http://informahealthcare.com/cts ISSN: 0300-8207 (print), 1607-8438 (electronic) Connect Tissue Res, 2014; 55(5–6): 391–396 ! 2014 Informa Healthcare USA, Inc. DOI: 10.3109/03008207.2014.959118
ORIGINAL RESEARCH
Mechanical compression upregulates MMP9 through SMAD3 but not SMAD2 modulation in hypertrophic scar fibroblasts Dong Huang1, Yingping Liu1, Yongjun Huang1, Youfu Xie2, Kuanhong Shen1, Dawei Zhang1, and Yong Mou1 1
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
Department of Trauma and Microsurgery, Non-Affiliated Guangdong No. 2 People’s Hospital of Southern Medical University, Guangzhou, China and 2Department of Burn and Plastic Surgery, Guangzhou Red Cross Hospital, Guangzhou, China Abstract
Keywords
Purpose: Activation of transforming growth factor-b (TGF-b) signaling and matrix metalloproteinases are involved in hypertrophic scar (HS) formation. Compression therapy is known to be an effective approach for the treatment of hypertrophic scarring; however, the underlying molecular mechanisms remain poorly understood. We investigated the relationship between TGF-b signaling activation and matrix metalloproteinases in HS fibroblasts during mechanical compressive stress. Materials and methods: Two groups of skin tissue from HS and the nearby normal tissue were obtained from surgical patients and analyzed. Primary fibroblasts from the HS tissue and normal fibroblasts were isolated. Pressure therapy was recapitulated in an in vitro threedimensional culture model, using mechanical stress produced with the Flexcell FX-4000C Compression Plus System. Quantitative real-time PCR (qPCR) was used to analyze the gene expression profiles in skin tissue and cultured primary cells exposed to compressive stress. Knockdown of SMAD2 and SMAD3 was performed using their specific siRNA in HS and normal fibroblasts subjected to compressive stress, and gene expression was examined by qPCR and Western blot. Results: There was a significant upregulation of the mRNA expression of matrix metalloproteinase-2 (MMP2) and MMP9 in primary HS fibroblasts in response to mechanical stress. In contrast, the mRNA levels of collagen I and collagen III were downregulated in primary HS fibroblasts compared with those in the control cells. SiRNA-mediated knockdown of SMAD3 in the primary fibroblasts exposed to mechanical stress resulted in a decrease in the expression of MMP9 compared to control cells. Conclusion: These results demonstrate that compressive stress upregulates MMP9 by SMAD3 but not by SMAD2.
Compression therapy, hypertrophic scars, MMP2, MMP9, SMAD2/3, TGF-b
Introduction Hypertrophic scarring results from an abnormal cell response when normal skin (NS) becomes damaged or injured. Hypertrophic scarring can cause pain, cosmetic concerns and skin contraction. Mechanical compression, or stress therapy, (such as pressure garment therapy) has gained considerable popularity in the prevention of scar tissue expansion (1,2). However, the molecular mechanism of compression therapy in the prevention and treatment of hypertrophic scars (HSs) remains unclear.
Correspondence: Prof. Huang Dong, Doctor, Department of Trauma and Microsurgery, Non-Affiliated Guangdong No. 2 People’s Hospital of Southern Medical University, Xingang Road E, Guangzhou 510317, China. Tel: +86-20-8916-8156. Fax: +86-20-8916-8013. E-mail: [email protected]
History Received 2 December 2013 Revised 16 August 2014 Accepted 20 August 2014 Published online 22 September 2014
In our previous study using the Flexcell FX-4000C Compression Plus System (Flexcell International Corporation, Hillsborough, NC), we showed that the expression level of TGF-b pathway-related genes and matrix metalloproteinases (MMPs) changed in HS fibroblasts under compressive stress (3). Other studies showed that HSs contain excessive collagen in the dermis (4), and that activation of the TGF-b signaling pathway is involved in HS formation (5). TGF-b signaling occurs at via TGF-b receptors at the cell surface, and SMAD2 and SMAD3 are important intracellular transducers of TGF-b signaling (6). However, the expression levels of TGF-b, SMAD2 and SMAD3 vary with skin types (7). The expression of HS-related gene expression including collagen I, collagen III, MMPs and the TGF-b signaling pathway-related genes have also been shown to be altered by compression stress (8–10). Because SMAD2 and SMAD3 play important roles in TGF-b signaling pathways, the effects SMAD2 and SMD3 in compression stress need to be investigated.
392
D. Huang et al.
In the present study, we mimicked stress therapy in vitro with the Flexcell FX-4000C Compression Plus System (Flexcell International Corporation), which produces stress to the cells without inducing cell necrosis, to examine the effects of mechanical stress on dermal fibroblasts. We also investigated if SMAD2 or SMAD3 contribute to the effects of compressive stress by knocking down SMAD3 or SMAD2 with their specific siRNAs, and determining the response of fibroblasts to mechanical stress.
