×20.
Less infiltration of T-lymphocytes or macrophages in the CRF rat peritoneum To reveal whether the other types of inflammatory leukocytes, such as T-lymphocytes and macrophages, also infiltrate into the CRF rat peritoneum, we examined the expression of the markers for these cells. In the mesenteric lymph nodes from sham-operated rats, where inflammatory leukocytes are abundant, the immunohistochemistry for CD3 and ED-1 both demonstrated large numbers of positively stained cells (Fig. 4Aa,b). However, in the visceral peritoneum from these rats, the immunohistochemistry demonstrated negative staining with these markers (Fig. 4Ac,d). In the CRF rat peritoneum with 4 or 8-week recovery period after subtotal nephrectomy, only a few CD3- or ED-1positive cells were noted in several high-power fields (Fig. 4Ba–d, arrow heads). They were considered to be the inflammatory leukocytes, such as T-lymphocytes and macrophages, which may have been recruited by the chemokines released from the mast cells increased (Fig. 3). © 2015 Asian Pacific Society of Nephrology
However, the numbers of these inflammatory leukocytes were much less than those of the mast cells, which was consistent with the findings previously demonstrated in patients with encapsulating peritoneal sclerosis.8
Production of fibroblast-activating factors and stem cell factor from peritoneal mast cells In addition to their exocytotic release of numerous chemokines, such as serotonin and histamine, mast cells are known to produce several growth factors once they are activated.9 Among them are fibroblast-activating factors, such as basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF) and tumour necrosis factor-α (TNF-α), which promote the proliferation of fibroblasts and stimulate their activity to produce collagen.9 Since the number of myofibroblasts was actually increased in CRF rat peritoneum (Fig. 2B), we examined the expression of the fibroblastactivating factors synthesized in peritoneal mast cells (Fig. 5A–C). Compared to the mast cells obtained from sham-operated rats, the mRNA expressions of bFGF, VEGF and TNF-α were all significantly higher in the cells obtained from CRF rats (Fig. 5A–C). The mRNA expression of stem cell factor (SCF), which is a growth factor of mast cells themselves,9 was also significantly higher in those cells (Fig. 5D). These results suggested that mast cells in CRF rat peritoneum were more activated than those in 613
I Kazama et al.
tissue within the submesothelial space (Fig. 6Ab,d). However, it was not as widely spaced or loosely distributed as was observed in the vehicle-treated CRF rat peritoneum (Fig. 6Aa,c). The thickness of the submesothelial space was significantly smaller in the tranilast-treated CRF rat peritoneum (Fig. 6B), indicating that tranilast actually ameliorated the progression of peritoneal fibrosis. From these findings, the proliferation of mast cells and their increased activity in the peritoneum are thought to be strongly associated with the progression of peritoneal fibrosis in CRF.
DISCUSSION
Fig. 6 Histological features of parietal peritoneal walls in vehicle-treated and tranilast-treated chronic renal failure (CRF) rats. (A) Hematoxylin and eosin (H&E) and Masson’s trichrome staining, in vehicle-treated (a, c) and tranilasttreated (b, d) CRF rat peritoneum. Magnification, ×20. (B) Thickness of submethothelial area was measured in vehicle-treated and tranilast-treated CRF rat peritoneum. *P < 0.05 vs. vehicle-treated CRF rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t-test.
sham-operated rat peritoneum. The increased production of the fibroblast-activating factors is thought to be responsible for the proliferation and activation of the peritoneal myofibroblasts.
Therapeutic effects of a mast cell stabilizer, tranilast, on the progression of peritoneal fibrosis To obtain direct evidence that the proliferation of mast cells and their increased activity actually contributed to the progression of peritoneal fibrosis, we examined the histological features of the CRF rat peritoneum after treating the animals with tranilast, one of the most potent mast cell stabilizers23,24 (Fig. 6). In CRF rat peritoneum with vehicle-treatment, the submesothelial area was remarkably thickened with widely spaced fibrous tissue (Fig. 6Aa,c). The fibrous tissue spread downwards between the muscle fibers and loosened their bundled structure (Fig. 6Ac). In CRF rat peritoneum with tranilast-treatment, there was also an increase in the fibrous 614
Using experimental animal models of EPS, previous studies demonstrated that external chemical stimuli, such as lipopolysaccharide or chlorhexidine gluconate, trigger the development of peritoneal fibrosis.2,3 Therefore, It has generally been believed in patients with ESRD that the peritoneal fibrosis and the resultant peritoneal failure is primarily caused by the continuous or intermittent exposure to peritoneal dialysate, which is chemically characterized by a high osmolality, high glucose concentration and low pH.1 However, Williams et al. demonstrated that the peritoneal fibrosis also occurs in uraemic patients undergoing hemodialysis,4 indicating that uraemic substances alone can trigger the development of peritoneal fibrosis, irrespective of the external stimuli in the peritoneal dialysate. Using experimental animal models of CRF, Combet et al. further revealed that the increased production of nitric oxide in the systemic circulation may be responsible for the uraemia-induced peritoneal fibrosis.5 In the present study, using the rat model with subtotal nephrectomy, we confirmed the previous findings that chronic uraemia alone induces peritoneal fibrosis without the need of external chemical stimuli,5 and provided an additional evidence that mast cells are also involved in the uraemia-induced progression of peritoneal fibrosis. Previous studies demonstrated the increased levels of inflammatory cytokines, such as IL-1β and IL-6, in the ascites of patients or experimental animal models of EPS.8 Since these cytokines stimulate fibroblasts to produce collagen,7 and since their serum and ascites levels are both elevated in CRF patients,25 they were thought to be involved in the progression of peritoneal fibrosis in CRF. In the present study, however, in contrast to renal fibrosis, which is characterized by the massive infiltration of leukocytes such as lymphocytes and macrophages,7 we did not observe such an infiltration of leukocytes in the fibrotic peritoneum of CRF rats (Fig. 4B). Instead, we noted a significant increase in the numbers of mast cells in both the parietal and visceral peritoneum as a result of their in situ proliferation there (Fig. 3). These mast cells significantly increased their production of fibroblast-activating factors that stimulate the collagen synthesis (Fig. 5). Additionally, since the administration of tranilast, a mast cell stabilizer, actually ameliorated the © 2015 Asian Pacific Society of Nephrology