Materials and methods
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
Clinic specimens Twenty-one HS patients, aged 18–45 years were included in our study. The HS tissues and paired related normal tissues were obtained from patients at the Guangzhou Red Cross Hospital (Guangzhou, China) and the Second People’s Hospital of Guangdong Province (Guangzhou, China). The clinical stage of the scars was assessed and confirmed by routine histological analysis (Hematoxylin and Eosin staining, H&E staining). All samples were used to detect the gene expression at the mRNA level. Primary skin fibroblasts were prepared as described below. The present study was approved by the Committees for Ethical Review of Research Involving Human Subjects at Guangzhou Red Cross Hospital and the Second People’s Hospital of Guangdong Province. Establishment of primary fibroblast cultures HS and NS tissue from HS patients were washed twice with phosphate-buffered saline (PBS), minced into 0.5–2 mm3 pieces and washed again with PBS, centrifuged at 1000 rpm for 5 min and rinsed twice in fetal bovine serum (FBS)-free Dulbecco’s modified Eagle medium (DMEM). The pellets were suspended in complete DMEM supplemented with 20% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin (Invitrogen Inc., San Diego, CA) and seeded into 25 cm2 plastic flasks. The specimen pieces were allowed to attach to the flask walls. After 3–4 h, 0.2–0.5 mL of medium was added into the flask to cover the pieces. The cells were incubated at 37 C with 5% CO2, and on the second day, 5 mL medium was added and the cells were incubated for an additional 2–3 weeks. The primary cells were sub-cultured in 10% FBS DMEM to a confluence of 70–80% before being used for further analysis as described below. Force application The FX Flexcell-4000C Compression Plus System (Flexcell International Corporation) was used to apply stress to the cells. The pressure model consisted of six-well culture plates implanted with fibroblasts. Monolayer cultures containing 2 105 fibroblasts were implanted into the cell lattices and were incubated at 37 C with 5% CO2 in six-well culture plates. Six cylinders (25 mm diameter), which were centered beneath each 35-mm well served as loading posts for the culture plates. The force transducer output was set to 0.23 Hz as previously reported (11). Cells with no stress were used as controls. The pressures stress was applied for 22 h. The control samples (uncompressed) were maintained in serumfree DMEM medium with 10% FBS at 37 C in an atmosphere
Connect Tissue Res, 2014; 55(5–6): 391–396
of 5% CO2 for the same period. As confirmed by the lactate dehydrogenase (LDH) assay, the compression stress did not induce cell necrosis. As determined by our preliminary experiment, the pressure stabilized at 35 mmHg after 5–10 min. After 22 h, mRNA was extracted from the cells, and stored in TRIzol (Invitrogen, Carlsbad, CA) at 80 C, as detailed below. RNA extraction and quantitative real-time PCR Total mRNA was extracted from the HS tissue samples and from stressed and unstressed fibroblasts with TRIzol reagent (Invitrogen). PrimeScript RT Master Mix (Takara Bio Inc., Otsu, Japan) was used to synthesize complementary DNA (cDNA). Two microgram of total RNA from each sample was used to synthesize cDNA. The cDNA products were amplified using a SYBR Green PCR Kit (Roche). The amplification protocol comprised 40 cycles of 95 C for 1 min, 60 C for 1 min and 72 C for 1 min. A 7900HT RealTime PCR System (Applied Biosystems, Carlsbad, CA) was used for the PCR. The expression level was normalized against endogenous GAPDH for related gene expression. The primer sequences used in quantitative real-time PCR (qPCR) are listed in Table 1. siRNA knockdown NS and HS fibroblasts were maintained in DMEM supplemented with 10% FBS. Transfections with siRNA against SMAD2 or SMAD3 were performed according to the manufacturer’s protocol. Transfection and knockdown efficiency were tested using Western blot. siRNA targeting human SMAD2 or SMAD3 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Immunohistochemical staining Immunohistochemical staining (IHC) was performed using a standard second antibody IgG labeled with peroxidase complex method. In brief, paraffin block sections were deparaffinized, blocked with 5% normal goat serum for 10 min and incubated with mouse anti-human a-SMA monoclonal antibody (Abcam, 1:100 dilution) overnight at 4 C. The slides were then incubated with goat anti-mouse immunoglobulin labeled with peroxidase at a concentration of 1:100 at 37 C for 30 min. A 3,5-diaminobenzidine (DAB) Substrate Kit (Dako, Glostrup, Denmark) was used for color development, followed by Mayer’s hematoxylin counterstaining. Isotope human IgG was used as a negative control. Western blot Western blotting was performed according to the standard protocol with antibodies for GAPDH (Santa Cruz Biotechnology, 1:5000), MMP2 (Abcam, MA, 1:1500), MMP9 (Santa Cruz Biotechnology, 1:1000), Timp1 (Santa Cruz Biotechnology, 1:500), p-Smad2 and p-Smad3 (CST, MA, 1:100 and 1:500). Forty micrograms of each sample was loaded on 8% sodium dodecyl sulfate (SDS) gels for electrophoresis. The protein was transferred to nitrocellulose membranes (Roche, Bael, Switzerland). The membranes were incubated with blocking buffer (5% nonfat dry milk in PBS
Compressive stress upregulates MMP9 by SMAD3 not by SMAD2 in HS
DOI: 10.3109/03008207.2014.959118
393
Table 1. List of qPCR primers. PCR
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
MMP2 MMP9 MMP12 Timp1 Collagen I (1A2) Collagen III GAPDH
F (50 -30 )
R (50 -30 )
CTTCCAAGTCTGGAGCGATGT GGGACGCAGACATCGTCATC CATGAACCGTGAGGATGTTGA ACCACCTTATACCAGCGTTATGA CATGCCGTGACTTGAGACTCA CGAGCTTCCCAGAACATCACA CATGAGAAGTATGACAACAGCCT
TACCGTCAAAGGGGTATCCAT TCGTCATCGTCGAAATGGGC GCATGGGCTAGGATTCCACC GGTGTAGACGAACCGGATGTC AGGCGCATGAAGGCAAGTT TTCGTGCAACCATCCTCCA AGTCCTTCCACGATACCAAAGT
with 0.1% Tween-20) for 1 h at room temperature to block nonspecific binding and then incubated with a primary antibody in blocking buffer overnight at 4 C. Blots were incubated at room temperature with peroxidase-labeled rabbit secondary antibody (1:2000; CST, MA) and developed with an ECL Kit (EMD Millipore Corporation, Billerica, MA). Statistical analysis All data were analyzed with SPSS 13.0 software (SPSS Inc., San Rafael, CA). The data are presented in the figures as mean ± SD (standard deviation). The two-tailed unpaired Student’s t-test was used to analyze the qPCR and WB results, and the paired Student’s t-test was used to analyze the differences between the pressure group and control. A p50.05 was considered as statistically significant. Densitometry analysis of the intensity of the protein bands seen on the gels was performed using Image 1.6 software (Scion Corporation, Frederick, MD).
Results Expression of Timp1, collagen I, collagen III, MMP2 and MMP9 mRNA in HS samples The effect of stress therapy on HSs of the same clinical stage varies in different individuals (12). To minimize the individual variation, qPCR was performed to analyze mRNA expression of TGF-b pathway target genes including the MMPs and collagens in HS and NS tissue before primary culture. The results indicated that the mRNA expression of TGF-b1, Timp1, collagen I and collagen III were upregulated in the HS group (n ¼ 21) (Figure 1) compared to NS group (n ¼ 11, as 10/21 mRNA samples were unavailable). In contrast, the expression of MMP2 and MMP9 mRNA was significantly downregulated (MMP2, p50.05; MMP9, p50.01). Therefore, in our subsequent experiment, the upregulation of Timp1, collagen I and collagen III mRNA, as well as the downregulation of MMP2 and MMP9 were used as the inclusion criteria and were used as the readouts for stress therapy assay. Primary fibroblast characterization The HS samples used in our study all exhibited increased expression of Timp1, collagen I and collagen III, mRNA, and MMP2 and MMP9 downregulation. Nine HS patients’ (five men and four women, age range 18–45 years) tissue mRNA levels met the above criteria were used in our study. Representative images of the H&E staining of the HS and NS samples are shown in Figure 2(A). Irregular collagen
Figure 1. Expression of TGF-b pathway genes and MMPs in HS and NS tissue. The expression of TGF-b pathway genes and MMPs in HS and NS tissue was detected by qPCR. The HS group (n ¼ 21) demonstrates upregulation of Timp1, Timp2, MMP1, collagen I and collagen III expression and a significant downregulation of TGF-b, MMP2 and MMP9 expression (*p50.05, **p50.01), compared with the NS control cells.