Mast cells in peritoneal fibrosis
progression of fibrosis in CRF rat peritoneum (Fig. 6), the mast cells were thought to be responsible for the progression of peritoneal fibrosis in CRF. Mast cells are of hematopoietic origin, and circulate only transiently as disguised progenitor cells, ultimately completing their maturation in peripheral connective tissues.9 Therefore, in contrast to the peritoneal dialysate, which ruin the peritoneal tissue directly from the most external mesothelial layers, the mast cells that reside within the submesothelial space may gradually damage the peritoneum from inside the tissue, which may result in the partial preservation of the external mesothelial layers (Fig. 2). In previous studies, numerous inflammatory cytokines or chemokines, such as IL-4 and IL-9, were identified as playing roles in recruiting mast cells into diseased organs.12 In CRF patients, since the serum cytokine levels are known to be elevated with the progression of renal dysfunction,25,26 the cytokines are thought to be responsible for the initial infiltration of mast cells into the peritoneum. Additionally, in the present study, the peritoneal mast cells from CRF rats produced more stem cell factor (SCF) than those from sham-operated rats (Fig. 5D). Since SCF, also known as a ‘mast cell growth factor’, stimulates the differentiation and the survival of mast cells themselves in addition to their proliferation,9 this factor may have exerted additive effects on the mast cell increase in the CRF rat peritoneum. Previous studies revealed the involvement of mast cells in the development of fibrosis in many organs, including kidney, skin, lung and liver.10–12 Therefore, for the treatment or protection against organ fibrosis, several pharmacological approaches to inhibit the activation of mast cells, such as the use of mast cell stabilizers27,28 or chemokine inhibitors,29,30 have been suggested. In the present study, tranilast, one of the most potent mast cell stabilizers,23,24 whose therapeutic efficacy as an anti-fibrotic agent has also been demonstrated in sclerosing organs,16,17,28 actually ameliorated the progression of peritoneal fibrosis (Fig. 6). In our recent in vitro studies, the cationic and relatively lipophilic drugs, such as chlorpromazine and olopatadine, which are partitioned preferentially into the inner leaflets of lipid bilayers, generated inward membrane-bending in mast cells and thus counteracted the process of exocytosis.18,19 Given the pharmacological properties of these drugs in mast cell stabilization, the administration of chlorpromazine or olopatadine could also be useful for the treatment of peritoneal fibrosis. In summary, this study demonstrated for the first time that the number of mast cells was significantly increased in the fibrotic peritoneum of CRF rats. The proliferation of mast cells and their increased activity in the peritoneum are thought to be responsible for the progression of peritoneal fibrosis.
ACKNOWLEDGEMENTS We thank Ms. Fumiko Date, Ms. Miki Yoshizawa and their colleagues at Biomedical Research Core of Tohoku University © 2015 Asian Pacific Society of Nephrology
Graduate School of Medicine for their technical support. This work was supported by Miyagi Kidney Foundation Grant and MEXT KAKENHI Grant Number 25860155.
REFERENCES 1. Kawaguchi Y, Kawanishi H, Mujais S, Topley N, Oreopoulos DG. Encapsulating peritoneal sclerosis: Definition, etiology, diagnosis, and treatment. International Society for Peritoneal Dialysis Ad Hoc Committee on Ultrafiltration Management in Peritoneal Dialysis. Perit. Dial. Int. 2000; 20 (Suppl 4): S43–55. 2. Margetts PJ, Kolb M, Yu L, Hoff CM, Gauldie J. A chronic inflammatory infusion model of peritoneal dialysis in rats. Perit. Dial. Int. 2001; 21 (Suppl 3): S368–72. 3. Nakamoto H, Imai H, Ishida Y et al. New animal models for encapsulating peritoneal sclerosis–role of acidic solution. Perit. Dial. Int. 2001; 21 (Suppl 3): S349–53. 4. Williams JD, Craig KJ, Topley N et al. Morphologic changes in the peritoneal membrane of patients with renal disease. J. Am. Soc. Nephrol. 2002; 13: 470–79. 5. Combet S, Ferrier ML, Van Landschoot M et al. Chronic uremia induces permeability changes, increased nitric oxide synthase expression, and structural modifications in the peritoneum. J. Am. Soc. Nephrol. 2001; 12: 2146–57. 6. Margetts PJ, Kolb M, Yu L et al. Inflammatory cytokines, angiogenesis, and fibrosis in the rat peritoneum. Am. J. Pathol. 2002; 160: 2285–94. 7. Kazama I, Maruyama Y, Endo Y et al. Overexpression of delayed rectifier K(+) channels promotes in situ proliferation of leukocytes in rat kidneys with advanced chronic renal failure. Int. J. Nephrol. 2012; 2012: 581581. 8. Imai H, Nakamoto H, Fukushima R, Ishida Y, Yamanouchi Y, Suzuki H. Role of adhesion molecules in the progression of peritoneal sclerosis. Adv. Perit. Dial. 2003; 19: 180–85. 9. Gruber BL. Mast cells in the pathogenesis of fibrosis. Curr. Rheumatol. Rep. 2003; 5: 147–53. 10. Gruber BL. Mast cells: Accessory cells which potentiate fibrosis. Int. Rev. Immunol. 1995; 12: 259–79. 11. Holdsworth SR, Summers SA. Role of mast cells in progressive renal diseases. J. Am. Soc. Nephrol. 2008; 19: 2254–61. 12. Blank U, Essig M, Scandiuzzi L, Benhamou M, Kanamaru Y. Mast cells and inflammatory kidney disease. Immunol. Rev. 2007; 217: 79–95. 13. Patel TS, Freedman BI, Yosipovitch G. An update on pruritus associated with CKD. Am. J. Kidney Dis. 2007; 50: 11–20. 14. Malbec O, Roget K, Schiffer C et al. Peritoneal cell-derived mast cells: An in vitro model of mature serosal-type mouse mast cells. J. Immunol. 2007; 178: 6465–75. 15. Kazama I, Baba A, Matsubara M, Endo Y, Toyama H, Ejima Y. Benidipine suppresses in situ proliferation of leukocytes and slows the progression of renal fibrosis in rat kidneys with advanced chronic renal failure. Nephron Exp. Nephrol. 2014; 128: 67–79. 16. Tan SM, Zhang Y, Cox AJ, Kelly DJ, Qi W. Tranilast attenuates the up-regulation of thioredoxin-interacting protein and oxidative stress in an experimental model of diabetic nephropathy. Nephrol. Dial. Transplant. 2011; 26: 100–10. 17. Hanada M, Tsutsumi K, Arima H et al. Evaluation of the effect of tranilast on rats with spinal cord injury. J. Neurol. Sci. 2014; 346: 209–15. 18. Kazama I, Maruyama Y, Takahashi S, Kokumai T. Amphipaths differentially modulate membrane surface deformation in rat
615
I Kazama et al.
19.
20.
21.
22.
23.
24.
616
peritoneal mast cells during exocytosis. Cell. Physiol. Biochem. 2013; 31: 592–600. Baba A, Tachi M, Maruyama Y, Kazama I. Olopatadine inhibits exocytosis in rat peritoneal mast cells by counteracting membrane surface deformation. Cell. Physiol. Biochem. 2015; 35: 386–96. Dullens HF, Van Basten C, De Weger RA, Den Otter W. Isolation of mast cells from murine peritoneal cell populations by velocity sedimentation at unit gravity. J. Immunol. Methods 1981; 40: 367–72. Michimata M, Kazama I, Mizukami K et al. Urinary concentration defect and limited expression of sodium cotransporter, rBSC1, in a rat model of chronic renal failure. Nephron Physiol. 2003; 93: 34–41. Miyazaki M, Yuzawa Y. The role of peritoneal fibrosis in encapsulating peritoneal sclerosis. Perit. Dial. Int. 2005; 25 (Suppl 4): S48–56. Nishigaki T. Mast cell degranulation and its inhibition by an anti-allergic agent tranilast. An electron microscopic study. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 1988; 55: 311–22. Rogosnitzky M, Danks R, Kardash E. Therapeutic potential of tranilast, an anti-allergy drug, in proliferative disorders. Anticancer Res. 2012; 32: 2471–8.
25. Barreto DV, Barreto FC, Liabeuf S et al. Plasma interleukin-6 is independently associated with mortality in both hemodialysis and pre-dialysis patients with chronic kidney disease. Kidney Int. 2010; 77: 550–56. 26. Kaysen GA, Kumar V. Inflammation in ESRD: Causes and potential consequences. J. Ren. Nutr. 2003; 13: 158–60. 27. Miyajima A, Asano T, Yoshimura I, Seta K, Hayakawa M. Tranilast ameliorates renal tubular damage in unilateral ureteral obstruction. J. Urol. 2001; 165: 1714–18. 28. Kelly DJ, Zhang Y, Gow R, Gilbert RE. Tranilast attenuates structural and functional aspects of renal injury in the remnant kidney model. J. Am. Soc. Nephrol. 2004; 15: 2619–29. 29. Doggrell SA, Wanstall JC. Cardiac chymase: Pathophysiological role and therapeutic potential of chymase inhibitors. Can. J. Physiol. Pharmacol. 2005; 83: 123–30. 30. Shiota N, Kakizoe E, Shimoura K, Tanaka T, Okunishi H. Effect of mast cell chymase inhibitor on the development of scleroderma in tight-skin mice. Br. J. Pharmacol. 2005; 145: 424–31.
© 2015 Asian Pacific Society of Nephrology
Nephrology 20 (2015) 609–616
Original Article
Mast cell involvement in the progression of peritoneal fibrosis in rats with chronic renal failure ITSURO KAZAMA,1 ASUKA BABA,1,2 YASUHIRO ENDO,3 HIROAKI TOYAMA,3 YUTAKA EJIMA,3 MITSUNOBU MATSUBARA4 and MASAHIRO TACHI2 Departments of 1Physiology I and 2Plastic and Reconstructive Surgery, 4Division of Molecular Medicine, Center for Translational and Advanced Animal Research, Tohoku University Graduate School of Medicine, and 3Department of Anesthesiology, Tohoku University Hospital, Sendai, Japan
KEY WORDS: chronic renal failure, fibroblast-activating factors, mast cells, peritoneal fibrosis, tranilast. Correspondence: Dr Itsuro Kazama, Department of Physiology I, Tohoku University Graduate School of Medicine, Seiryo-cho, Aoba-ku, Sendai, Miyagi, 980-8575, Japan. Email: [email protected] Accepted for publication 11 April 2015. Accepted manuscript online 16 April 2015. doi:10.1111/nep.12489 Declaration of interest: The authors declare no conflicts of interest.
SUMMARY AT A GLANCE Using a rat model of CKD and peritoneal fibrosis, the authors demonstrated the possible involvement of mast cells in the pathogenesis of peritoneal fibrosis, as indicated by their increased numbers and activity.
ABSTRACT: Aim: Peritoneal fibrosis is a serious complication in patients with end stage renal disease (ESRD), especially those undergoing long-term peritoneal dialysis therapy. Since the peritoneum is a major site of mast cell accumulation, and since mast cells are known to facilitate the progression of organ fibrosis, they would also contribute to the pathogenesis of peritoneal fibrosis. The aim of this study was to reveal the involvement of mast cells in the progression of peritoneal fibrosis in chronic renal failure. Methods: Using a rat model with chronic renal failure (CRF) resulting from 5/6 nephrectomy, we examined the histopathological features of the rat peritoneum and compared them to those of age-matched sham-operated rat peritoneum. By treating the CRF rats with a potent mast cell stabilizer, tranilast, we also examined the involvement of mast cells in the progression of peritoneal fibrosis. Results: The CRF rat peritoneum was characterized by the wide staining of collagen III and an increased number of myofibroblasts, indicating the progression of fibrosis. Compared to sham-operated rat peritoneum, the number of toluidine blue-stained mast cells was significantly higher in the fibrotic peritoneum of CRF rats. The mRNA expression of fibroblastactivating factors and stem cell factor was significantly higher in peritoneal mast cells obtained from CRF rats than in those obtained from shamoperated rats. Treatment with tranilast significantly suppressed the progression of peritoneal fibrosis in CRF rats. Conclusions: This study demonstrated for the first time that the number of mast cells was significantly increased in the fibrotic peritoneum of CRF rats. The proliferation of mast cells and their increased activity in the peritoneum were thought to be responsible for the progression of peritoneal fibrosis.