(pink) patterns were observed in the HS tissue sections. Fibroblasts from these HS patients were obtained (Figure 2B). These primary fibroblasts exhibited typical morphology and IHC features (positive a-SMA, Figure 2C), and were used in the subsequent stress therapy study. MMP2 and MMP9 are dramatically upregulated in HS fibroblasts under stress therapy Stress therapy is an effective therapy for HS patients. To investigate the underlying mechanisms, primary HS and NS fibroblast cells were cultured for 22 h in agarose lattices under stress using the Flexcell FX-4000C Compression Plus System (Flexcell International Corporation), as previously reported (13,14). The control cells were cultured in contraction-free lattices under the normal isotonic conditions. At the conclusion of the stress application, cells were harvested to test the expression of TGF-b pathway-related genes by qPCR. A significant upregulation of MMP2 and MMP9 was observed in HS-derived fibroblasts (Figure 3A, p50.01), compared to the normal cell group (Figure 3B). In contrast, a significant decrease in the expression of collagen I mRNA and collagen III was seen in the HS-derived fibroblasts (p50.01 and p50.05, respectively), compared to normal fibroblasts).
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
394
D. Huang et al.
Connect Tissue Res, 2014; 55(5–6): 391–396
Figure 2. Establishment and characteristics of primary fibroblasts in NS and HS. (A) Representative images of H&E stained primary culture cells. (B) After 4 d in culture, the primary fibroblasts had grown to confluent monolayer. (C) The cells exhibit typical morphology of fibroblasts and expression of a-SMA.
Figure 3. MMP2 and MMP9 are dramatically upregulated in HS fibroblasts under compressive stress. (A) stress results in a significant upregulation of MMP2 and MMP9 in HS-derived fibroblasts collagen I and collagen III mRNA expression showed a marked downregulation compared to control cells. (B) No significant change was observed in the normal cell group. (*p50.05; **p50.01).
SMAD3 but not SMAD2 regulates MMP9 under stress therapy To investigate the effect of the TGF-b signaling pathway on HS fibroblasts under stress, we knocked down SMAD3 and SMAD2 using their specific siRNAs (Figure 4A). We observed that knockdown of SMAD3 did not alter the mRNA expression of collagen I (Figure 4B) under stress. In contrast, in the SMAD2 siRNA group, stress led to decreased expression of collagen I (Figure 4B, p50.01), suggesting that SMAD3 plays a key role in the compression process. Furthermore, a significant decrease in the expression of MMP9 was observed in tissue fibroblasts with SMAD3 knockdown compare with control group but not in the SMAD2 knockdown cells (p50.01, Figure 4C and D). Taken together, these results suggest that SMAD3 plays a functional role in HS stress therapy.
Discussion Pressure therapy has been used for the management of HS patients for centuries. However, the molecular mechanisms of this treatment remain unclear. It has been suggested that the TGF-b pathway is involved in the HS formation process and MMPs may be involved in the reconstruction of the skin’s basal membrane (15,16). In the present study, we found altered expression of TGF-b signaling target genes and MMPs in HS and NS fibroblasts that was similar to previous reports (17,18,24). We have demonstrated an upregulation of MMP2 and MMP9 in HS cells in response to in vitro mechanical pressure. Increased expression of MMP2 and MMP9 may directly or indirectly contribute to the reduction of collagen I and collagen III in HS tissues. Furthermore, we have observed that SMAD3 but SMAD2 may play a key role in this mechanical compression model.
DOI: 10.3109/03008207.2014.959118
Compressive stress upregulates MMP9 by SMAD3 not by SMAD2 in HS
395
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
Figure 4. SMAD3 but not SMAD2 regulated MMP9 under compressive stress. (A) The use of siRNA against SMAD3 and SMAD2 reduced the expression of these molecules. (B) SMAD3 knockdown did not affect collagen I expression, while SMAD2 siRNA led to a significant reduction of collagen I expression (p50.01). (C and D) SMAD3 knockdown resulted in a significant downregulation in MMP9 expression. (**p50.01).
TGF-b pathway-related genes and MMPs are involved in compressive therapy (3,19). The expression of MMP2 and MMP9 will upregulate and the expression of TGF-b1 receptor, SMAD2 and SMAD3 will downregulate after pressure effects on the growth of fibroblasts. (3,20–23). In our study, we hypothesized that mechanically stressed fibroblasts activate MMPs through the TGF-b pathway. We used siRNA to block TGF-b signaling transduced by SMAD3 or SMAD2, and found that the function of MMP9 may be dependent on SMAD3 but not on SMAD2. The results suggest that SMAD3 can activate the expression of MMP9 in HS-derived fibroblasts under compressive stress. However, other reports have shown that interleukin-1b and TNF-a also play important roles in hypertrophy regression induced by pressure (24). More studies are needed to explore the role of these inflammatory cytokines in pressure therapy. TGF-b/SMAD3 has been implicated in preventing the expansion of HS tissue (25). However, our study suggests a more complex gene network may be involved in response to stress therapy. SMAD3 and SMAD2 function as intracellular signal transducers in TGF-b signaling during fibrosis. Interestingly, our data show that in cells under compressive stress, SMAD3 has multiple roles in this process. Our data indicate that in cells under compressive stress, SMAD3, but not SMAD2, may play a predominant role. The detailed mechanisms of how SMAD3 may be involved in the in vivo mechanical stimulation of tissue remains to be elucidated. The involvement of other SMAD family members such as SMAD7, which has been implicated in HS therapy (26) should also be explored. In summary, our data indicates that SMAD3 may be a critical regulator of HS formation, and thus, it should be further studied to explore its possible application as a therapeutic target for scar formation treatment.
Acknowledgments We thank Professor Xiaona Li (Taiyuan University of Technology, China) for her generous support with the Force Measurement using Flexcell FX-4000C Compression Plus System and for the helpful discussion about the effects of stress on fibroblasts.