Encapsulating peritoneal sclerosis (EPS) is a serious complication in patients with end-stage renal disease (ESRD) undergoing long-term peritoneal dialysis (PD) therapy.1 Using chemically induced animal models of EPS, previous studies demonstrated that external stimuli, such as PD solutions and infections, trigger the development of peritoneal fibrosis.2,3 However, peritoneal fibrosis can also be induced by chronic uraemia alone, indicating the involvement of inflammatory stimuli in its pathogenesis.4,5 By performing experiments with gene transfer into rat peritoneum, Margetts et al. revealed that inflammatory cytokines, such as interleukin-1β (IL-1β) and tumour necrosis factor-α (TNFα), were directly responsible for the development of perito© 2015 Asian Pacific Society of Nephrology
neal fibrosis.6 According to our previous study, these cytokines were produced by leukocytes that infiltrated into diseased organs and proliferated in situ.7 In an experimental model of peritoneal fibrosis, however, leukocytes, such as macrophages and lymphocytes, were not detected in the fibrotic peritoneum.8 Mast cells, which are also of hematopoietic origin, are known to produce cytokines in addition to their exocytotic release of chemokines.9 Recent advances in molecular biology further revealed that mast cells produce fibroblast growth factors in certain pathological conditions, such as inflammation,9 and thus facilitate the progression of organ fibrosis.10–12 Since chronic renal failure (CRF) is associated with a peripheral increase in mast cells,13 609
I Kazama et al.
and since the peritoneum is the site where mast cells predominantly accumulate,14 they are thought to contribute to the pathogenesis of peritoneal fibrosis in CRF. To clarify this, using a rat model of CRF, we examined the histopathological features of the peritoneum under chronic uraemia, and the involvement of infiltrated mast cells in the progression of peritoneal fibrosis. Here, we show for the first time that the number of mast cells was significantly increased in the fibrotic peritoneum of CRF rats. We also show that the proliferation of mast cells and their increased activity in the peritoneum were responsible for the progression of peritoneal fibrosis.
METHODS Animal preparation Rats with 5/6 nephrectomy and 8-week recovery periods were used as the model of CRF in the present study. Subtotal nephrectomy was performed in male Sprague–Dawley rats weighing 150–180 g (Japan SLC, Shizuoka, Japan) as described in our previous studies.7,15 Briefly, the upper third and lower third of the right kidney were ligated to induce infarction. One week later, the left kidney was removed. During the subsequent 8 weeks, rats had free access to standard rat chow and water ad libitum, and were maintained in a humidity- and temperature-controlled room on a 12-hour light-dark cycle. Age-matched sham-operated rats were used as controls. At the end of the recovery period, the rats were deeply anaesthetized with isoflurane and then killed by cervical dislocation. Parietal and visceral peritoneal walls were removed for histological examination. Trunk blood was withdrawn for measurement of the serum creatinine and urea nitrogen levels. All experimental protocols described in the present study were approved by the Ethics Review Committee for Animal Experimentation of Tohoku University.
Tranilast treatment Tranilast, purchased from Tokyo Chemical Industry (Tokyo, Japan), was suspended in water containing 1% methylcellulose (Wako Pure Chemicals, Japan) to prepare a concentration of 40 mg/mL. After subtotal nephrectomy, a group of CRF rats (n = 5) were subjected to oral administration of tranilast at a dose of 200 mg/kg body weight via a gastric tube daily for 8 weeks (tranilast-treated group). In previous studies using experimental animals with sclerosing organs,16,17 tranilast most effectively suppressed the progression of the organ fibrosis at a dose as high as 200 mg/kg. Therefore, we selected this dose in the present study. For another group of CRF rats (n = 5), 1% methylcellulose alone was administered daily for 8 weeks, and these rats were used as vehicle-treated controls (vehicletreated group). At the end of the 8-week recovery period, parietal peritoneal walls were removed for histological examination.
Histological analyses Cross sections of parietal peritoneum were fixed in 4% paraformaldehyde, embedded in paraffin, and deparaffinized in xylene, and then 3-μm sections were stained with hematoxylin-eosin (H&E) or 610
Masson’s trichrome. Bright-field images were acquired from randomly selected, nonoverlapping high-power fields of view (10 views from 5 sham-operated and 5 CRF rats, respectively). The thickness of the submesothelial space was measured in each field and averaged.
Immunohistochemistry The 3-μM paraffin sections of 4% paraformaldehyde-fixed parietal or visceral peritoneal walls were placed in citrate-buffered solution (pH 6.0) and then boiled for 30 min for antigen retrieval. Endogenous peroxidase was blocked with 3% hydrogen peroxide, and nonspecific binding was blocked with 10% BSA. Primary antibodies were as follows: mouse anti-collagen type III (1:100; Abnova, Taipei City, Taiwan), anti-α-smooth muscle actin (α-SMA) (1:100; Thermo Fisher Scientific, Cheshire, UK), anti-CD3 (1:25; DAKO, Glostrup, Denmark) and anti-ED-1 (1:50; AbD Serotec, Oxfordshire, UK). Diaminobenzidine substrate (Sigma Chemical Co., St. Louis, MO, USA) was used for the color reaction. Sections were counterstained with hematoxylin. The secondary antibody alone was consistently negative on all sections. Toluidine blue staining was performed by immersion of the sections in 0.1% toluidine blue (Muto Pure Chemical Co., Tokyo, Japan) for 30 min at room temperature. Mast cells were identified by their characteristic metachromasia. Brightfield images were acquired from randomly selected, nonoverlapping high-power fields of view (10 views from 5 sham-operated and 5 CRF rats, respectively). The collagen III deposition, expressed as percentages of collagen III-positive areas relative to the total area, was quantified and the numbers of α − SMA-positive cells or mast cells were counted in each field and averaged.
Immunofluorescence staining Immunofluorescence staining was performed as described previously.15 Primary antibodies used were mouse anti-mast cell tryptase (1:100; AbD Serotec, Oxfordshire, UK), co-stained with rabbit antiKi-67 (1:100; Lab Vision Co., Fremont, CA, USA). Fluorescent images were taken using a TE 2000-E Nikon Eclipse confocal microscope (Nikon, Tokyo, Japan). The secondary antibody alone was consistently negative on all sections.