Declaration of interest This work was supported by a grant from the National Natural Science Foundation of China (No. 81071564).
References 1. Chrisostomidis C, Konofaos P, Chrisostomidis G, Vasilopoulou A, Papadopoulos O. Pressure therapy with a round rod for hypertrophic scars: reply. Plast Reconstr Surg 2008;121:692. 2. Tang XX. Pressure garment for the prevention and correction of hypertrophic burn scars. Zhonghua Zheng Xing Shao Shang Wai Ke Za Zhi 1986;2:267–9. 3. Kuan-hong S, Dong H, Wei-chi W, Yong-jun H, Yong M. Study on the molecular mechanism of mechanical compression treating hyperplastic scar via TGF-b 1 pathway. Chinese J Clin Anat 2013; 31:299–302. 4. Chu Y, Guo F, Li Y, Li X, Zhou T, Guo Y. A novel truncated TGF-beta receptor II downregulates collagen synthesis and TGFbeta I secretion of keloid fibroblasts. Connect Tissue Res 2008;49: 92–8. 5. Penn JW, Grobbelaar AO, Rolfe KJ. The role of the TGF-beta family in wound healing, burns and scarring: a review. Int J Burns Trauma 2012;2:18–28. 6. Finnson KW, McLean S, Di Guglielmo GM, Philip A. Dynamics of transforming growth factor beta signaling in wound healing and scarring. Adv Wound Care (New Rochelle) 2013;2: 195–214. 7. Chen W, Fu X, Sun T, Sun X, Zhao Z, Sheng Z. Change of gene expression of transforming growth factor-beta1, Smad2 and Smad3 in hypertrophic scars skins. Chinese J Surg 2002;40:17–19. 8. Oliveira GV, Hawkins HK, Chinkes D, Burke A, Tavares AL, Ramos-e-Silva M, Albrecht TB, Kitten GT, Herndon DN.
396
9.
10.
11.
12. 13.
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
14.
15.
16.
17.
D. Huang et al. Hypertrophic versus non hypertrophic scars compared by immunohistochemistry and laser confocal microscopy: type I and III collagens. Int Wound J 2009;6:445–52. Abdou AG, Maraee AH, Al-Bara AM, Diab WM. Immunohistochemical expression of TGF-beta1 in keloids and hypertrophic scars. Am J Dermatopathol 2011;33:84–91. Fu XB, Sun TZ, Yang YH. Characteristics of bFGF and TGF-beta expression in dermal chronic ulcers and hypertrophic scars and their effects on tissue repair. Chinese J Reparative Reconstr Surg 2000;14:271–4. Xiao H, Li J. Effect of compressive stress on proliferation and apoptosis of human hyperplastic scar fibroblasts in vitro. Chinese J Reparative Reconst Surg 2007;21:1330–4. Cather JC. Hypertrophic and atrophic scars. Proc (Bayl Univ Med Cent) 2007;20:184–6. Kessler D, Dethlefsen S, Haase I, Plomann M, Hirche F, Krieg T, Eckes B. Fibroblasts in mechanically stressed collagen lattices assume a ‘‘synthetic’’ phenotype. J Biol Chem 2001;276: 36575–85. Chang LW, Deng WP, Yeong EK, Wu CY, Yeh SW. Pressure effects on the growth of human scar fibroblasts. J Burn Care Res 2008;29:835–41. Saarialho-Kere U, Kerkela¨ E, Jahkola T, Suomela S, Keski-Oja J, Lohi J. Epilysin (MMP-28) expression is associated with cell proliferation during epithelial repair. J Invest Dermatol 2002;119: 14–21. Reno F, Sabbatini M, Stella M, Magliacani G, Cannas M. Effect of in vitro mechanical compression on Epilysin (matrix metalloproteinase-28) expression in hypertrophic scars. Wound Repair Regen 2005;13:255–61. Akasaka Y, Ishikawa Y, Ono I, Fujita K, Masuda T, Asuwa N, Inuzuka K, Kiguchi H, Ishii T. Enhanced expression of caspase-3 in hypertrophic scars and keloid: induction of caspase-3 and apoptosis in keloid fibroblasts in vitro. Lab Invest 2000;80:345–57.
Connect Tissue Res, 2014; 55(5–6): 391–396
18. Zhang T, Rong XZ, Yang RH, Li TZ, Xu YB. Effect of asiaticoside on the expression of transforming growth factor-beta mRNA and matrix metalloproteinases in hypertrophic scars. J Southern Med Univ 2006;26:67–70. 19. Tan J, Fu JF. Effects of pressure therapy on the proliferation and apoptosis of cells in hypertrophic scar of burn patients. Zhonghua Shao Shang Za Zhi 2013;29:509–15. 20. Le J, Rattner A, Chepda T, Frey J, Chamson A. Production of matrix metalloproteinase 2 in fibroblast reaction to mechanical stress in a collagen gel. Arch Dermatol Res 2002;294:405–10. 21. Player DJ, Martin NR, Passey SL, Sharples AP, Mudera V, Lewis MP. Acute mechanical overload increases IGF-I and MMP-9 mRNA in 3D tissue-engineered skeletal muscle. Biotechnol Lett 2014;36:1113–24. 22. Eastwood M, Mudera VC, McGrouther DA, Brown RA. Effect of precise mechanical loading on fibroblast populated collagen lattices: morphological changes. Cell Motil Cytoskeleton 1998; 40:13–21. 23. Schiller M, Javelaud D, Mauviel A. TGF-beta-induced SMAD signaling and gene regulation: consequences for extracellular matrix remodeling and wound healing. J Dermatol Sci 2004;35: 83–92. 24. Reno F, Sabbatini M, Lombardi F, Stella M, Pezzuto C, Magliacani G, Cannas M. In vitro mechanical compression induces apoptosis and regulates cytokines release in hypertrophic scars. Wound Repair Regen 2003;11:331–6. 25. Wang X, Qian Y, Jin R, Wo Y, Chen J, Wang C, Wang D. Effects of TRAP-1-like protein (TLP) gene on collagen synthesis induced by TGF-beta/Smad signaling in human dermal fibroblasts. PLoS One 2013;8:e55899. 26. Tang B, Zhu B, Liang Y, Bi L, Hu Z, Chen B, Zhang K, Zhu J. Asiaticoside suppresses collagen expression and TGF-beta/Smad signaling through inducing Smad7 and inhibiting TGF-betaRI and TGF-betaRII in keloid fibroblasts. Arch Dermatol Res 2011;303: 563–72.