Real-time RT-PCR Peritoneal cell suspensions were obtained by washing the peritoneal cavity with normal saline as described in our previous studies.18,19 Peritoneal mast cells were then isolated by velocity sedimentation at unit gravity.20 According to the literature, using this method, the yield of mast cells with an average purity of 95% was more than 75%. Additionally, in the present study, the purity of mast cells was actually determined by making a cytospin and staining with toluidine blue. Mast cells were also easily distinguishable from other cells by their intracellular inclusion of secretory granules.18,19 Total RNAs from freshly isolated mast cells were extracted using the RNeasy mini kit (Qiagen, Hilden, Germany). First-stand cDNA was synthesized from 2 μg of total RNA of each tissue in 20 μl of reaction mixture using the SuperScript VILO first-strand synthesis kit (Invitrogen, Carlsbad, CA, USA). The quantitative RT-PCR was carried out using the Applied Biosystems 7500 Real-Time PCR System (Life Technologies Inc, Gaithersburg, MD, USA) with SYBR Premix Ex Taq II (Takara Bio, Kyoto, Japan). The quantity of RNA © 2015 Asian Pacific Society of Nephrology
Mast cells in peritoneal fibrosis
Table 1 Primers used for quantitative real-time reverse transcriptase -polymerase chain reaction (RT-PCR) Gene
Primer
Product length (bp)
bFGF
Forward: GAACCGGTACCTGGCTATGA Reverse: TTCCGTGACCGGTAAGTGTT Forward: ACGAAAGCGCAAGAAATCCC Reverse: TTAACTCAAGCTGCCTCGCC Forward: GTCGTAGCAAACCACCAAG Reverse: AGAGAACCTGGGAGTAGATAAG Forward: TTCGCTTGTAATTGGCTTTGC Reverse: TTCAACTGCCCTTGTAAGACTTGA Forward: GGCACAGTCAAGGCTGAGAATG Reverse: ATGGTGGTGAAGACGCCAGTA
120
VEGF TNF-α SCF GAPDH
129 145 80 143
bFGF, basic fibroblast growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SCF, stem cell factor; TNF-α, tumour necrosis factor-α; VEGF, vascular endothelial growth factor.
samples was normalized by the expression level of GAPDH. The sequences of the primers used are listed in Table 1.
Other measurements and statistical analyses The serum creatinine and urea nitrogen levels were measured using a chemical autoanalyzer (DRI-CHEM 3500V; Fuji, Tokyo, Japan). Data were analyzed using Microsoft Excel (Microsoft Co., Redmond, WA, USA) and reported as means ± SEM. Statistical significance was assessed by two-way ANOVA followed by Dunnett’s or Student’s t test. A value of P < 0.05 was considered significant.
RESULTS Histological features of peritoneal walls in CRF rats The elevated serum creatinine (1.10 ± 0.06 vs. shamoperated 0.34 ± 0.02 mg/dl, n = 6, P < 0.05) and urea nitrogen (45.5 ± 4.80 vs. sham-operated 13.9 ± 1.28 mg/dl, n = 6, P < 0.05) levels in the nephrectomized rats indicated CRF with uraemia as a result of deteriorated renal function.7,15,21 Sections of the parietal peritoneal walls from sham-operated rats showed normal peritoneum, which was composed of a monolayer of flat mesothelial cells and a thin compact zone of mature fibrous tissue, on top of a massive layer of muscle fibers (Fig. 1Aa). In the peritoneum from CRF rats, however, the surface layer of mesothelial cells was almost completely destroyed (Fig. 1Ab). As previously reported,4,22 the submesothelial area was remarkably thickened with widely spaced fibrous tissue (Fig. 1Ad vs. c), which, downwards, was interposed between muscle fibers, loosening their bundled structure (Fig. 1Ad). Figure 1B shows the marked difference in the thickness of the submesothelial space between the sham-operated and CRF rat peritoneum.
Progression of peritoneal fibrosis in CRF rats In CRF rat peritoneum (Fig. 2Ab), the immunohistochemistry for collagen III, a marker of fibrosis, showed a © 2015 Asian Pacific Society of Nephrology
Fig. 1 Histological features of parietal peritoneal walls in sham-operated (sham) and chronic renal failure (CRF) rats. (A) Haematoxylin and eosin (H&E) and Masson’s trichrome staining, in sham-operated (sham) (a, c) and CRF (b, d) rat peritoneum. Magnification, ×20. (B) Thickness of submethothelial area was measured in sham-operated and CRF rat peritoneum. #P < 0.05 vs. shamoperated rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t-test.
wide range of staining in the thickened submesothelial space compared to the peritoneum from the sham-operated control rats (Fig. 2Aa). In the CRF rat peritoneum, the tissue deposition of collagen III, expressed as percentages of collagen III-positive areas relative to the total areas, was significantly increased (Fig. 2Ac), indicating the progression of peritoneal fibrosis. In sham-operated rat peritoneum, immunohistochemistry for α-SMA, a marker of myofibroblasts, was only weakly positive in several cells within the submesothelial compact zone or intramuscular spaces (Fig. 2Ba, arrow heads). In CRF rat peritoneum, however, the immunohistochemistry demonstrated a greater number of positively stained cells in the submesothelial space as well as in the loosened tissues between muscle fibers (Fig. 2Bb). Figure 2Bc shows the dramatic difference in the numbers of α-SMA positive cells between the sham-operated and CRF rat peritoneum. These results indicated that the number of 611
I Kazama et al.
Fig. 2 Fibrotic marker expression in parietal peritoneal walls of shamoperated (sham) and chronic renal failure (CRF) rats. (A) Immunohistochemistry using antibody for collagen III (brown) in sham-operated (a) and CRF (b) rat peritoneum. (c) Collagen III deposition was quantified and expressed as percentages of collagen III-positive areas relative to the total areas. (B) Immunohistochemistry using antibody for α-smooth muscle actin (α-SMA, brown) in sham-operated (a) and CRF (b) rat peritoneum. (c) α-SMApositive cells were counted in high-power views of sham-operated and CRF rat peritoneum. Magnification, ×20. #P < 0.05 vs. sham-operated rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t-test.
myofibroblasts was increased in CRF rat peritoneum, which may have facilitated the progression of peritoneal fibrosis (Figs 1 and 2A).
In situ proliferation of mast cells in the CRF rat peritoneum Mast cells are known to be increased in fibrotic tissues of sclerosing organs, such as in renal fibrosis,11,12 liver cirrhosis and myocardial infarction.10 Since mast cells are considered to be responsible for the progression of tissue fibrosis,9 and since a wide range of fibrosis was actually observed in CRF rat peritoneum (Figs 1,2A), we examined the numbers of 612
Fig. 3 Mast cells infiltration and proliferation in chronic renal failure (CRF) rat peritoneum. (A) Mast cells in sham-operated (sham) and CRF rat peritoneum. Toluidine blue staining of either parietal or visceral peritoneum in shamoperated (sham) (a, c) and CRF (b, d) rats. Magnification, ×20. (e, f) Toluidine blue-stained mast cells were counted in high-power fields of view in parietal (e) and visceral (f) peritonea (10 views from 6 sham-operated and CRF rat peritoneum, respectively). #P < 0.05 vs. sham-operated rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t test. (B) Immunofluorescence staining using an antibody for mast cell tryptase (green) co-stained with Ki-67 (red) in visceral peritoneal walls from CRF rats. A High-power view of visceral peritoneal wall. Magnification, ×60.
mast cells that had infiltrated into the CRF rat peritoneum (Fig. 3A). In both the parietal and visceral peritoneum of sham-operated rats (Fig. 3Aa,c), toluidine blue staining was only positive in a few mast cells within high-power views. In CRF rats, however, the staining showed a number of positive cells in both peritonea (Fig. 3Ab,d). Figure 3Ae and f show the differences in the numbers of toluidine blue-stained mast cells between sham-operated and CRF rat peritoneum, indicating that the number of peritoneal mast cells was significantly increased in CRF rats. Since these mast cells, which were positively stained with tryptase (Fig. 3B, green), were mostly co-stained with Ki-67 (red), they were thought to proliferate in situ in the CRF rat peritoneum. © 2015 Asian Pacific Society of Nephrology
Mast cells in peritoneal fibrosis
Fig. 5 Expression of fibroblast-activating factors and stem cell factor in peritoneal mast cells obtained from sham-operated (sham) and chronic renal failure (CRF) rats. The mRNA abundance of basic fibroblast growth factor (bFGF) (A), vascular endothelial growth factor (VEGF) (B), tumour necrosis factor-α (TNF-α) (C) and stem cell factor (SCF) (D) in mast cells obtained from the peritoneal cavity of sham-operated (sham) and CRF rats. #P < 0.05 vs. sham-operated rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t-test.
Fig. 4 Infiltration of inflammatory leukocytes in sham-operated (sham) and chronic renal failure (CRF) rat peritoneum. Immunohistochemistry using antibodies for CD3 (a, c) and ED-1 (b, d). (A) Mesenteric lymph nodes (a, b) and visceral peritoneum (c, d) from sham-operated rats. (B) Visceral peritoneum from CRF rats with 4 (a, b) or 8-week (c, d) recovery period after subtotal nephrectomy. Magnification, ×20.
Less infiltration of T-lymphocytes or macrophages in the CRF rat peritoneum To reveal whether the other types of inflammatory leukocytes, such as T-lymphocytes and macrophages, also infiltrate into the CRF rat peritoneum, we examined the expression of the markers for these cells. In the mesenteric lymph nodes from sham-operated rats, where inflammatory leukocytes are abundant, the immunohistochemistry for CD3 and ED-1 both demonstrated large numbers of positively stained cells (Fig. 4Aa,b). However, in the visceral peritoneum from these rats, the immunohistochemistry demonstrated negative staining with these markers (Fig. 4Ac,d). In the CRF rat peritoneum with 4 or 8-week recovery period after subtotal nephrectomy, only a few CD3- or ED-1positive cells were noted in several high-power fields (Fig. 4Ba–d, arrow heads). They were considered to be the inflammatory leukocytes, such as T-lymphocytes and macrophages, which may have been recruited by the chemokines released from the mast cells increased (Fig. 3). © 2015 Asian Pacific Society of Nephrology
However, the numbers of these inflammatory leukocytes were much less than those of the mast cells, which was consistent with the findings previously demonstrated in patients with encapsulating peritoneal sclerosis.8
Production of fibroblast-activating factors and stem cell factor from peritoneal mast cells In addition to their exocytotic release of numerous chemokines, such as serotonin and histamine, mast cells are known to produce several growth factors once they are activated.9 Among them are fibroblast-activating factors, such as basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF) and tumour necrosis factor-α (TNF-α), which promote the proliferation of fibroblasts and stimulate their activity to produce collagen.9 Since the number of myofibroblasts was actually increased in CRF rat peritoneum (Fig. 2B), we examined the expression of the fibroblastactivating factors synthesized in peritoneal mast cells (Fig. 5A–C). Compared to the mast cells obtained from sham-operated rats, the mRNA expressions of bFGF, VEGF and TNF-α were all significantly higher in the cells obtained from CRF rats (Fig. 5A–C). The mRNA expression of stem cell factor (SCF), which is a growth factor of mast cells themselves,9 was also significantly higher in those cells (Fig. 5D). These results suggested that mast cells in CRF rat peritoneum were more activated than those in 613
I Kazama et al.
tissue within the submesothelial space (Fig. 6Ab,d). However, it was not as widely spaced or loosely distributed as was observed in the vehicle-treated CRF rat peritoneum (Fig. 6Aa,c). The thickness of the submesothelial space was significantly smaller in the tranilast-treated CRF rat peritoneum (Fig. 6B), indicating that tranilast actually ameliorated the progression of peritoneal fibrosis. From these findings, the proliferation of mast cells and their increased activity in the peritoneum are thought to be strongly associated with the progression of peritoneal fibrosis in CRF.
DISCUSSION
Fig. 6 Histological features of parietal peritoneal walls in vehicle-treated and tranilast-treated chronic renal failure (CRF) rats. (A) Hematoxylin and eosin (H&E) and Masson’s trichrome staining, in vehicle-treated (a, c) and tranilasttreated (b, d) CRF rat peritoneum. Magnification, ×20. (B) Thickness of submethothelial area was measured in vehicle-treated and tranilast-treated CRF rat peritoneum. *P < 0.05 vs. vehicle-treated CRF rats. Values are means ± standard error of the mean (SEM) (n = 5). Differences were analyzed by ANOVA followed by Dunnett’s or Student’s t-test.
sham-operated rat peritoneum. The increased production of the fibroblast-activating factors is thought to be responsible for the proliferation and activation of the peritoneal myofibroblasts.