ORIGINAL RESEARCH
Mechanical compression upregulates MMP9 through SMAD3 but not SMAD2 modulation in hypertrophic scar fibroblasts Dong Huang1, Yingping Liu1, Yongjun Huang1, Youfu Xie2, Kuanhong Shen1, Dawei Zhang1, and Yong Mou1 1
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
Department of Trauma and Microsurgery, Non-Affiliated Guangdong No. 2 People’s Hospital of Southern Medical University, Guangzhou, China and 2Department of Burn and Plastic Surgery, Guangzhou Red Cross Hospital, Guangzhou, China Abstract
Keywords
Purpose: Activation of transforming growth factor-b (TGF-b) signaling and matrix metalloproteinases are involved in hypertrophic scar (HS) formation. Compression therapy is known to be an effective approach for the treatment of hypertrophic scarring; however, the underlying molecular mechanisms remain poorly understood. We investigated the relationship between TGF-b signaling activation and matrix metalloproteinases in HS fibroblasts during mechanical compressive stress. Materials and methods: Two groups of skin tissue from HS and the nearby normal tissue were obtained from surgical patients and analyzed. Primary fibroblasts from the HS tissue and normal fibroblasts were isolated. Pressure therapy was recapitulated in an in vitro threedimensional culture model, using mechanical stress produced with the Flexcell FX-4000C Compression Plus System. Quantitative real-time PCR (qPCR) was used to analyze the gene expression profiles in skin tissue and cultured primary cells exposed to compressive stress. Knockdown of SMAD2 and SMAD3 was performed using their specific siRNA in HS and normal fibroblasts subjected to compressive stress, and gene expression was examined by qPCR and Western blot. Results: There was a significant upregulation of the mRNA expression of matrix metalloproteinase-2 (MMP2) and MMP9 in primary HS fibroblasts in response to mechanical stress. In contrast, the mRNA levels of collagen I and collagen III were downregulated in primary HS fibroblasts compared with those in the control cells. SiRNA-mediated knockdown of SMAD3 in the primary fibroblasts exposed to mechanical stress resulted in a decrease in the expression of MMP9 compared to control cells. Conclusion: These results demonstrate that compressive stress upregulates MMP9 by SMAD3 but not by SMAD2.
Compression therapy, hypertrophic scars, MMP2, MMP9, SMAD2/3, TGF-b
Introduction Hypertrophic scarring results from an abnormal cell response when normal skin (NS) becomes damaged or injured. Hypertrophic scarring can cause pain, cosmetic concerns and skin contraction. Mechanical compression, or stress therapy, (such as pressure garment therapy) has gained considerable popularity in the prevention of scar tissue expansion (1,2). However, the molecular mechanism of compression therapy in the prevention and treatment of hypertrophic scars (HSs) remains unclear.
Correspondence: Prof. Huang Dong, Doctor, Department of Trauma and Microsurgery, Non-Affiliated Guangdong No. 2 People’s Hospital of Southern Medical University, Xingang Road E, Guangzhou 510317, China. Tel: +86-20-8916-8156. Fax: +86-20-8916-8013. E-mail: [email protected]
History Received 2 December 2013 Revised 16 August 2014 Accepted 20 August 2014 Published online 22 September 2014
In our previous study using the Flexcell FX-4000C Compression Plus System (Flexcell International Corporation, Hillsborough, NC), we showed that the expression level of TGF-b pathway-related genes and matrix metalloproteinases (MMPs) changed in HS fibroblasts under compressive stress (3). Other studies showed that HSs contain excessive collagen in the dermis (4), and that activation of the TGF-b signaling pathway is involved in HS formation (5). TGF-b signaling occurs at via TGF-b receptors at the cell surface, and SMAD2 and SMAD3 are important intracellular transducers of TGF-b signaling (6). However, the expression levels of TGF-b, SMAD2 and SMAD3 vary with skin types (7). The expression of HS-related gene expression including collagen I, collagen III, MMPs and the TGF-b signaling pathway-related genes have also been shown to be altered by compression stress (8–10). Because SMAD2 and SMAD3 play important roles in TGF-b signaling pathways, the effects SMAD2 and SMD3 in compression stress need to be investigated.
392
D. Huang et al.
In the present study, we mimicked stress therapy in vitro with the Flexcell FX-4000C Compression Plus System (Flexcell International Corporation), which produces stress to the cells without inducing cell necrosis, to examine the effects of mechanical stress on dermal fibroblasts. We also investigated if SMAD2 or SMAD3 contribute to the effects of compressive stress by knocking down SMAD3 or SMAD2 with their specific siRNAs, and determining the response of fibroblasts to mechanical stress.