Therapeutic effects of a mast cell stabilizer, tranilast, on the progression of peritoneal fibrosis To obtain direct evidence that the proliferation of mast cells and their increased activity actually contributed to the progression of peritoneal fibrosis, we examined the histological features of the CRF rat peritoneum after treating the animals with tranilast, one of the most potent mast cell stabilizers23,24 (Fig. 6). In CRF rat peritoneum with vehicle-treatment, the submesothelial area was remarkably thickened with widely spaced fibrous tissue (Fig. 6Aa,c). The fibrous tissue spread downwards between the muscle fibers and loosened their bundled structure (Fig. 6Ac). In CRF rat peritoneum with tranilast-treatment, there was also an increase in the fibrous 614
Using experimental animal models of EPS, previous studies demonstrated that external chemical stimuli, such as lipopolysaccharide or chlorhexidine gluconate, trigger the development of peritoneal fibrosis.2,3 Therefore, It has generally been believed in patients with ESRD that the peritoneal fibrosis and the resultant peritoneal failure is primarily caused by the continuous or intermittent exposure to peritoneal dialysate, which is chemically characterized by a high osmolality, high glucose concentration and low pH.1 However, Williams et al. demonstrated that the peritoneal fibrosis also occurs in uraemic patients undergoing hemodialysis,4 indicating that uraemic substances alone can trigger the development of peritoneal fibrosis, irrespective of the external stimuli in the peritoneal dialysate. Using experimental animal models of CRF, Combet et al. further revealed that the increased production of nitric oxide in the systemic circulation may be responsible for the uraemia-induced peritoneal fibrosis.5 In the present study, using the rat model with subtotal nephrectomy, we confirmed the previous findings that chronic uraemia alone induces peritoneal fibrosis without the need of external chemical stimuli,5 and provided an additional evidence that mast cells are also involved in the uraemia-induced progression of peritoneal fibrosis. Previous studies demonstrated the increased levels of inflammatory cytokines, such as IL-1β and IL-6, in the ascites of patients or experimental animal models of EPS.8 Since these cytokines stimulate fibroblasts to produce collagen,7 and since their serum and ascites levels are both elevated in CRF patients,25 they were thought to be involved in the progression of peritoneal fibrosis in CRF. In the present study, however, in contrast to renal fibrosis, which is characterized by the massive infiltration of leukocytes such as lymphocytes and macrophages,7 we did not observe such an infiltration of leukocytes in the fibrotic peritoneum of CRF rats (Fig. 4B). Instead, we noted a significant increase in the numbers of mast cells in both the parietal and visceral peritoneum as a result of their in situ proliferation there (Fig. 3). These mast cells significantly increased their production of fibroblast-activating factors that stimulate the collagen synthesis (Fig. 5). Additionally, since the administration of tranilast, a mast cell stabilizer, actually ameliorated the © 2015 Asian Pacific Society of Nephrology
Mast cells in peritoneal fibrosis
progression of fibrosis in CRF rat peritoneum (Fig. 6), the mast cells were thought to be responsible for the progression of peritoneal fibrosis in CRF. Mast cells are of hematopoietic origin, and circulate only transiently as disguised progenitor cells, ultimately completing their maturation in peripheral connective tissues.9 Therefore, in contrast to the peritoneal dialysate, which ruin the peritoneal tissue directly from the most external mesothelial layers, the mast cells that reside within the submesothelial space may gradually damage the peritoneum from inside the tissue, which may result in the partial preservation of the external mesothelial layers (Fig. 2). In previous studies, numerous inflammatory cytokines or chemokines, such as IL-4 and IL-9, were identified as playing roles in recruiting mast cells into diseased organs.12 In CRF patients, since the serum cytokine levels are known to be elevated with the progression of renal dysfunction,25,26 the cytokines are thought to be responsible for the initial infiltration of mast cells into the peritoneum. Additionally, in the present study, the peritoneal mast cells from CRF rats produced more stem cell factor (SCF) than those from sham-operated rats (Fig. 5D). Since SCF, also known as a ‘mast cell growth factor’, stimulates the differentiation and the survival of mast cells themselves in addition to their proliferation,9 this factor may have exerted additive effects on the mast cell increase in the CRF rat peritoneum. Previous studies revealed the involvement of mast cells in the development of fibrosis in many organs, including kidney, skin, lung and liver.10–12 Therefore, for the treatment or protection against organ fibrosis, several pharmacological approaches to inhibit the activation of mast cells, such as the use of mast cell stabilizers27,28 or chemokine inhibitors,29,30 have been suggested. In the present study, tranilast, one of the most potent mast cell stabilizers,23,24 whose therapeutic efficacy as an anti-fibrotic agent has also been demonstrated in sclerosing organs,16,17,28 actually ameliorated the progression of peritoneal fibrosis (Fig. 6). In our recent in vitro studies, the cationic and relatively lipophilic drugs, such as chlorpromazine and olopatadine, which are partitioned preferentially into the inner leaflets of lipid bilayers, generated inward membrane-bending in mast cells and thus counteracted the process of exocytosis.18,19 Given the pharmacological properties of these drugs in mast cell stabilization, the administration of chlorpromazine or olopatadine could also be useful for the treatment of peritoneal fibrosis. In summary, this study demonstrated for the first time that the number of mast cells was significantly increased in the fibrotic peritoneum of CRF rats. The proliferation of mast cells and their increased activity in the peritoneum are thought to be responsible for the progression of peritoneal fibrosis.
ACKNOWLEDGEMENTS We thank Ms. Fumiko Date, Ms. Miki Yoshizawa and their colleagues at Biomedical Research Core of Tohoku University © 2015 Asian Pacific Society of Nephrology
Graduate School of Medicine for their technical support. This work was supported by Miyagi Kidney Foundation Grant and MEXT KAKENHI Grant Number 25860155.