Materials and methods
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
Clinic specimens Twenty-one HS patients, aged 18–45 years were included in our study. The HS tissues and paired related normal tissues were obtained from patients at the Guangzhou Red Cross Hospital (Guangzhou, China) and the Second People’s Hospital of Guangdong Province (Guangzhou, China). The clinical stage of the scars was assessed and confirmed by routine histological analysis (Hematoxylin and Eosin staining, H&E staining). All samples were used to detect the gene expression at the mRNA level. Primary skin fibroblasts were prepared as described below. The present study was approved by the Committees for Ethical Review of Research Involving Human Subjects at Guangzhou Red Cross Hospital and the Second People’s Hospital of Guangdong Province. Establishment of primary fibroblast cultures HS and NS tissue from HS patients were washed twice with phosphate-buffered saline (PBS), minced into 0.5–2 mm3 pieces and washed again with PBS, centrifuged at 1000 rpm for 5 min and rinsed twice in fetal bovine serum (FBS)-free Dulbecco’s modified Eagle medium (DMEM). The pellets were suspended in complete DMEM supplemented with 20% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin (Invitrogen Inc., San Diego, CA) and seeded into 25 cm2 plastic flasks. The specimen pieces were allowed to attach to the flask walls. After 3–4 h, 0.2–0.5 mL of medium was added into the flask to cover the pieces. The cells were incubated at 37 C with 5% CO2, and on the second day, 5 mL medium was added and the cells were incubated for an additional 2–3 weeks. The primary cells were sub-cultured in 10% FBS DMEM to a confluence of 70–80% before being used for further analysis as described below. Force application The FX Flexcell-4000C Compression Plus System (Flexcell International Corporation) was used to apply stress to the cells. The pressure model consisted of six-well culture plates implanted with fibroblasts. Monolayer cultures containing 2 105 fibroblasts were implanted into the cell lattices and were incubated at 37 C with 5% CO2 in six-well culture plates. Six cylinders (25 mm diameter), which were centered beneath each 35-mm well served as loading posts for the culture plates. The force transducer output was set to 0.23 Hz as previously reported (11). Cells with no stress were used as controls. The pressures stress was applied for 22 h. The control samples (uncompressed) were maintained in serumfree DMEM medium with 10% FBS at 37 C in an atmosphere
Connect Tissue Res, 2014; 55(5–6): 391–396
of 5% CO2 for the same period. As confirmed by the lactate dehydrogenase (LDH) assay, the compression stress did not induce cell necrosis. As determined by our preliminary experiment, the pressure stabilized at 35 mmHg after 5–10 min. After 22 h, mRNA was extracted from the cells, and stored in TRIzol (Invitrogen, Carlsbad, CA) at 80 C, as detailed below. RNA extraction and quantitative real-time PCR Total mRNA was extracted from the HS tissue samples and from stressed and unstressed fibroblasts with TRIzol reagent (Invitrogen). PrimeScript RT Master Mix (Takara Bio Inc., Otsu, Japan) was used to synthesize complementary DNA (cDNA). Two microgram of total RNA from each sample was used to synthesize cDNA. The cDNA products were amplified using a SYBR Green PCR Kit (Roche). The amplification protocol comprised 40 cycles of 95 C for 1 min, 60 C for 1 min and 72 C for 1 min. A 7900HT RealTime PCR System (Applied Biosystems, Carlsbad, CA) was used for the PCR. The expression level was normalized against endogenous GAPDH for related gene expression. The primer sequences used in quantitative real-time PCR (qPCR) are listed in Table 1. siRNA knockdown NS and HS fibroblasts were maintained in DMEM supplemented with 10% FBS. Transfections with siRNA against SMAD2 or SMAD3 were performed according to the manufacturer’s protocol. Transfection and knockdown efficiency were tested using Western blot. siRNA targeting human SMAD2 or SMAD3 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Immunohistochemical staining Immunohistochemical staining (IHC) was performed using a standard second antibody IgG labeled with peroxidase complex method. In brief, paraffin block sections were deparaffinized, blocked with 5% normal goat serum for 10 min and incubated with mouse anti-human a-SMA monoclonal antibody (Abcam, 1:100 dilution) overnight at 4 C. The slides were then incubated with goat anti-mouse immunoglobulin labeled with peroxidase at a concentration of 1:100 at 37 C for 30 min. A 3,5-diaminobenzidine (DAB) Substrate Kit (Dako, Glostrup, Denmark) was used for color development, followed by Mayer’s hematoxylin counterstaining. Isotope human IgG was used as a negative control. Western blot Western blotting was performed according to the standard protocol with antibodies for GAPDH (Santa Cruz Biotechnology, 1:5000), MMP2 (Abcam, MA, 1:1500), MMP9 (Santa Cruz Biotechnology, 1:1000), Timp1 (Santa Cruz Biotechnology, 1:500), p-Smad2 and p-Smad3 (CST, MA, 1:100 and 1:500). Forty micrograms of each sample was loaded on 8% sodium dodecyl sulfate (SDS) gels for electrophoresis. The protein was transferred to nitrocellulose membranes (Roche, Bael, Switzerland). The membranes were incubated with blocking buffer (5% nonfat dry milk in PBS
Compressive stress upregulates MMP9 by SMAD3 not by SMAD2 in HS
DOI: 10.3109/03008207.2014.959118
393
Table 1. List of qPCR primers. PCR
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
MMP2 MMP9 MMP12 Timp1 Collagen I (1A2) Collagen III GAPDH
F (50 -30 )
R (50 -30 )
CTTCCAAGTCTGGAGCGATGT GGGACGCAGACATCGTCATC CATGAACCGTGAGGATGTTGA ACCACCTTATACCAGCGTTATGA CATGCCGTGACTTGAGACTCA CGAGCTTCCCAGAACATCACA CATGAGAAGTATGACAACAGCCT
TACCGTCAAAGGGGTATCCAT TCGTCATCGTCGAAATGGGC GCATGGGCTAGGATTCCACC GGTGTAGACGAACCGGATGTC AGGCGCATGAAGGCAAGTT TTCGTGCAACCATCCTCCA AGTCCTTCCACGATACCAAAGT
with 0.1% Tween-20) for 1 h at room temperature to block nonspecific binding and then incubated with a primary antibody in blocking buffer overnight at 4 C. Blots were incubated at room temperature with peroxidase-labeled rabbit secondary antibody (1:2000; CST, MA) and developed with an ECL Kit (EMD Millipore Corporation, Billerica, MA). Statistical analysis All data were analyzed with SPSS 13.0 software (SPSS Inc., San Rafael, CA). The data are presented in the figures as mean ± SD (standard deviation). The two-tailed unpaired Student’s t-test was used to analyze the qPCR and WB results, and the paired Student’s t-test was used to analyze the differences between the pressure group and control. A p50.05 was considered as statistically significant. Densitometry analysis of the intensity of the protein bands seen on the gels was performed using Image 1.6 software (Scion Corporation, Frederick, MD).
Results Expression of Timp1, collagen I, collagen III, MMP2 and MMP9 mRNA in HS samples The effect of stress therapy on HSs of the same clinical stage varies in different individuals (12). To minimize the individual variation, qPCR was performed to analyze mRNA expression of TGF-b pathway target genes including the MMPs and collagens in HS and NS tissue before primary culture. The results indicated that the mRNA expression of TGF-b1, Timp1, collagen I and collagen III were upregulated in the HS group (n ¼ 21) (Figure 1) compared to NS group (n ¼ 11, as 10/21 mRNA samples were unavailable). In contrast, the expression of MMP2 and MMP9 mRNA was significantly downregulated (MMP2, p50.05; MMP9, p50.01). Therefore, in our subsequent experiment, the upregulation of Timp1, collagen I and collagen III mRNA, as well as the downregulation of MMP2 and MMP9 were used as the inclusion criteria and were used as the readouts for stress therapy assay. Primary fibroblast characterization The HS samples used in our study all exhibited increased expression of Timp1, collagen I and collagen III, mRNA, and MMP2 and MMP9 downregulation. Nine HS patients’ (five men and four women, age range 18–45 years) tissue mRNA levels met the above criteria were used in our study. Representative images of the H&E staining of the HS and NS samples are shown in Figure 2(A). Irregular collagen
Figure 1. Expression of TGF-b pathway genes and MMPs in HS and NS tissue. The expression of TGF-b pathway genes and MMPs in HS and NS tissue was detected by qPCR. The HS group (n ¼ 21) demonstrates upregulation of Timp1, Timp2, MMP1, collagen I and collagen III expression and a significant downregulation of TGF-b, MMP2 and MMP9 expression (*p50.05, **p50.01), compared with the NS control cells.