REFERENCES 1. Kawaguchi Y, Kawanishi H, Mujais S, Topley N, Oreopoulos DG. Encapsulating peritoneal sclerosis: Definition, etiology, diagnosis, and treatment. International Society for Peritoneal Dialysis Ad Hoc Committee on Ultrafiltration Management in Peritoneal Dialysis. Perit. Dial. Int. 2000; 20 (Suppl 4): S43–55. 2. Margetts PJ, Kolb M, Yu L, Hoff CM, Gauldie J. A chronic inflammatory infusion model of peritoneal dialysis in rats. Perit. Dial. Int. 2001; 21 (Suppl 3): S368–72. 3. Nakamoto H, Imai H, Ishida Y et al. New animal models for encapsulating peritoneal sclerosis–role of acidic solution. Perit. Dial. Int. 2001; 21 (Suppl 3): S349–53. 4. Williams JD, Craig KJ, Topley N et al. Morphologic changes in the peritoneal membrane of patients with renal disease. J. Am. Soc. Nephrol. 2002; 13: 470–79. 5. Combet S, Ferrier ML, Van Landschoot M et al. Chronic uremia induces permeability changes, increased nitric oxide synthase expression, and structural modifications in the peritoneum. J. Am. Soc. Nephrol. 2001; 12: 2146–57. 6. Margetts PJ, Kolb M, Yu L et al. Inflammatory cytokines, angiogenesis, and fibrosis in the rat peritoneum. Am. J. Pathol. 2002; 160: 2285–94. 7. Kazama I, Maruyama Y, Endo Y et al. Overexpression of delayed rectifier K(+) channels promotes in situ proliferation of leukocytes in rat kidneys with advanced chronic renal failure. Int. J. Nephrol. 2012; 2012: 581581. 8. Imai H, Nakamoto H, Fukushima R, Ishida Y, Yamanouchi Y, Suzuki H. Role of adhesion molecules in the progression of peritoneal sclerosis. Adv. Perit. Dial. 2003; 19: 180–85. 9. Gruber BL. Mast cells in the pathogenesis of fibrosis. Curr. Rheumatol. Rep. 2003; 5: 147–53. 10. Gruber BL. Mast cells: Accessory cells which potentiate fibrosis. Int. Rev. Immunol. 1995; 12: 259–79. 11. Holdsworth SR, Summers SA. Role of mast cells in progressive renal diseases. J. Am. Soc. Nephrol. 2008; 19: 2254–61. 12. Blank U, Essig M, Scandiuzzi L, Benhamou M, Kanamaru Y. Mast cells and inflammatory kidney disease. Immunol. Rev. 2007; 217: 79–95. 13. Patel TS, Freedman BI, Yosipovitch G. An update on pruritus associated with CKD. Am. J. Kidney Dis. 2007; 50: 11–20. 14. Malbec O, Roget K, Schiffer C et al. Peritoneal cell-derived mast cells: An in vitro model of mature serosal-type mouse mast cells. J. Immunol. 2007; 178: 6465–75. 15. Kazama I, Baba A, Matsubara M, Endo Y, Toyama H, Ejima Y. Benidipine suppresses in situ proliferation of leukocytes and slows the progression of renal fibrosis in rat kidneys with advanced chronic renal failure. Nephron Exp. Nephrol. 2014; 128: 67–79. 16. Tan SM, Zhang Y, Cox AJ, Kelly DJ, Qi W. Tranilast attenuates the up-regulation of thioredoxin-interacting protein and oxidative stress in an experimental model of diabetic nephropathy. Nephrol. Dial. Transplant. 2011; 26: 100–10. 17. Hanada M, Tsutsumi K, Arima H et al. Evaluation of the effect of tranilast on rats with spinal cord injury. J. Neurol. Sci. 2014; 346: 209–15. 18. Kazama I, Maruyama Y, Takahashi S, Kokumai T. Amphipaths differentially modulate membrane surface deformation in rat
615
I Kazama et al.
19.
20.
21.
22.
23.
24.
616
peritoneal mast cells during exocytosis. Cell. Physiol. Biochem. 2013; 31: 592–600. Baba A, Tachi M, Maruyama Y, Kazama I. Olopatadine inhibits exocytosis in rat peritoneal mast cells by counteracting membrane surface deformation. Cell. Physiol. Biochem. 2015; 35: 386–96. Dullens HF, Van Basten C, De Weger RA, Den Otter W. Isolation of mast cells from murine peritoneal cell populations by velocity sedimentation at unit gravity. J. Immunol. Methods 1981; 40: 367–72. Michimata M, Kazama I, Mizukami K et al. Urinary concentration defect and limited expression of sodium cotransporter, rBSC1, in a rat model of chronic renal failure. Nephron Physiol. 2003; 93: 34–41. Miyazaki M, Yuzawa Y. The role of peritoneal fibrosis in encapsulating peritoneal sclerosis. Perit. Dial. Int. 2005; 25 (Suppl 4): S48–56. Nishigaki T. Mast cell degranulation and its inhibition by an anti-allergic agent tranilast. An electron microscopic study. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 1988; 55: 311–22. Rogosnitzky M, Danks R, Kardash E. Therapeutic potential of tranilast, an anti-allergy drug, in proliferative disorders. Anticancer Res. 2012; 32: 2471–8.
25. Barreto DV, Barreto FC, Liabeuf S et al. Plasma interleukin-6 is independently associated with mortality in both hemodialysis and pre-dialysis patients with chronic kidney disease. Kidney Int. 2010; 77: 550–56. 26. Kaysen GA, Kumar V. Inflammation in ESRD: Causes and potential consequences. J. Ren. Nutr. 2003; 13: 158–60. 27. Miyajima A, Asano T, Yoshimura I, Seta K, Hayakawa M. Tranilast ameliorates renal tubular damage in unilateral ureteral obstruction. J. Urol. 2001; 165: 1714–18. 28. Kelly DJ, Zhang Y, Gow R, Gilbert RE. Tranilast attenuates structural and functional aspects of renal injury in the remnant kidney model. J. Am. Soc. Nephrol. 2004; 15: 2619–29. 29. Doggrell SA, Wanstall JC. Cardiac chymase: Pathophysiological role and therapeutic potential of chymase inhibitors. Can. J. Physiol. Pharmacol. 2005; 83: 123–30. 30. Shiota N, Kakizoe E, Shimoura K, Tanaka T, Okunishi H. Effect of mast cell chymase inhibitor on the development of scleroderma in tight-skin mice. Br. J. Pharmacol. 2005; 145: 424–31.
© 2015 Asian Pacific Society of Nephrology