(pink) patterns were observed in the HS tissue sections. Fibroblasts from these HS patients were obtained (Figure 2B). These primary fibroblasts exhibited typical morphology and IHC features (positive a-SMA, Figure 2C), and were used in the subsequent stress therapy study. MMP2 and MMP9 are dramatically upregulated in HS fibroblasts under stress therapy Stress therapy is an effective therapy for HS patients. To investigate the underlying mechanisms, primary HS and NS fibroblast cells were cultured for 22 h in agarose lattices under stress using the Flexcell FX-4000C Compression Plus System (Flexcell International Corporation), as previously reported (13,14). The control cells were cultured in contraction-free lattices under the normal isotonic conditions. At the conclusion of the stress application, cells were harvested to test the expression of TGF-b pathway-related genes by qPCR. A significant upregulation of MMP2 and MMP9 was observed in HS-derived fibroblasts (Figure 3A, p50.01), compared to the normal cell group (Figure 3B). In contrast, a significant decrease in the expression of collagen I mRNA and collagen III was seen in the HS-derived fibroblasts (p50.01 and p50.05, respectively), compared to normal fibroblasts).
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
394
D. Huang et al.
Connect Tissue Res, 2014; 55(5–6): 391–396
Figure 2. Establishment and characteristics of primary fibroblasts in NS and HS. (A) Representative images of H&E stained primary culture cells. (B) After 4 d in culture, the primary fibroblasts had grown to confluent monolayer. (C) The cells exhibit typical morphology of fibroblasts and expression of a-SMA.
Figure 3. MMP2 and MMP9 are dramatically upregulated in HS fibroblasts under compressive stress. (A) stress results in a significant upregulation of MMP2 and MMP9 in HS-derived fibroblasts collagen I and collagen III mRNA expression showed a marked downregulation compared to control cells. (B) No significant change was observed in the normal cell group. (*p50.05; **p50.01).
SMAD3 but not SMAD2 regulates MMP9 under stress therapy To investigate the effect of the TGF-b signaling pathway on HS fibroblasts under stress, we knocked down SMAD3 and SMAD2 using their specific siRNAs (Figure 4A). We observed that knockdown of SMAD3 did not alter the mRNA expression of collagen I (Figure 4B) under stress. In contrast, in the SMAD2 siRNA group, stress led to decreased expression of collagen I (Figure 4B, p50.01), suggesting that SMAD3 plays a key role in the compression process. Furthermore, a significant decrease in the expression of MMP9 was observed in tissue fibroblasts with SMAD3 knockdown compare with control group but not in the SMAD2 knockdown cells (p50.01, Figure 4C and D). Taken together, these results suggest that SMAD3 plays a functional role in HS stress therapy.
Discussion Pressure therapy has been used for the management of HS patients for centuries. However, the molecular mechanisms of this treatment remain unclear. It has been suggested that the TGF-b pathway is involved in the HS formation process and MMPs may be involved in the reconstruction of the skin’s basal membrane (15,16). In the present study, we found altered expression of TGF-b signaling target genes and MMPs in HS and NS fibroblasts that was similar to previous reports (17,18,24). We have demonstrated an upregulation of MMP2 and MMP9 in HS cells in response to in vitro mechanical pressure. Increased expression of MMP2 and MMP9 may directly or indirectly contribute to the reduction of collagen I and collagen III in HS tissues. Furthermore, we have observed that SMAD3 but SMAD2 may play a key role in this mechanical compression model.
DOI: 10.3109/03008207.2014.959118
Compressive stress upregulates MMP9 by SMAD3 not by SMAD2 in HS
395
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
Figure 4. SMAD3 but not SMAD2 regulated MMP9 under compressive stress. (A) The use of siRNA against SMAD3 and SMAD2 reduced the expression of these molecules. (B) SMAD3 knockdown did not affect collagen I expression, while SMAD2 siRNA led to a significant reduction of collagen I expression (p50.01). (C and D) SMAD3 knockdown resulted in a significant downregulation in MMP9 expression. (**p50.01).
TGF-b pathway-related genes and MMPs are involved in compressive therapy (3,19). The expression of MMP2 and MMP9 will upregulate and the expression of TGF-b1 receptor, SMAD2 and SMAD3 will downregulate after pressure effects on the growth of fibroblasts. (3,20–23). In our study, we hypothesized that mechanically stressed fibroblasts activate MMPs through the TGF-b pathway. We used siRNA to block TGF-b signaling transduced by SMAD3 or SMAD2, and found that the function of MMP9 may be dependent on SMAD3 but not on SMAD2. The results suggest that SMAD3 can activate the expression of MMP9 in HS-derived fibroblasts under compressive stress. However, other reports have shown that interleukin-1b and TNF-a also play important roles in hypertrophy regression induced by pressure (24). More studies are needed to explore the role of these inflammatory cytokines in pressure therapy. TGF-b/SMAD3 has been implicated in preventing the expansion of HS tissue (25). However, our study suggests a more complex gene network may be involved in response to stress therapy. SMAD3 and SMAD2 function as intracellular signal transducers in TGF-b signaling during fibrosis. Interestingly, our data show that in cells under compressive stress, SMAD3 has multiple roles in this process. Our data indicate that in cells under compressive stress, SMAD3, but not SMAD2, may play a predominant role. The detailed mechanisms of how SMAD3 may be involved in the in vivo mechanical stimulation of tissue remains to be elucidated. The involvement of other SMAD family members such as SMAD7, which has been implicated in HS therapy (26) should also be explored. In summary, our data indicates that SMAD3 may be a critical regulator of HS formation, and thus, it should be further studied to explore its possible application as a therapeutic target for scar formation treatment.
Acknowledgments We thank Professor Xiaona Li (Taiyuan University of Technology, China) for her generous support with the Force Measurement using Flexcell FX-4000C Compression Plus System and for the helpful discussion about the effects of stress on fibroblasts.
Declaration of interest This work was supported by a grant from the National Natural Science Foundation of China (No. 81071564).
References 1. Chrisostomidis C, Konofaos P, Chrisostomidis G, Vasilopoulou A, Papadopoulos O. Pressure therapy with a round rod for hypertrophic scars: reply. Plast Reconstr Surg 2008;121:692. 2. Tang XX. Pressure garment for the prevention and correction of hypertrophic burn scars. Zhonghua Zheng Xing Shao Shang Wai Ke Za Zhi 1986;2:267–9. 3. Kuan-hong S, Dong H, Wei-chi W, Yong-jun H, Yong M. Study on the molecular mechanism of mechanical compression treating hyperplastic scar via TGF-b 1 pathway. Chinese J Clin Anat 2013; 31:299–302. 4. Chu Y, Guo F, Li Y, Li X, Zhou T, Guo Y. A novel truncated TGF-beta receptor II downregulates collagen synthesis and TGFbeta I secretion of keloid fibroblasts. Connect Tissue Res 2008;49: 92–8. 5. Penn JW, Grobbelaar AO, Rolfe KJ. The role of the TGF-beta family in wound healing, burns and scarring: a review. Int J Burns Trauma 2012;2:18–28. 6. Finnson KW, McLean S, Di Guglielmo GM, Philip A. Dynamics of transforming growth factor beta signaling in wound healing and scarring. Adv Wound Care (New Rochelle) 2013;2: 195–214. 7. Chen W, Fu X, Sun T, Sun X, Zhao Z, Sheng Z. Change of gene expression of transforming growth factor-beta1, Smad2 and Smad3 in hypertrophic scars skins. Chinese J Surg 2002;40:17–19. 8. Oliveira GV, Hawkins HK, Chinkes D, Burke A, Tavares AL, Ramos-e-Silva M, Albrecht TB, Kitten GT, Herndon DN.
396
9.
10.
11.
12. 13.
Connect Tissue Res Downloaded from informahealthcare.com by University of Montreal on 12/02/14 For personal use only.
14.
15.
16.
17.
D. Huang et al. Hypertrophic versus non hypertrophic scars compared by immunohistochemistry and laser confocal microscopy: type I and III collagens. Int Wound J 2009;6:445–52. Abdou AG, Maraee AH, Al-Bara AM, Diab WM. Immunohistochemical expression of TGF-beta1 in keloids and hypertrophic scars. Am J Dermatopathol 2011;33:84–91. Fu XB, Sun TZ, Yang YH. Characteristics of bFGF and TGF-beta expression in dermal chronic ulcers and hypertrophic scars and their effects on tissue repair. Chinese J Reparative Reconstr Surg 2000;14:271–4. Xiao H, Li J. Effect of compressive stress on proliferation and apoptosis of human hyperplastic scar fibroblasts in vitro. Chinese J Reparative Reconst Surg 2007;21:1330–4. Cather JC. Hypertrophic and atrophic scars. Proc (Bayl Univ Med Cent) 2007;20:184–6. Kessler D, Dethlefsen S, Haase I, Plomann M, Hirche F, Krieg T, Eckes B. Fibroblasts in mechanically stressed collagen lattices assume a ‘‘synthetic’’ phenotype. J Biol Chem 2001;276: 36575–85. Chang LW, Deng WP, Yeong EK, Wu CY, Yeh SW. Pressure effects on the growth of human scar fibroblasts. J Burn Care Res 2008;29:835–41. Saarialho-Kere U, Kerkela¨ E, Jahkola T, Suomela S, Keski-Oja J, Lohi J. Epilysin (MMP-28) expression is associated with cell proliferation during epithelial repair. J Invest Dermatol 2002;119: 14–21. Reno F, Sabbatini M, Stella M, Magliacani G, Cannas M. Effect of in vitro mechanical compression on Epilysin (matrix metalloproteinase-28) expression in hypertrophic scars. Wound Repair Regen 2005;13:255–61. Akasaka Y, Ishikawa Y, Ono I, Fujita K, Masuda T, Asuwa N, Inuzuka K, Kiguchi H, Ishii T. Enhanced expression of caspase-3 in hypertrophic scars and keloid: induction of caspase-3 and apoptosis in keloid fibroblasts in vitro. Lab Invest 2000;80:345–57.
Connect Tissue Res, 2014; 55(5–6): 391–396
18. Zhang T, Rong XZ, Yang RH, Li TZ, Xu YB. Effect of asiaticoside on the expression of transforming growth factor-beta mRNA and matrix metalloproteinases in hypertrophic scars. J Southern Med Univ 2006;26:67–70. 19. Tan J, Fu JF. Effects of pressure therapy on the proliferation and apoptosis of cells in hypertrophic scar of burn patients. Zhonghua Shao Shang Za Zhi 2013;29:509–15. 20. Le J, Rattner A, Chepda T, Frey J, Chamson A. Production of matrix metalloproteinase 2 in fibroblast reaction to mechanical stress in a collagen gel. Arch Dermatol Res 2002;294:405–10. 21. Player DJ, Martin NR, Passey SL, Sharples AP, Mudera V, Lewis MP. Acute mechanical overload increases IGF-I and MMP-9 mRNA in 3D tissue-engineered skeletal muscle. Biotechnol Lett 2014;36:1113–24. 22. Eastwood M, Mudera VC, McGrouther DA, Brown RA. Effect of precise mechanical loading on fibroblast populated collagen lattices: morphological changes. Cell Motil Cytoskeleton 1998; 40:13–21. 23. Schiller M, Javelaud D, Mauviel A. TGF-beta-induced SMAD signaling and gene regulation: consequences for extracellular matrix remodeling and wound healing. J Dermatol Sci 2004;35: 83–92. 24. Reno F, Sabbatini M, Lombardi F, Stella M, Pezzuto C, Magliacani G, Cannas M. In vitro mechanical compression induces apoptosis and regulates cytokines release in hypertrophic scars. Wound Repair Regen 2003;11:331–6. 25. Wang X, Qian Y, Jin R, Wo Y, Chen J, Wang C, Wang D. Effects of TRAP-1-like protein (TLP) gene on collagen synthesis induced by TGF-beta/Smad signaling in human dermal fibroblasts. PLoS One 2013;8:e55899. 26. Tang B, Zhu B, Liang Y, Bi L, Hu Z, Chen B, Zhang K, Zhu J. Asiaticoside suppresses collagen expression and TGF-beta/Smad signaling through inducing Smad7 and inhibiting TGF-betaRI and TGF-betaRII in keloid fibroblasts. Arch Dermatol Res 2011;303: 563–72.
